Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The natural range is approximately Maine across southern Canada to the Dakotas and central Nebraska, south into Texas and Miami, Florida. The species has been introduced for pollination services in California and Mexico and will likely be permanently established.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Lectotype for Bombus impatiens Cresson, 1863
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;
Preparation: Pinned
Locality: Penn., Pennsylvania, United States
  • Lectotype: 1863. Proceedings of the Entomological Society of America. 2: 90.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Bombus impatiens in Illinois

Bombus impatiens Cresson: Apidae (Bombini), Hymenoptera
(observations are from Robertson, Reed, Evans, Mitchell et al., Clinebell & Bernhardt, Clinebell, Groman, Larson & Barrett, Hicks et al., Mehrhoff, Macior, Iltis, Willson & Bertin, Cane et al., Small, Reader, Daly, Costelloe, Steury et al., Smith et al., Grundel et al., Tuell et al.)

Acanthaceae: Justicia americana sn (Rb), Ruellia humilis sn (Rb); Agavaceae: Manfreda virginica cp (Grm); Anacardiaceae: Rhus copallinum [unsp fq] (Gnd); Apiaceae: Cicuta maculata sn (Rb), Eryngium yuccifolium sn (Rb, Gnd), Osmorhiza longistylis sn (Rb), Pastinaca sativa sn (Rb), Sium suave cp (Rb), Zizia aurea sn (Rb); Asclepiadaceae: Asclepias incarnata [plpr sn] (Rb), Asclepias verticillata [plpr sn] [plup sn] (Rb, WB); Asteraceae: Arctium minus sn cp (Rb), Arnoglossum atriplicifolium fq (Tll), Aster sp. (Smh), Aster anomalus sn (Rb), Aster ericoides sn fq (Rb, Re), Aster laevis fq (Tll), Aster lanceolatus sn (Rb, Re), Aster lateriflorus sn cp fq (Rb), Aster novae-angliae sn fq (Rb, Mc, Tll), Aster oolentangiensis (Re, Gnd), Aster patens (SDO), Aster pilosus sn cp fq (Rb, Mc), Aster sagittifolius sn cp fq (Rb), Aster salicifolius sn fq (Rb), Aster sericeus (Re), Aster turbinellus sn cp fq (Rb), Bidens aristosa sn cp fq (Rb), Bidens cernua sn (Rb), Bidens connata sn (Rb), Bidens frondosa sn (Rb), Boltonia asterioides sn cp (Rb), Chrysopsis villosa (Re), Cirsium altissimum sn cp (Rb), Cirsium discolor sn cp (Rb, Re), Cirsium vulgare sn fq (Rb), Coreopsis lanceolata (Gnd), Coreopsis tripteris sn (Rb, Gnd), Crepis tectorum (Re), Echinacea purpurea sn (Rb, Cl), Erigeron annuus (Gnd), Eupatoriadelphus purpureus sn fq (Rb), Eupatorium altissimum sn (Rb), Eupatorium perfoliatum sn fq (Rb, Tll), Eupatorium serotinum sn cp fq (Rb), Euthamia graminifolia sn cp fq (Rb), Helenium autumnale sn fq (Rb), Helianthus annuus sn cp fq (Rb), Helianthus divaricatus fq (Gnd), Helianthus grosseserratus sn (Rb), Helianthus strumosus fq (Tll), Heliopsis helianthoides sn (Rb), Lactuca floridana sn cp (Rb), Liatris aspera fq (Re, Gnd, Tll), Liatris pycnostachya sn cp (Rb, Cl), Liatris spicata (Gnd), Oligoneuron rigidum sn cp (Rb, Ev, Re), Prenanthes crepidinea sn cp (Rb), Pyrrhopappus caroliniana cp (Da), Ratibida pinnata fq (Tll), Rudbeckia hirta (Re), Rudbeckia laciniata sn (Rb), Silphium integrifolium sn (Rb), Silphium laciniatum (Smh), Silphium perfoliatum sn cp fq (Rb, Tll), Silphium terebinthinaceum sn cp (Rb, Gnd), Solidago spp. fq (Gnd), Solidago caesia (Gnd), Solidago canadensis sn cp fq (Rb, Re, Gnd), Solidago nemoralis sn (Rb, Ev, Re, Gnd), Solidago riddellii fq (Tll), Solidago rugosa (Gnd), Solidago simplex racemosa (SDO), Solidago speciosa sn fq (Rb, Re, Gnd, Tll), Solidago ulmifolia sn (Rb), Taraxacum officinale sn (Rb), Verbesina alternifolia sn cp (Rb), Vernonia gigantea (Gnd), Vernonia missurica fq (Tll); Balsaminaceae: Impatiens capensis sn cp (Rb), Impatiens pallida sn cp fq (Rb); Berberidaceae: Caulophyllum thalictroides sn (Rb), Podophyllum peltatum sn (Rb); Boraginaceae: Lithospermum canescens sn (Rb, Mc), Onosmodium molle (Wm); Brassicaceae: Arabis shortii sn (Rb), Dentaria laciniata sn (Rb); Caesalpiniaceae: Chamaecrista fasciculata [flwr cp fq] (Rb, Smh); Campanulaceae: Campanulastrum americanum sn (Rb), Lobelia siphilitica sn cp fq (Rb, Mc, Tll); Caprifoliaceae: Lonicera dioica sn fq (Rb), Symphoricarpos orbiculatus sn cp fq (Rb); Commelinaceae: Tradescantia pilosa cp (Rb), Tradescantia virginiensis cp (Rb); Cucurbitaceae: Cucurbita pepo sn (Rb), Sicyos angulatus [unsp sn] (Rb); Ebenaceae: Diospyros virginiana [stam sn cp] (Rb); Ericaceae: Andromeda glaucophylla (Sm, Rd), Chamaedaphne calyculata fq (Sm, Rd), Gaylussacia baccata (Sm, Gnd), Vaccinium macrocarpon (Rd), Vaccinium myrtilloides fq (Sm), Vaccinium stamineum cp fq (Cn); Fabaceae: Amorpha canescens (Re, Tll), Amphicarpaea bracteata comosa sn cp (Rb), Cercis canadensis sn (Rb), Dalea purpurea sn cp fq (Rb, Re, Smh), Dalea villosa (Re), Desmodium paniculatum cp (Rb, Gnd), Gymnocladus dioicus sn cp (Rb), Lespedeza capitata (Gnd), Lespedeza hirta fq (Tll), Melilotus alba (Re), Melilotus officinalis (Gnd), Orbexilum onobrychis sn (Rb), Robinia pseudoacacia sn fq (Rb), Trifolium pratense sn (Rb, Mc), Trifolium repens sn (Rb); Fumariaceae: Dicentra cucullaria sn (Rb); Geraniaceae: Geranium maculatum sn (Rb); Gentianaceae: Gentiana andrewsii sn cp fq (Mc, Cst), Gentianopsis