Overview

Brief Summary

The common eastern bumble bee (Bombus impatiens) is so named because it is native to the eastern part of North America. They are native from Ontario to Maine and south to Florida; introduced in California and in British Columbia, Canada.

Queen bees are larger than both the drones and workers, ranging from 17 to 21 mm long. Drones are between 12 and 17 mm long and typically black. Workers are between 8.5 and 16 mm long and resemble the queen.

Bombus impatiens nest in open fields and woods.

  • Bombus impatiens Cresson, 1863 (Discover Life)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The natural range is approximately Maine across southern Canada to the Dakotas and central Nebraska, south into Texas and Miami, Florida. The species has been introduced for pollination services in California and Mexico and will likely be permanently established.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Lectotype for Bombus impatiens Cresson, 1863
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;
Preparation: Pinned
Locality: Penn., Pennsylvania, United States
  • Lectotype: 1863. Proceedings of the Entomological Society of America. 2: 90.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Bombus impatiens in Illinois

Bombus impatiens Cresson: Apidae (Bombini), Hymenoptera
(observations are from Robertson, Reed, Evans, Mitchell et al., Clinebell & Bernhardt, Clinebell, Groman, Larson & Barrett, Hicks et al., Mehrhoff, Macior, Iltis, Willson & Bertin, Cane et al., Small, Reader, Daly, and Costelloe)

