Overview

Brief Summary

Biology

Nests are commonly constructed underground in disused rodent nests, or similar protected positions where there is available material for insulation (2). The queen creates a circular chamber in which she builds a wax egg cell, and she lays her first batch of eggs inside. The eggs are laid on a layer of pollen, which is collected by the queen, and then covered with a layer of wax (6). After hatching, the white larvae are fed on honey and pollen by the queen. When they are fully-grown, the larvae cease to feed and develop into pupae after spinning a protective silk cocoon around themselves. During the pupal stage, the larvae undergo complex changes, and develop into adult workers. Throughout their development, the queen incubates this first brood by lying over the cell in which they grow, keeping them warm with the heat of her body (3), which in turn is produced by the metabolism of sugars derived from the nectar she collects (2).  After emerging, the workers undertake the duties of foraging and nest care, and the queen remains inside the nest, producing further batches of eggs. When the colony reaches its peak, males and new queens are produced. Males develop from unfertilised eggs; after leaving the nest they fly around in search of new queens with which to mate (3). After mating, the new queens search for a place to hibernate. The colony, together with the old queen, gradually dies out in autumn, and the newly mated queens emerge from hibernation the following spring, to establish new colonies (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The white-tailed bumblebee (Bombus lucorum) is a common species that is easily confused with the similar species Bombus magnus (3). Work is on-going to determine whether these bees are actually the same species (4). Queens and workers of B. lucorum and B. magnus have bright lemon or creamy yellow stripes with a white tail that may have a pinkish flush. In both species there is a yellow 'collar', which is narrower in B. lucorum, but extends below the bases of the wings in B. magnus. Furthermore, the queens of B. lucorum are often small in relation to those of B. magnus (3). There is no known way of distinguishing the males of the two species. They have pure white tails, and a long and uneven covering of hairs. The hair on the face is black, yellow or a mixture of the two colours, and there may also be yellow hair on the thorax (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) According the the Discover Life Website visited in March 2010 this species occurs in Iceland, widely throughout Europe and across Asia to central Siberia, Korea, India, widely in China, and Japan. In North America the species is mainly found in alaska and western Canada east at about 61 North to Great Slave Lake and south to Banff, Alberta and southern British columbia. They also list a 1922 Oregon specimen and a poorly documented record from Utah. Bumblebee.org does not include any US state except Alaska in their range summary.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This bumblebee has a wide range, and is known in the Palaearctic, Oriental, Arctic, and western Nearctic regions as well as Japan. It is generally commoner in more northerly regions. It occurs in Iceland, where it has probably been introduced by humans (5). It is widespread throughout Britain, whereas B. magnus is found only in the west and north of Britain (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Bombus lucorum is found in a wide variety of habitats, and often occurs in gardens (3). B. magnus is restricted to northerly and western parts of Britain and is associated with upland and moorland habitats (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasitoid / endoparasitoid
solitary larva of Physocephala rufipes is endoparasitoid of adult of Bombus lucorum

