Ecology

Associations

In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus rupestris takes over nest of Bombus lapidarius
Other: sole host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bombus rupestris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Bombus rupestris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAAATTATTTAATTCCACTAATATTAGGTTCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGACTTCTTCCCCCATCATTAATTTTATTAATTTTAAGAAATTTATTCACTCCTAATACAGGAACAGGTTGAACTATTTACCCTCCTTTATCTTCATATTTATTTCATTCATCACCTTCTGTAGATTTAACAATTTTTTCACTACACATAACAGGAATTTCTTCAATTATTGGTTCATTAAATTTTATAGTTTCAATTATAATAATAAAAAATTATTCATTAAATTATGATCAAATTAATCTATTTTCATGATCAATTTATATTACTGTAATTTTATTAACTTTATCTTTACCTGTTTTAGCAGGAGCAATTACAATATTATTATTTGATCGAAATTTTAATACATCATTTTTTGATCCAATAGGTGGTGGAGATCCTATTCTTTATCAACATCTATTTTGATTTTTTGGACATCCAGAAGTATATATTTTAATTCTTCCAGGATTTGGATTAATTTCTCAAATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTTGGAAATTTAAGAATAATTTATGCAATATTAGGAATTGGATTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTTGGTTTAGATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bombus rupestris

Bombus rupestris is a species of cuckoo bumblebee present in most of Europe except Iceland and the Balkans. It is also found in Turkey.[2]

Description[edit]

The female is much larger than the male; she has a length of 20–25 mm (0.79–0.98 in), while the drone usually is not more than 16 mm (0.63 in).[3] The bumblebee is black, with the last abdominal segments coloured orange-red.[4]

Due to its parasitic lifestyle, no workers exist.

Behaviour[edit]

Bombus rupestris is found in flower-rich habitats, such as meadows and along hedgerows.[3] The bumblebee parasitizes the nests of the red-tailed bumblebee, B. lapidarius, whose queen is killed or subjugated.[4]

References[edit]

  1. ^ "Bombus rupestris (Fabricius, 1793)". Biolib.cz. Retrieved 4 July 2012. 
  2. ^ Discover Life. "Discover Life map of Bombus rupestris". Retrieved 28 February 2009. 
  3. ^ a b Jim Lindsey (retired professor of Biostatistics). "Bombus rupestris". Retrieved 28 February 2009. [dead link]
  4. ^ a b Dr Brian Nelson, Ulster Museum. "Bombus (Psithyrus) rupestris – a cuckoo bumblebee". National Museums Northern Ireland. Retrieved 28 February 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!