crinita sn cp (Cst); Grossulariaceae: Ribes missouriense sn fq (Rb); Hippocastanaceae: Aesculus glabra sn (Rb), Aesculus hippocastanum sn fq (Rb); Hydrophyllaceae: Hydrophyllum appendiculatum sn fq (Rb), Hydrophyllum virginianum sn fq (Rb); Lamiaceae: Agastache foeniculum (Re), Agastache nepetoides sn cp fq (Rb, Tll), Blephilia ciliata sn (Rb), Blephilia hirsuta sn (Rb), Lycopus americanus sn fq (Rb), Monarda bradburiana sn (Rb), Monarda fistulosa (Ev, Re, Cl, Gnd), Monarda punctata (Gnd, Tll), Nepeta cataria sn fq (Rb, Re), Prunella vulgaris sn cp fq (Rb), Pycnanthemum pilosum (Cl), Pycnanthemum tenuifolium sn (Rb, Smh), Pycnanthemum virginianum (Re), Scutellaria incana sn cp (Rb), Stachys palustris sn (Rb), Teucrium canadense sn fq (Rb); Liliaceae: Allium canadense (Re), Allium cernuum fq (Tll), Camassia scilloides sn (Rb), Erythronium albidum sn (Rb), Uvularia grandiflora sn (Rb); Lythraceae: Lythrum alatum sn cp fq (Rb), Lythrum salicaria (Gnd); Malvaceae: Malva neglecta sn cp (Rb), Napaea dioica (Ilt); Melastomataceae: Rhexia virginica cp fq (LBt); Nelumbonaceae: Nelumbo lutea dead np (Rb); Onagraceae: Gaura biennis cp (Rb, Smh); Orchidaceae: Isotria verticillata exp np (Mhr); Polemoniaceae: Phlox divaricata laphamii sn (Rb), Phlox pilosa sn (Rb, Gnd), Polemonium reptans sn fq (Rb); Polygonaceae: Persicaria pensylvanica sn fq (Rb), Persicaria vulgaris sn (Rb); Portulacaceae: Claytonia virginica sn (Rb); Primulaceae: Dodecatheon meadia cp exp fq (Rb, Mc); Ranunculaceae: Aquilegia canadensis sn (Mc), Clematis virginiana [stam sn cp] (Rb), Delphinium tricorne sn fq (Rb, Mc); Rhamnaceae: Ceanothus americanus (Gnd); Rosaceae: Crataegus crus-galli sn (Rb), Crataegus intricata sn (Rb), Fragaria virginiana sn (Rb), Malus coronaria sn fq (Rb), Prunus americana sn (Rb), Prunus serotina [flwr sn] (Rb), Rosa carolina cp (Rb, Gnd), Rosa setigera cp (Rb, Tll), Rubus allegheniensis sn (Rb), Rubus flagellaris (Ev), Spiraea alba fq (Sm, Gnd, Tll); Rubiaceae: Cephalanthus occidentalis sn cp fq (Rb, SDO, Tll), Mitchella repens sn (Hck); Salicaceae: Salix sp. [unsp] (Gnd), Salix humilis [pist sn] (Rb); Scrophulariaceae: Agalinis purpurea sn cp (Rb, SDO), Agalinis tenuifolia sn fq (Rb), Aureolaria flava (Gnd), Aureolaria grandiflora sn cp (Rb), Aureolaria pedicularia fq (Gnd), Chelone glabra sn (Cst), Collinsia verna sn (Rb), Dasistoma macrophylla sn (Rb), Linaria vulgaris sn cp (Rb), Mimulus ringens sn (Mch), Pedicularis canadensis sn cp fq (Mc), Pedicularis lanceolata sn cp fq (Mc, Cst), Penstemon digitalis sn fq (Rb, CB), Penstemon hirsutus sn (Rb), Scrophularia marilandica sn cp fq (Rb, Tll), Tomanthera auriculata sn cp (Rb), Veronicastrum virginicum fq (Cl, Tll); Smilacaceae: Smilax tamnoides hispida sn (Rb); Solanaceae: Lycopersicon esculentum cp (Mc), Solanum carolinense cp (Rb), Solanum dulcamara cp fq (Mc), Solanum ptycanthum cp (Rb); Staphyleaceae: Staphylea trifolia sn fq (Rb); Verbenaceae: Verbena hastata sn cp (Rb), Verbena stricta sn fq (Rb, Tll), Verbena urticifolia sn (Rb); Violaceae: Viola cucullata sn np (Rb), Viola pedata sn (Rb), Viola striata sn np (Rb); Vitaceae: Vitis riparia cp (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Very likely millions of colonies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus impatiens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATGATATATTTTATTTTTGCTATATGATCAGGAATAATCGGATCATCAATAAGATTATTAATTCGAATAGAACTTAGACATCCAGGAATATGAATTAATAATGATCAAATTTATAATTCATTAGTTACAAGACATGCATTTTTAATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGATTCGGAAATTATTTAATTCCTTTAATATTAGGATCACCTGATATAGCTTTTCCACGAATAAATAATATTAGATTTTGATTATTACCTCCATCTATTTTTATATTATTATTAAGAACTTTATTTACACCTAATGTAGGAACAGGTTGAACCGTATATCCCCCTTTATCATCTTATTTATTTCATTCATCACCTTCAGTAGATATTGCAATTTTTTCTTTACATGTAACAGGAATTTCTTCTATTATTGGTTCATTAAATTTTATCGTTGCTATTATATTAATAAAAAATTTTTCATTAAATTATGATCAAATTACTTTATTTTCATGATCTGTATGTATTACAGTATTATTATTAATTTTATCATTACCAGTTTTAGCAGGAGCAATTACTATACTTCTTTTTGATCGAAATTTTAATACATCATTTTTTGATCCAATAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bombus impatiens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 47
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This and other bumblebees in its subgenus are apparently not among those experiencing recent declines in North America. B. impatiens is a significant crop pollinator and is somewhat domesticated. It is transported beyond its native range for crop pollination and probably has or will become established outside its native range. This species may benefit from the demise of some of the other bumblebees. For now this very common bee is assigned a conservation status rank of G5, despite some reluctance to apply that rank to any bumblebees until the exact causes for declines are better understood. All evidence suggests this species is unaffected by most of these causes, and it does very well in disturbed landscapes. For now, nearly all evidence indicates that this species is stable to increasing in its native range. Its status should be periodically updated, but among bumblebees this one is probably the big winner among changes in recent years.

