Ecology

Associations

In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus sylvestris takes over nest of Bombus pratorum
Other: major host/prey

Animal / sequestrates
female of Psithyrus sylvestris takes over nest of Bombus jonellus
Other: minor host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus sylvestris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAAATTATTTAATTCCTTTAATAATAGGATCCCCTGATATAGCATTTCCACGATTAAATAACTTAAGATTTTGACTTTTACCTCCATCATTAATATTATTAATTATAAGAAATTTATTTACCCCAAATACTGGTACAGGATGAACAATTTATCCACCATTATCTTCCTATTTATTCCATTCATCCCCTTCTGTAGATTTAACTATTTTTTCATTACACATAACAGGTATTTCCTCAATTATTGGATCACTAAATTTTTTAATTTCAATTATAATAATAAAAAATTACTCAATAAATTTTGATCAAATCAATTTATTTTCTTGATCTGTTTGTATTACTGTAATTTTATTAACTTTATCTTTACCAGTTTTAGCTGGTGCAATTACAATATTATTATTTGATCGAAACTTTAATACATCATTTTTTGATCCAATAGGTGGTGGTGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTCTAATTCTACCAGGATTTGGATTAATTTCACAAATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTTGGAAATTTAAGAATAATTTATGCAATATTAGGAATTGGATTCTTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAGGATTAGATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bombus sylvestris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bombus sylvestris

Bombus sylvestris is a species of cuckoo bumblebee, that can be found in most of Europe and the Russian part of Asia.[3] Its main hosts are Bombus pratorum, Bombus jonellus and Bombus monticola.[4]

Contents

Description

Bombus sylvestris is a small bumblebee, the queen having a body length of 15 millimetres (0.59 in) and the male one of 14 millimetres (0.55 in).[5] The head is round and the proboscis (tongue) is short. Its fur is black with a yellow collar and a white tail. Sometimes the bumblebee can have a few pale hairs on top of the head, the scutellum and on tergite (abdominal segment) 1. The male can sometimes be more or less melanic, or, very rarely in northern Scotland, have a tail that is yellow instead of white.[4]

Distribution

Bombus sylvestris is present in most of Europe (including Russian Asia) from the northern half of the Iberian peninsula, southern Italy and the Balkans in the south to beyond the Arctic circle in the north, and from Ireland in the west to easternmost Russia.[3] In Britain it has a widespread but patchy distribution, the major areas being the south-east, north-eastern England and east Scotland.[4]

Ecology

The species is a cuckoo bumblebee, that instead of constructing a nest of its own usurpates nests other bumblebees. Its major host is Bombus pratorum, but Bombus jonellus and Bombus monticola are also visited.[4]

When patrolling for young queens to mate with, the males fly in circuits about 1 m above ground, marking objects with pheromones to attract the queens.[5]

The bumblebee often visits thistles and bramble. The queen also feeds on flowers as sallow, deadnettles, dandelion, bay, horse chestnut, lavender and others, while the male visits clover, green alkanet, hound's-tongue, knapweed and many others.[4]

References

  1. ^ Bombus sylvestris Lepeletier, 1833 ITIS Report
  2. ^ "Bombus sylvestris (Lepeletier, 1832)". Biolib.cz. http://www.biolib.cz/en/taxon/id70376/. Retrieved 3 July, 2012.
  3. ^ a b Pierre Rasmont. "Bombus (Psithyrus) vestalis (Fourcroy, 1785)". Université de Mons. http://zoologie.umh.ac.be/hymenoptera/pagetaxon.asp?tx_id=3060. Retrieved 6 January 2013.
  4. ^ a b c d e Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 423-425. ISBN 0007174519.
  5. ^ a b "Cuckoo bumblebees". Bumblebee.org. http://www.bumblebee.org/cuckoo.htm. Retrieved 5 January 2013.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!