Acanthaceae: Justicia americana sn (Rb), Ruellia humilis sn (Rb); Agavaceae: Manfreda virginica cp (Grm); Apiaceae: Cicuta maculata sn (Rb), Eryngium yuccifolium sn (Rb), Osmorhiza longistylis sn (Rb), Pastinaca sativa sn (Rb), Sium suave cp (Rb), Zizia aurea sn (Rb); Asclepiadaceae: Asclepias incarnata [plpr sn] (Rb), Asclepias verticillata [plpr sn] [plup sn] (Rb, WB); Asteraceae: Arctium minus sn cp (Rb), Aster anomalus sn (Rb), Aster ericoides sn fq (Rb, Re), Aster lanceolatus sn (Rb, Re), Aster lateriflorus sn cp fq (Rb), Aster novae-angliae sn (Rb, Mc), Aster oolentangiensis (Re), Aster pilosus sn cp fq (Rb, Mc), Aster sagittifolius sn cp fq (Rb), Aster salicifolius sn fq (Rb), Aster sericeus (Re), Aster turbinellus sn cp fq (Rb), Bidens aristosa sn cp fq (Rb), Bidens cernua sn (Rb), Bidens connata sn (Rb), Bidens frondosa sn (Rb), Boltonia asterioides sn cp (Rb), Chrysopsis villosa (Re), Cirsium altissimum sn cp (Rb), Cirsium discolor sn cp (Rb, Re), Cirsium vulgare sn fq (Rb), Coreopsis tripteris sn (Rb), Crepis tectorum (Re), Echinacea purpurea sn (Rb, Cl), Eupatoriadelphus purpureus sn fq (Rb), Eupatorium altissimum sn (Rb), Eupatorium perfoliatum sn (Rb), Eupatorium serotinum sn cp fq (Rb), Euthamia graminifolia sn cp fq (Rb), Helenium autumnale sn fq (Rb), Helianthus annuus sn cp fq (Rb), Helianthus grosseserratus sn (Rb), Heliopsis helianthoides sn (Rb), Lactuca floridana sn cp (Rb), Liatris aspera (Re), Liatris pycnostachya sn cp (Rb, Cl), Oligoneuron rigidum sn cp (Rb, Ev, Re), Prenanthes crepidinea sn cp (Rb), Pyrrhopappus caroliniana cp (Da), Rudbeckia hirta (Re), Rudbeckia laciniata sn (Rb), Silphium integrifolium sn (Rb), Silphium perfoliatum sn cp fq (Rb), Silphium terebinthinaceum sn cp (Rb), Solidago canadensis sn cp fq (Rb, Re), Solidago nemoralis sn (Rb, Ev, Re), Solidago speciosa sn (Rb, Re), Solidago ulmifolia sn (Rb), Taraxacum officinale sn (Rb), Verbesina alternifolia sn cp (Rb); Balsaminaceae: Impatiens capensis sn cp (Rb), Impatiens pallida sn cp fq (Rb); Berberidaceae: Caulophyllum thalictroides sn (Rb), Podophyllum peltatum sn (Rb); Boraginaceae: Lithospermum canescens sn (Rb, Mc), Onosmodium molle (Wm); Brassicaceae: Arabis shortii sn (Rb), Dentaria laciniata sn (Rb); Caesalpiniaceae: Chamaecrista fasciculata [flwr cp] (Rb); Campanulaceae: Campanulastrum americanum sn (Rb), Lobelia siphilitica sn cp fq (Rb, Mc); Caprifoliaceae: Lonicera dioica sn fq (Rb), Symphoricarpos orbiculatus sn cp fq (Rb); Commelinaceae: Tradescantia pilosa cp (Rb), Tradescantia virginiensis cp (Rb); Cucurbitaceae: Cucurbita pepo sn (Rb), Sicyos angulatus [unsp sn] (Rb); Ebenaceae: Diospyros virginiana [stam sn cp] (Rb); Ericaceae: Andromeda glaucophylla (Sm, Rd), Chamaedaphne calyculata fq (Sm, Rd), Gaylussacia baccata (Sm), Vaccinium macrocarpon (Rd), Vaccinium myrtilloides fq (Sm), Vaccinium stamineum cp fq (Cn); Fabaceae: Amorpha canescens (Re), Amphicarpaea bracteata comosa sn cp (Rb), Cercis canadensis sn (Rb), Dalea purpurea sn cp fq (Rb, Re), Dalea villosa (Re), Desmodium paniculatum cp (Rb), Gymnocladus dioicus sn cp (Rb), Melilotus alba (Re), Orbexilum onobrychis sn (Rb), Robinia pseudoacacia sn fq (Rb), Trifolium pratense sn (Rb, Mc), Trifolium repens sn (Rb); Fumariaceae: Dicentra cucullaria sn (Rb); Geraniaceae: Geranium maculatum sn (Rb); Gentianaceae: Gentiana andrewsii sn cp fq (Mc, Cst), Gentianopsis crinita sn cp (Cst); Grossulariaceae: Ribes missouriense sn fq (Rb); Hippocastanaceae: Aesculus glabra sn (Rb), Aesculus hippocastanum sn fq (Rb); Hydrophyllaceae: Hydrophyllum appendiculatum sn fq (Rb), Hydrophyllum virginianum sn fq (Rb); Lamiaceae: Agastache foeniculum (Re), Agastache nepetoides sn cp fq (Rb), Blephilia ciliata sn (Rb), Blephilia hirsuta sn (Rb), Lycopus americanus sn fq (Rb), Monarda bradburiana sn (Rb), Monarda fistulosa (Ev, Re, Cl), Nepeta cataria sn fq (Rb, Re), Prunella vulgaris sn cp fq (Rb), Pycnanthemum pilosum (Cl), Pycnanthemum tenuifolium sn (Rb), Pycnanthemum virginianum (Re), Scutellaria incana sn cp (Rb), Stachys palustris sn (Rb), Teucrium canadense sn fq (Rb); Liliaceae: Allium canadense (Re), Camassia scilloides sn (Rb), Erythronium albidum sn (Rb), Uvularia grandiflora sn (Rb); Lythraceae: Lythrum alatum sn cp fq (Rb); Malvaceae: Malva neglecta sn cp (Rb), Napaea dioica (Ilt); Melastomataceae: Rhexia virginica cp fq (LBt); Nelumbonaceae: Nelumbo lutea dead np (Rb); Onagraceae: Gaura biennis cp (Rb); Orchidaceae: Isotria verticillata exp np (Mhr); Polemoniaceae: Phlox divaricata laphamii sn (Rb), Phlox pilosa sn (Rb), Polemonium reptans sn fq (Rb); Polygonaceae: Persicaria pensylvanica sn fq (Rb), Persicaria vulgaris sn (Rb); Portulacaceae: Claytonia virginica sn (Rb); Primulaceae: Dodecatheon meadia cp exp fq (Rb, Mc); Ranunculaceae: Aquilegia canadensis sn (Mc), Clematis virginiana [stam sn cp] (Rb), Delphinium tricorne sn fq (Rb, Mc); Rosaceae: Crataegus crus-galli sn (Rb), Crataegus intricata sn (Rb), Fragaria virginiana sn (Rb), Malus coronaria sn fq (Rb), Prunus americana sn (Rb), Prunus serotina [flwr sn] (Rb), Rosa carolina cp (Rb), Rosa setigera cp (Rb), Rubus allegheniensis sn (Rb), Rubus flagellaris (Ev), Spiraea alba (Sm); Rubiaceae: Cephalanthus occidentalis sn cp fq (Rb), Mitchella repens sn (Hck); Salicaceae: Salix humilis [pist sn] (Rb); Scrophulariaceae: Agalinis purpurea sn cp (Rb), Agalinis tenuifolia sn fq (Rb), Aureolaria grandiflora sn cp (Rb), Chelone glabra sn (Cst), Collinsia verna sn (Rb), Dasistoma macrophylla sn (Rb), Linaria vulgaris sn cp (Rb), Mimulus ringens sn (Mch), Pedicularis canadensis sn cp fq (Mc), Pedicularis lanceolata sn cp fq (Mc, Cst), Penstemon digitalis sn fq (Rb, CB), Penstemon hirsutus sn (Rb), Scrophularia marilandica sn cp fq (Rb), Tomanthera auriculata sn cp (Rb), Veronicastrum virginicum fq (Cl); Smilacaceae: Smilax tamnoides hispida sn (Rb); Solanaceae: Lycopersicon esculentum cp (Mc), Solanum carolinense cp (Rb), Solanum dulcamara cp fq (Mc), Solanum ptycanthum cp (Rb); Staphyleaceae: Staphylea trifolia sn fq (Rb); Verbenaceae: Verbena hastata sn cp (Rb), Verbena stricta sn fq (Rb), Verbena urticifolia sn (Rb); Violaceae: Viola cucullata sn np (Rb), Viola pedata sn (Rb), Viola striata sn np (Rb); Vitaceae: Vitis riparia cp (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Very likely millions of colonies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology of pollination- changes in recent decades

