Overview

Brief Summary

Biology

The name cuckoo bumblebee refers to the fact that these bees are brood parasites in the nests of other bumblebees (3). Bombus terrestris (the great earth bumblebee) is the only known host of Bombus vestalis, and the cuckoo's distribution reflects the predominantly southern distribution of its host in Britain (4) and, presumably also throughout its palaearctic range (2). Cuckoo bumblebees do not have a 'worker' caste, like other bumblebees. Instead all the hard work of brood rearing and foraging is carried out by the host colony. Mated female cuckoo bees hibernate through the winter, and emerge in the spring later than their hosts. They feed on flowers for a while before searching out a suitable host nest. They depend on finding, by sight or scent or a combination of the two, a host nest, which needs to be sufficiently advanced to have a worker population large enough to rear the cuckoo bee's offspring (2). The thick, heavily armoured cuticle of the female cuckoo bee helps to protect her from aggressive encounters with the hosts, who attempt to defend their nest (4). The cuckoo bee may put up with unfriendly attention from workers, and wait for them to calm down, before finding a quiet part of the nest to hide in. Alternatively, there may be a battle in which the cuckoo bee is either successful in killing numbers of workers, and is finally accepted, or is herself killed (9). After a time of lying low within the host colony, perhaps to take on the scent of the hosts, the cuckoo bumblebee female sets about laying eggs (4). At some stage, she will fight the host queen, who is usually killed (2). She kills host eggs and larvae and uses the wax from host cells to make her own. After the cuckoo bumblebee larvae have developed into pupae and then adults, they leave the host nest and feed on flowers. After mating occurs the females go into hibernation and the males die before the onset of winter (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Until recently, cuckoo bumblebees were once considered to belong to a separate genus (Psithyrus) in recognition of their distinctive appearance and their behaviour as parasites in the colonies of other bumblebees. Lately, experts have, by and large, agreed that all bumblebees belong to a single genus, Bombus, with Psithyrus as a subgenus (3). Cuckoo bees are similar in appearance to bumblebees, but they have a softer 'buzz', indeed Psithyrus means 'murmuring' as opposed to 'Bombus', which means 'booming'. Other differences include the lack of pollen baskets on the legs and a sparser coat of hairs, through which the shiny black cuticle can easily be seen (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Found in the Palaearctic region (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Found in a variety of habitats including gardens and grasslands. Host nests are typically made in old vole or mouse burrows in rough grassland, often beside hedges (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus vestalis takes over nest of Bombus terrestris
Other: sole host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bombus vestalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Bombus vestalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGAAATTATCTAATTCCATTAATATTAGGATCTCCTGATATAGCATTTCCACGATTAAATAATCTAAGATTTTGACTTTTACCACCATCATTAATATTACTAATTTTAAGAAATCTATTTACTCCAAATACTGGAACAGGTTGAACAATTTACCCCCCCCTATCATCTTATTTATTTCATTCATCACCTTCAATTGATTTAGCAATTTTTTCATTACATATAACAGGAATTTCTTCAATCATTGGTTCACTAAATTTTATAGTTTCAATTATAATAATAAAAAATTATTCATTAAACTTTGATCAAATTAATTTATTTTCCTGATCAATTTGTATTACTGTTATTTTATTATCTTTATCTTTACCCGTTTTAGCAGGAGCTATTACAATACTTCTATTTGATCGAAATTTTAATACATCATTCTTTGATCCAATAGGTGGAGGTGATCCAATTCTTTACCAACATTTATTCTGATTTTTTGGACATCCAGAAGTTTATATTTTAATCCTTCCAGGATTTGGATTAATTTCACAAATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTTGGAAATCTTAGTATAATTTACGCAATATTAGGTATTGGATTCTTAGGTTTTATTGTTTGAGCTCACCATATATTCACTGTAGGATTAGATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Not currently threatened (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Although this species is not threatened at present, there has been a dramatic country-wide decline in bumblebees, largely as a result of the loss of large areas of suitable farmland habitats (6). As this species depends on the presence of host colonies, it is affected by declines in the host population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The Bumblebee Working Group has produced a leaflet called Help save the bumblebee…get more buzz from your garden in order to advise householders and farmers on ways to help the bumblebees (6)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bombus vestalis

The Vestal cuckoo bumblebee (Bombus vestalis) is a species of cuckoo bumblebee that lives in most of Europe, including North Africa and western Asia.[2]

Bombus vestalis' usual host is Bombus terrestris (the buff-tailed bumblebee).

Description[edit]

The queen is a large bumblebee with a length up to 21 millimetres (0.83 in) and a wingspan of 37 millimetres (1.5 in);[3] the male is considerably smaller (16 millimetres (0.63 in)). The bumblebee is predomninantly black, with an orange collar. The third tergite (abdominal segment) has a border of yellow hairs, and the hairs on the fifth tergite are mostly white. The males are similar to the females, but smaller and with longer antennae.[4]

It is similar in appearance to another cuckoo bumblebee: Bombus bohemicus but is distinguishable by either looking at the length of the antennal segments or dissection and comparison of the genitalia. In B. vestalis the fifth antennal segment will be the same length as the third and fourth together.[5]

Distribution[edit]

The bumblebee is common from North Africa in the south to southern Sweden in the north, and from Britain in the west to northern Iran in the east.[2] It is common throughout England and Wales but has only recently (2009) been sighted in Scotland.[4] Using data from the National Biodiversity Network gateway it is apparent that B. vestalis is most prominent in South-East England.[6]

Ecology[edit]

Bombus vestalis is a cuckoo bumblebee; it does not construct any nest of its own, but usurpates the nest of Bombus terrestris, kills the host queen and lets the host workers raise its offspring.[3] The male bumblebees often congregate in gardens in the suburbs.[7]

The queen emerges early in the spring; the males later, late May to early June. Favourite food sources are flowering plants such as clover (males especially often visit white clover), tufted vetch, knapweed and others. In the spring, the emerging queens frequently fly to flowers such as, for example, deadnettles, sallows, blackthorns, and dandelions.[3]

See also[edit]

References[edit]

  1. ^ ITIS Report
  2. ^ a b Pierre Rasmont. "Bombus (Psithyrus) vestalis (Fourcroy, 1785)". Université de Mons. Retrieved 5 January 2013. 
  3. ^ a b c Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 403–406. ISBN 0007174519. 
  4. ^ a b "Cuckoo bumblebees". Bumblebee.org. Retrieved 5 January 2013. 
  5. ^ Vestal Cuckoo Bumblebee - Bombus vestalis NatureSpot
  6. ^ Grid map of records for Bombus (Psithyrus) vestalis National Biodiversity Network
  7. ^ "Bombus". Natural History Museum, London, UK. 2013. Retrieved 5 January 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!