In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus bohemicus takes over nest of Bombus lucorum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombus lucorum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 88 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGATTTGGAAATTATTTAATTCCATTAATA---CTAGGATCACCAGATATAGCTTTCCCTCGAATAAATAATATTAGATTTTGACTTTTACCTCCATCATTATTTATATTATTATTAAGAAATTTATTTACACCTAATGTAGGTACAGGATGAACTGTTTACCCTCCTTTATCTTCATATTTATTTCATTCATCCCCATCAATTGATATT---GCAATTTTTTCCTTACATATATCAGGAATTTCTTCTATTATTGGATCATTAAATTTTATTGTTACTATTTTAATAATAAAAAATTTTTCATTAAATTATGATCAAATTAACTTATTTTCATGATCAGTATGTATTACTGTAATTTTATTAATTTTATCTTTACCAGTATTAGCTGGA---GCAATTACTATATTACTTTTTGATCGAAATTTTAATACCTCATTTTTTGACCCTATAGGTGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGGCACCCAGAAGTATATATTTTAATTTTACCGGGATTTGGATTAATTTCGCAAGTTATTATAAATGAAAGAGGTAAAAAA---GAAACCTTTGGAAATTTAAGAATAATTTATGCTATATTAGGAATTGGATTTTTAGGATTTATTGTTTGAGCTCACCATATATTTACTGTTGGATTAGATGTAGATACACGAGCATATTTTACATCTGCTACAATAATTATTGCTGTACCTACAGGAATTAAAGTTTTTAGATGATTA---GCTACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bombus lucorum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 85
Specimens with Barcodes: 122
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NU - Unrankable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This is among the most common bumble bees in the world, perhaps especially in Europe, and no major declines have been noted. However, it should be noted that of the four other species in this subgenus in North America, one is possibly extinct, one has at least declined drastically and may be on the brink, and two others have declined but still persist in some places. The severity of threat to North American populations of B. lucorum, which occur mostly in remote far northern or high mountain areas, over the next few decades is essentially unknown. Introduced pathogens and parasites are widely credited with driving these declines, but there is some uncertainty. Bombus (Bombus) lucorum and the closely related B. (B.) terrestris are among the natural hosts for the microsporidian Nosema bombi which infects both species from at least Sweden (Larsson, 2007) to China (Jilian et al., 2005) and both bees remain common. These Eurasian bees presumably have co-existed with this pathogen for at least thousands of years. However, European N. bombi were probably introduced to North America in about 1992 and was probably a major factor in the major declines of four species of this subgenus that began about the same time. It cannot be assumed with confidence that North American B. lucorum will prove as resistant to supposedly introduced Nosema as European and Asian populations, and it is also not known if they harbor any sort of related, native microsporidians. It is also possible that some other factor is driving declines in subgenus Bombus. So while a G5 rank is warranted for the species as a whole, it may or may not be secure in Alaska and Canada. The level of threat there, if any, is currently unknown. Only time will tell, status will probably become clearer by about 2020. Populations should be monitored where some occur in more readily accessible parts of southwestern Canada, e.g. around Banff.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: There is a lot of information for Europe, less for elsewhere. No references reviewed suggested any large scale decline of this species which is among the two most common bumblebees in much of Europe. In North America it occurs mostly in cold remote areas where it presumably is also stable.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Threats are low in much of the Eurasian range, but unknown would be a better assessment for North America where populations may or may not be resistant to an apparently recently introduced strain of Nosema bombi. North American Bombus (B.) lucorum may be unthreatened or on the verge of collapse or in between these extremes. For example the closely related North American Bombus (B.). affinis would surely have been ranked G5 in 1998, but by 2009 there was concern that it may be on the verge of extinction and that another close relative, Bombus (B.) franklinii may be extinct. Two other members of this subgenus also had abrupt, concurrent major declines, B. terricola and B. occidentalis. It is not certain that escaped exotic Nosema caused these declines, although the circumstantial case is substantial. However, Sokolova et al. (2010) suggest that Nosema recovered at low level (about 2%) from Bombus impatiens and B. sandersoni in Great Smoky Mountains National Park may be native rather than introduced, even though the genetic sequences analysed were identical to known European strains that infect B. lucorum in Eurasia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although this species is not currently threatened in Britain, many British bumblebee species, including this one, have undergone a worrying decline, largely as a result of changes in agricultural practices leading to a loss of open habitats, nesting and hibernation sites, as well as important food plants (2) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation action has not been targeted directly at this species. However, concern over the decline of our bumblebee populations has caused steps to be taken. English Nature has produced a leaflet called 'help save the bumblebee', which includes advice on how to make your garden attractive to bumblebees (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: The following is a summary of the management and conservation needs for the genus Bombus. There is a lot of literature on the decline of bumblebees and other pollinators (e.g. Goulson et al. 2005, Brown and Paxton 2009, Evans et al. 2008, and the Committee on the Status of Pollinators in North America 2007). Byrne and Fitzpatrick (2009) review pollinator conservation programs at national, regional, and global levels. DeVore (2009) offers many practical considerations for pollinator conservation in the U.S. Noordijk et al.'s (2009) discussion of mowing in Europe should be generally applicable in North America, especially northern portions. Goulson et al. (2005), among others, make more general recommendations.