Seasonal temperature changes are an important factor in determining when plants come into bloom. If there are significant changes in annual temperature cycles over time, the blooming schedule can be altered worldwide. This begs an important question for plant pollination. Have the insects and other animals that service animal-pollinated plants altered their behavioral calendar in a similar way?

Using historical museum datasets and recent bee-monitoring data, North American researchers have examined this question in ten species of wild bees: Colletes inaequalis, Andrena crataegi, Andrena carlini, Andrena miserabilis, Osmia pumila, Osmia bucephala, Osmia atriventris, Osmia lignaria, Bombus impatiens, and Bombus bimaculatus. Over the past 130 years, there has been a significant shift toward emergence earlier in the Spring among these bees, which average approximately ten days earlier now than in the late 1800s. This trend was most pronounced in the last forty years.(Bartomeus et al, 2011)

Does this shift resemble a shift in the bloom schedule of the plants these bees visit? Changes in plant bloom times in response to climate change have been a subject of intensive study recently and data is available through several studies of native plants in North America, from herbarium records and monitoring programs (Miller-Rushing et al, 2006; Primack et al, 2004; Bradley et al, 1999; Cook et al, 2008). Among 106 native plants that are visited by these ten bee species, there is also a significant trend toward earlier flowering. This trend also became more pronounced in the last forty years.(Bartomeus et al, 2011)

Do these two shifts mean that bees will continue to be active during appropriate periods to take advantage of the bloom calendar? That is difficult to say. Emergence and bloom dates are quite variable, and all ten of these bee species visit many different species of plant, which have different bloom calendars. Another important research question: do schedule shifts also correspond for specialist plant-pollinator pairs, where a single species of animal visits a single species of plant?