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10-25% to decline of 30%

Comments: Probably more or less stable overall, but Colla and Packer (2008) documented an increase in Ontario, while Michael Arbuster (pers. comm. to D. Schweitzer, September 5, 2008) noted that the species had been common through 2007 in Missouri but was scarce in 2008. This of course could just have been a natural locally bad year and no other reports of decline were found. Williams et al. (2009) also indicate a substantial increase in Ontario. This species is also now domesticated and (unfortunately perhaps) probably established where it is not native.

Global Long Term Trend: Relatively stable to increase of >25%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Low

Comments: This species, and probably this subgenus, appears to be only mildly to sub-lethally affected by pathogens that are thought to be the main cause for the annihilation of subgenus Bombus in many places. In fact, B. impatiens reared in Europe and returned to North America for pollination services, were probably the source of the pathogen. In addition, the species adapts well to a variety of habitats, nectar sources, and climates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Besides occurring on many protected or otherwise secure lands, this species is also cultivated for pollination services.

Needs: There may be a need to protect other species from harmful (such as competition) to catastrophic (such as pathogen spillover) impacts from this species by curtailing widespread introduction of Bombus impatiens beyond its native range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common eastern bumblebee

The common eastern bumblebee (Bombus impatiens) is the most often encountered bumblebee across much of eastern North America.[2] Its range includes Ontario, Maine, Georgia, Kentucky, Maryland, New Jersey, New York, Pennsylvania, South Carolina, North Carolina, Virginia, West Virginia, south to Florida, west to Michigan, Illinois, Kansas, Missouri, and Wyoming.[3]

Queen and drone mating

References[edit]

  1. ^ "Bombus impatiens". Integrated Taxonomic Information System. 
  2. ^ "Species Bombus impatiens - Common Eastern Bumble Bee". bugguide.net. Retrieved October 2, 2011. 
  3. ^ "North American bumblebees". Bumblebees.org. Retrieved October 2, 2011. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Pyrobombus

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!