It is generally agreed that declines, and in some regions extirpations, of bumblebees and other pollinators in Europe have been due primarily to habitat loss or alteration, including changes in forage plant availability (due especially to intensification of agriculture). In turn, some plants have declined due to loss of pollinators. Brown and Paxton (2009), based in the United Kingdom, suggest that future conservation strategies need to "prioritise (i) minimising habitat loss, (ii) making agricultural habitats bee-friendly, (iii) training scientists and the public in bee taxonomy and identification, (iv) basic autecological and population genetic studies to underpin conservation strategies, (v) assessing the value of DNA barcoding for bee conservation, (vi) determining the impact of invasive plants, animals, parasites and pathogens, and (vii) integrating this information to understand the potential impact of climate change on current bee diversity." Some needs may be different in the U.S. In particular, climate change is probably less of a concern, whereas parasites and diseases are of much greater immediate concern.

Williams et al. (2009) examine various hypotheses from the literature as related to the status of bumble bees in North America, Europe and China, including competition with congeners, climatic specialization, proximity to climatic range edge, food specialization, phenology, body size, and range size. Food specialization would be in part an index of habitat specialization, but possible special needs for overwintering or nesting sites are not addressed. Results of their meta-analysis of correlations showed support for the hypotheses that decline susceptibility is generally greater for species that have greater climatic specialization, in areas where species occur closest to the edges of their climatic ranges, and for species that have queens that become active relatively late in the year. At least on a multi-continent scale the other factors apparently do not widely explain bumblebee declines. Notably most North American bumble bees range through more than ten degrees of latitude and thus have adapted to a wide array of climates at least in terms of temperature, and some range from coast to coast, which requires adaptation to a wide array of precipitation regimens and habitat types as well. While climate change could impact bumble bees positively or negatively at the edges of their ranges, this is not a plausible explanation for range-wide declines of widespread species.

Williams et al. (2009) suggest that late queen phenology may render a species at a particular disadvantage when they have long colony cycles if there are losses of food plants in mid to late colony development. Among declining species in the Grixti et al. (2009) tabulation (see also Colla and Packer, 2008) two are early, one is intermediate, and two are late; the ratio is nearly the same for non-declining species six are early, one is intermediate and three are late, and late species are not over-represented among declining species (chi2=0.6, df=2, p=0.95). In contrast B. affinis, which is undergoing extreme decline and may be on the brink of extinction, has early queen phenology, as does B. terricola which is also in severe decline. Their phenologies should make them among the least at risk. Phenology is not driving the extremely rapid declines of these species. The meta-analysis of Williams et al. (2009) also does not support any relationship between declines and tongue length as some earlier studies suggested--long tongues generally indicate more specialized foragers. The data in Grixti et al. (2009) are consistent with this finding: among declining species two have short tongues, one is intermediate and two have long tongues while among non-declining species four have short tongues, four are intermediate and two have long tongues, again nearly identical (chi2=0.9, df=2, p=0.885). Some other factor, almost certainly diseases and parasites (Colla et al., 2006, Otterstatter and Thomson, 2008; Federman, 2009), is largely overriding phenology, tongue length (foraging ecology) and other life history traits that may be important determinants of risk in other countries leading to very rapid declines. Nevertheless managers should be aware of these ecological traits that may predispose species to future declines, or may be driving slower current declines. Practical implications include a need for legumes and other flowers favored by long-tongued species and for a reliable supply of flowers late in the season.

Habitat fragmentation can also be important in bumblebee ecology (Hines and Hendrix 2005). A study by Bhattacharya et al. (2003) near Boston documented that foraging bumble bees (Bombus impatiens, B. affinis) have high site fidelity and flower constancy, and are reluctant to cross roads and railroads compared to more natural habitats. If the flower supply runs out they are more likely to locate another on the same side of a road rather than to cross it. Thus like many animals, bumblebees should benefit from reducing the number of roads, and the amount of other highly unnatural habitats, such as lawns, in and near natural areas.

Bumble bees have three critical sets of ecological needs: suitable overwintering places for the queens, suitable nesting microhabitats, and adequate flowers for foraging throughout the length of the colony cycle. This cycle is several months, typically mid spring to mid or late summer. Little information was found regarding hibernation sites, and information on nesting sites is usually rather general, except that Carvell (2002) discusses the nesting habits of the subgenus Thoracobombus. These are known in England as carder bees and they "nest on the ground surface and comb together material from around the nest as a covering" and "therefore require moss and dried grasses, often in the form of disused small mammal nests... hence the importance of undisturbed tall grassland with sufficient sunlight providing warmth to the surface nest." Most other bumblebees nest below ground in pre-existing cavities. Bombus impatiens will also use a variety of man-made situations such as under houses or old rodent nests in cardboard boxes, etc. (D. Schweitzer, pers. obs in New Jersey). Plath (1922, 1927) provides detailed observations of the nesting habits of North American bumble bees, including the now seriously imperiled B. (Bombus) affinis, the nests of which he observed to be solely subterranean. Prior to its decline, B. affinis had adapted well to urban areas and was observed nesting in the concrete rubble beside the foundation of buildings (Super and Moyer, 2003). Queen bumblebees probably usually hibernate in the leaf litter near the soil surface or perhaps underground.