  • Ignasi Bartomeusa, John S. Ascherb, David Wagnerc, Bryan N. Danforthd, Sheila Collae, Sarah Kornbluthb, and Rachael Winfreea. 2011. Climate-associated phenological advances in bee pollinators and bee-pollinated plants. Proceedings of the National Academy of Science, 108(51): 20645-20649
  • Miller-Rushing AJ, Primack RB, Primack D, Mukunda S. 2006. Photographs and herbarium specimens as tools to document phenological changes in response to global warming. Am J Bot 93:1667–1674.
  • Primack D, Imbres C, Primack RB, Miller-Rushing AJ, Del Tredici P. 2004. Herbarium specimens demonstrate earlier flowering times in response to warming in Boston. Am J Bot 91:1260–1264.
  • Bradley NL, Leopold AC, Ross J, Huffaker W. 1999. Phenological changes reflect climate change in Wisconsin. Proc Natl Acad Sci USA 96:9701–9704.
  • Cook BI, Cook ER, Huth PC, Thompson JE, Smiley D. 2008. A cross-taxa phenological dataset from Mohonk Lake, NY and its relationship to climate. Int J Climatol 1383: 1369–1383.
Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Bumble bees are social bees and have annual nests. A queen will emerge from hibernation in early spring and start her own colony. Worker bees develop first, followed by males and new queens towards the end of summer. A bumble bee nest often contains between 300 and 500 individuals. Newly mated queens will hibernate in the ground over winter; worker bees, males, and the old queen die in the fall. Bumble bees eat only nectar and pollen and do not produce large amounts of honey.

  • Bombus impatiens Cresson, 1863 (Discover Life)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus impatiens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATGATATATTTTATTTTTGCTATATGATCAGGAATAATCGGATCATCAATAAGATTATTAATTCGAATAGAACTTAGACATCCAGGAATATGAATTAATAATGATCAAATTTATAATTCATTAGTTACAAGACATGCATTTTTAATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGATTCGGAAATTATTTAATTCCTTTAATATTAGGATCACCTGATATAGCTTTTCCACGAATAAATAATATTAGATTTTGATTATTACCTCCATCTATTTTTATATTATTATTAAGAACTTTATTTACACCTAATGTAGGAACAGGTTGAACCGTATATCCCCCTTTATCATCTTATTTATTTCATTCATCACCTTCAGTAGATATTGCAATTTTTTCTTTACATGTAACAGGAATTTCTTCTATTATTGGTTCATTAAATTTTATCGTTGCTATTATATTAATAAAAAATTTTTCATTAAATTATGATCAAATTACTTTATTTTCATGATCTGTATGTATTACAGTATTATTATTAATTTTATCATTACCAGTTTTAGCAGGAGCAATTACTATACTTCTTTTTGATCGAAATTTTAATACATCATTTTTTGATCCAATAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bombus impatiens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 47
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This and other bumblebees in its subgenus are apparently not among those experiencing recent declines in North America. B. impatiens is a significant crop pollinator and is somewhat domesticated. It is transported beyond its native range for crop pollination and probably has or will become established outside its native range. This species may benefit from the demise of some of the other bumblebees. For now this very common bee is assigned a conservation status rank of G5, despite some reluctance to apply that rank to any bumblebees until the exact causes for declines are better understood. All evidence suggests this species is unaffected by most of these causes, and it does very well in disturbed landscapes. For now, nearly all evidence indicates that this species is stable to increasing in its native range. Its status should be periodically updated, but among bumblebees this one is probably the big winner among changes in recent years.

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10-25% to decline of 30%

Comments: Probably more or less stable overall, but Colla and Packer (2008) documented an increase in Ontario, while Michael Arbuster (pers. comm. to D. Schweitzer, September 5, 2008) noted that the species had been common through 2007 in Missouri but was scarce in 2008. This of course could just have been a natural locally bad year and no other reports of decline were found. Williams et al. (2009) also indicate a substantial increase in Ontario. This species is also now domesticated and (unfortunately perhaps) probably established where it is not native.

