Overview

Brief Summary

Biology

Nests are commonly constructed underground in disused rodent nests, or similar protected positions where there is available material for insulation (2). The queen creates a circular chamber in which she builds a wax egg cell, and she lays her first batch of eggs inside. The eggs are laid on a layer of pollen, which is collected by the queen, and then covered with a layer of wax (6). After hatching, the white larvae are fed on honey and pollen by the queen. When they are fully-grown, the larvae cease to feed and develop into pupae after spinning a protective silk cocoon around themselves. During the pupal stage, the larvae undergo complex changes, and develop into adult workers. Throughout their development, the queen incubates this first brood by lying over the cell in which they grow, keeping them warm with the heat of her body (3), which in turn is produced by the metabolism of sugars derived from the nectar she collects (2).  After emerging, the workers undertake the duties of foraging and nest care, and the queen remains inside the nest, producing further batches of eggs. When the colony reaches its peak, males and new queens are produced. Males develop from unfertilised eggs; after leaving the nest they fly around in search of new queens with which to mate (3). After mating, the new queens search for a place to hibernate. The colony, together with the old queen, gradually dies out in autumn, and the newly mated queens emerge from hibernation the following spring, to establish new colonies (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The white-tailed bumblebee (Bombus lucorum) is a common species that is easily confused with the similar species Bombus magnus (3). Work is on-going to determine whether these bees are actually the same species (4). Queens and workers of B. lucorum and B. magnus have bright lemon or creamy yellow stripes with a white tail that may have a pinkish flush. In both species there is a yellow 'collar', which is narrower in B. lucorum, but extends below the bases of the wings in B. magnus. Furthermore, the queens of B. lucorum are often small in relation to those of B. magnus (3). There is no known way of distinguishing the males of the two species. They have pure white tails, and a long and uneven covering of hairs. The hair on the face is black, yellow or a mixture of the two colours, and there may also be yellow hair on the thorax (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

This bumblebee has a wide range, and is known in the Palaearctic, Oriental, Arctic, and western Nearctic regions as well as Japan. It is generally commoner in more northerly regions. It occurs in Iceland, where it has probably been introduced by humans (5). It is widespread throughout Britain, whereas B. magnus is found only in the west and north of Britain (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Bombus lucorum is found in a wide variety of habitats, and often occurs in gardens (3). B. magnus is restricted to northerly and western parts of Britain and is associated with upland and moorland habitats (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasitoid / endoparasitoid
solitary larva of Physocephala rufipes is endoparasitoid of adult of Bombus lucorum

In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus bohemicus takes over nest of Bombus lucorum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bombus lucorum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 85
Specimens with Barcodes: 123
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Bombus lucorum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 88 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGATTTGGAAATTATTTAATTCCATTAATA---CTAGGATCACCAGATATAGCTTTCCCTCGAATAAATAATATTAGATTTTGACTTTTACCTCCATCATTATTTATATTATTATTAAGAAATTTATTTACACCTAATGTAGGTACAGGATGAACTGTTTACCCTCCTTTATCTTCATATTTATTTCATTCATCCCCATCAATTGATATT---GCAATTTTTTCCTTACATATATCAGGAATTTCTTCTATTATTGGATCATTAAATTTTATTGTTACTATTTTAATAATAAAAAATTTTTCATTAAATTATGATCAAATTAACTTATTTTCATGATCAGTATGTATTACTGTAATTTTATTAATTTTATCTTTACCAGTATTAGCTGGA---GCAATTACTATATTACTTTTTGATCGAAATTTTAATACCTCATTTTTTGACCCTATAGGTGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGGCACCCAGAAGTATATATTTTAATTTTACCGGGATTTGGATTAATTTCGCAAGTTATTATAAATGAAAGAGGTAAAAAA---GAAACCTTTGGAAATTTAAGAATAATTTATGCTATATTAGGAATTGGATTTTTAGGATTTATTGTTTGAGCTCACCATATATTTACTGTTGGATTAGATGTAGATACACGAGCATATTTTACATCTGCTACAATAATTATTGCTGTACCTACAGGAATTAAAGTTTTTAGATGATTA---GCTACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Common (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Although this species is not currently threatened in Britain, many British bumblebee species, including this one, have undergone a worrying decline, largely as a result of changes in agricultural practices leading to a loss of open habitats, nesting and hibernation sites, as well as important food plants (2) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted directly at this species. However, concern over the decline of our bumblebee populations has caused steps to be taken. English Nature has produced a leaflet called 'help save the bumblebee', which includes advice on how to make your garden attractive to bumblebees (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bombus lucorum

The white-tailed bumblebee (Bombus lucorum) is a species of bumblebee that is widespread and common throughout Europe. However, the name has been widely used for many of a complex of nearly identical-looking or cryptic species of bumblebees. A recent review of all of these species worldwide has helped to clarify its distribution in Europe and northern Asia, almost to the Pacific.[2] In the north it reaches the Barent's Sea. In southern Europe, however, it is an upland species, its distribution never quite reaching the Mediterranean.[3]

Description[edit]

Bombus lucorum is a large bumblebee, the queen having a length of 18–22 mm (0.71–0.87 in) and a wingspan of around 36 mm (1.4 in). The workers are normally somewhat smaller. The species has a short proboscis (tongue). The predominating colour is black, with a pale yellow collar, another yellow band on the second tergite (abdominal segment), and a white tail. Both darker and paler forms exist.[4]

Yellow-haired male feeding from Lamium album "deadnettle" flowers

Ecology[edit]

The hibernating queen emerges very early, in southern Britain usually in March. The nest, which can be very large, up to 400 workers, is usually built underground, often in disused rodent nests. As many other bumblebee males, the males fly in a low patrolling circuit, depositing pheromones on grass to attract young queens. The bumblebee visits many flowers, including many garden plants, as lavender, Hebe, Rhododendron, deadnettles, thistles, and vetches.[4]

References[edit]

  1. ^ "White-tailed Bumble Bee Bombus lucorum (Linnaeus, 1761)". Biolib.cz. Retrieved 3 July 2012. 
  2. ^ P. H. Williams et al. (2012). "Unveiling cryptic species of the bumblebee subgenus Bombus s. str. world-wide with COI barcodes". Systematics and Biodiversity 10: 21–56. Retrieved 30 May 2012. 
  3. ^ Pierre Rasmont. "Bombus (Bombus) lucorum (Linnaeus, 1761)". Université de Mons. Retrieved 2 January 2013. 
  4. ^ a b Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 316–321. ISBN 0007174519. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!