Other than plowing (Hopwood, 2008, DeVore 2009), most common management activities should not directly affect underground nests. However bumblebees above ground in grasses would be vulnerable to fires, and to mowing if the blade is low enough to destroy them. Hibernating queens could be very vulnerable to prescribed burns if they are above ground in dry microhabitats. However, this might not affect the population in situations where nest sites are limiting such that many queens fail to establish colonies. Prescribed burning or any other management scheme potentially can have two sets of impacts, and the latter could be positive or negative: direct mortality to the pollinators and changes in vegetation composition and structure. Prescribed burning would likely render an area unsuitable for Bombus (Thoracobombus) for at least one season due to removal of nesting microhabitats (see Carvell, 2002). Much more information is needed regarding impacts of common management practices, perhaps especially fire, on bumblebees. In general maintaining healthy rodent populations in habitats where bumblebees nest should improve availability of nest sites. Besides providing habitat and cover for native rodents, elimination of free-roaming cats could be beneficial. In addition to a likely reduction in small rodents overall, high cat numbers may lead to an increased ratio of the non-native house mouse (Mus musculus) over native mice (Peromyscus spp.) (Hawkins, 1998, as cited by Longcore et al., 2009). It is not clear whether the species mix of small rodents has much affect on the availability of bumblebee nest sites. Besides old rodent holes and grass clumps, logs may provide useful nesting sites.

Most management activities involving bumblebees will be aimed at improving flower availability. Bumblebees depend on both nectar, mainly for carbohydrates, and pollen, for protein. A queen bumblebee needs nectar when she leaves hibernation, and for another month or more while she alone rears the first brood of workers. After that, workers need access to nectar and pollen for several months. Bumblebees will travel several kilometers. For example Schmidt and Jacobson (2005) note that B. pensylvanicus sonorus commonly flies to high elevations from desert nesting sites much lower, the vertical distance alone is often over a kilometer. Devore (2009) considers a mile (1.7 km) as about the typical distance over which bumblebees forage. Citing several studies (e.g. Dramstad, 1996), Hines and Hendrix (2005) state that bumble bees routinely forage up to 600-650 m from their nests. While some bumble bees are more generalized in their preferences than others, none are thought to be highly specialized in their foraging needs. Carvell (2002) found that the more common species in her study areas in England used between about nine and 15 plant species over the course of her study. Hines and Hendrix (2005) observed bumblebees foraging on 43 of 150 species of flowers monitored in Iowa prairie remnants. Bumblebee species with longer tongues tend to visit legumes and other plants with long corollas. Feeding is most efficient if the length of the tongue and corolla are similar. Thus habitats with a greater diversity of plants with varying corolla lengths can be expected to have a richer bumblebee fauna than less diverse communities.

Carvell (2002) in England found that "Numbers of both long- and short-tongued bumblebee species, abundance of all bumblebees and species richness per quadrat were significantly positively correlated with abundance of P[ilosella] officinarum and T[rifolium] pratense (red clover), total flower abundance, flowering plant species richness and continuity of bee-exploited species (the last excepting long-tongued bumblebee species)." Habitats most likely to have these features are generally open with simple vegetation structure and little moss or thatch cover. Gardens, even those in urban areas (Wojcik et al. 2008, Fetridge et al. 2008), can be useful foraging resources for bumblebees, as can croplands (e.g. Turnock et al. 2007) if they are not sprayed with insecticides during the flowering period. Hay fields with abundant red clover or alfalfa can be major foraging habitats. Roadsides with restored native prairie vegetation can also be very beneficial (Hopwood, 2008). Prairies, moist meadows, and restored roadsides with native flowers probably are among the most productive bumblebee foraging habitats. Tuell et al. (2008) provides many records of bees, including bumble bees, at native wild flowers in Michigan. Many other studies provide useful information about species of flowers visited by bumblebees (e.g. Hopwood, 2008, US fish and Wildlife Service, 1999, 2008, DeVore, 2009). Evans et al. (2008) provide summaries of plants known to be visited by three seriously declining or imperiled species of subgenus Bombus. Hopwood (2008) documents that in Kansas, roadsides restored to native prairie vegetation supported richer bee faunas than weedy roadsides or even local prairie remnants. Similarly Noordijk et al. (2009) discuss roadsides as important habitats for pollinators, including bumblebees, in northern Europe, and discuss the suitability of various mowing regimens. For Bombus species Hopwood had 37 observations of seven species on restored roadsides versus 10 representing two species on weedy controls. She concluded that infrequently mowed roadsides with diverse native flora actually make good native bee habitat because such places are not plowed, and thus are good nesting [and probably hibernating] habitats, and unlikely to be developed for other uses. She suggests roadsides could be important to pollinator management in much of the world.