Global Long Term Trend: Relatively stable to increase of >25%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Low

Comments: This species, and probably this subgenus, appears to be only mildly to sub-lethally affected by pathogens that are thought to be the main cause for the annihilation of subgenus Bombus in many places. In fact, B. impatiens reared in Europe and returned to North America for pollination services, were probably the source of the pathogen. In addition, the species adapts well to a variety of habitats, nectar sources, and climates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Besides occurring on many protected or otherwise secure lands, this species is also cultivated for pollination services.

Needs: There may be a need to protect other species from harmful (such as competition) to catastrophic (such as pathogen spillover) impacts from this species by curtailing widespread introduction of Bombus impatiens beyond its native range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Pollinator

After populations of the western bumble bee (Bombus occidentalis) were decimated by the introduction of exotic disease organisms, the Animal and Plant Health Inspection Service (APHIS) allowed transportation and introduction of the common eastern bumble bee into the western United States in 1998. This species was also allowed into British Columbia in 1999. However, there are concerns about the effects of importing this non-native bee species into the western United States, specifically in California. The Xerces Society for Invertebrate Conservation filed comments against the effort, citing unknown outcomes and ecological risks associated with importation of the bee.

These bumble bees are reared commercially and they are important pollinators of greenhouse tomatoes and blueberries, with research showing positive correlations between the density of common eastern bumble bees and blueberry fruit set as well as the number of large seeds per berry up to 150 m from the hive. Of the three commercially available pollinators of Maine blueberries - honey bees (Apis mellifera), alfalfa leafcutter bees (Megachile rotundata), and common eastern bumble bees (Bombus impatiens) - the common eastern bumble bee may be the most efficient pollinator. It pollinates flowers faster than and at cooler temperatures than honey and alfalfa leafcutter bees and is more faithful to the blueberry crop, even if alternate forage is available. Additionally, common eastern bumble bees will fly in moderate rain. The common eastern bumble bee is at least two to 10 times more efficient at pollinating blueberry than one honey bee. However, common eastern bumble bee colonies are more expensive to use than honey and alfalfa leafcutter bees because they can be used during only one season. These bees are also important pollinators of prairie ecosystems, preferring to forage on Culver's root (Veronicastrum virginicum) but also pollinating wild bergamot (Monarda fistulosa) and aster (Asteraceae) in late summer.
  • Wild Blueberry Fact Sheet: Commercial Bumble Bee (Bombus impatiens) Management for Wild Blueberry Pollination, C. S. Stubbs, F. A. Drummond, and D. E. Yarborough, The University of Maine, January 2000
  • Importation of Non-Native Bumble Bees into North America: Potential Consequences of Using Bombus terrestris and Other Non-Native Bumble Bees for Greenhouse Crop Pollination in Canada, Mexico, and the United States, K. Winter, L. Adams, R. Thorp, D. Inouye, L. Day, J. Ascher, and S. Buchmann, North American Pollinator Protection Campaign, August 2006
  • The Xerces Society opposes introduction of non-native bumble bees into California, The Xerces Society
  • Bombus impatiens Cresson, 1863, Discover Life
  • Foraging Ecology of Selected Prairie Wildflowers (Echinacea, Liatris, Monarda, and Veronicastrum) in Missouri Prairie Remnants and Restorations, Richard R. Clinebell, Litzsinger Road Ecology Center
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bombus impatiens

The common eastern bumblebee (Bombus impatiens) is the most often encountered bumblebee across much of eastern North America.[2] Its range includes Ontario, Maine, Georgia, Kentucky, Maryland, New Jersey, New York, Pennsylvania, South Carolina, North Carolina, Virginia, West Virginia, south to Florida, west to Michigan, Illinois, Kansas, Missouri, and Wyoming.[3]

Queen and drone mating

References[edit]

  1. ^ "Bombus impatiens". Integrated Taxonomic Information System. 
  2. ^ "Species Bombus impatiens - Common Eastern Bumble Bee". bugguide.net. Retrieved October 2, 2011. 
  3. ^ "North American bumblebees". Bumblebees.org. Retrieved October 2, 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Pyrobombus

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!