The recommendations of DeVore (2009), which are specifically for heavily agricultural southern Minnesota and for bees in general, would apply to bumblebees almost anywhere in eastern and central North America. The following quote provides guidance for making farms and other landscape pollinator-friendly not just of bumblebees, but for bees in general: "Native wildflowers can provide excellent foraging for pollinators. So can cover crops that are allowed to flower. Reducing tillage causes less disruption of nesting habitat, because two-thirds of bees nest underground. Leaving logs, stumps, snags, and clumps of grass will provide nesting sites for the rest. Fencerows with willow, dogwood, or other flowering plants provide foraging habitat on working farmland without disrupting the agronomic productivity... Roadsides, ditches, and buffer strips can also serve as wild pollinator habitat." In some cases the pollination service will have significant economic benefits. Even narrow strips of buffer land can have important impacts on bees (Hopwood, 2008, DeVore, 2009). While suburban and urban gardens do provide nutrition (but sometimes also toxic pesticides) to wild bees (Frankie et al., 2009, McFrederick and LeBuhn, 2006), manicured lawns are among the least useful nesting and foraging habitats. DeVore also points out that protection from insecticides may be needed and that several studies find low levels of many pesticides in hives, brought in by workers on contaminated pollen. While levels are usually sublethal there may still be impacts to hive success. Recent articles (e.g. Colla and Packer, 2008) have suggested persistent neonicotinoid insecticides might be particularly hazardous to bees, but so far these have not been directly linked to major local declines.

On more natural lands, management would likely focus on maintaining diverse assemblages of primarily native flora, such that flowers would be constantly available throughout the active season, typically about April to September in many places. In some areas several different habitats would be needed to fulfill this need. To the extent practical, productive foraging sites should not be mowed during the flowering season, although in most contexts foraging workers will probably locate alternative flowers. Noordijk et al. (2009) found that while mowing virtually eliminates nectar for a period of days or longer afterward, summer mowing often stimulates re-flowering that benefits the bees later in the season. Also growing season mowing could be highly detrimental to other taxa of conservation concern, such as Lepidoptera larvae that could be killed directly--in some cases an entire population. Carvell (2002) found cattle grazing to be an effective management tool in England.

Regardless of the suitability of habitat management on a local scale, the surrounding landscape context will affect bumblebee communities. Hines and Hendrix (2005) found that variation in the availability of floral resources, especially as determined by the extent of land in grassland, in the surrounding 500-700 meter radius around prairie remnants explained most difference in the bumblebee community in prairie remnants, with the abundance of suitable flowers on site also being important. Landscape context is also likely to be important in terms of suitable nesting and hibernation sites, since these habitats may not be the same as foraging areas (e.g. Carvell, 2002). Thus small scraps of habitat may be poorly suited for bumblebee conservation even if the flora is relatively pristine. Ideally management aimed at conserving local bumblebees should be tailored to the needs of the local fauna, but in general unplowed, open, diverse, flowery habitats will be the goal. In most places such habitat will need active management--the exact nature of which may be determined by factors unrelated to bumblebees. Some degree of connectivity to other suitable habitats may be necessary, which is one reason roadside, power lines, and other long corridors may be quite suitable. See Russell et al. (2005) for a useful discussion of power line management as it relates to bees.

While habitat changes, especially a large-scale decline in foraging plants in some regions such as highly agricultural parts of the Midwest, have undoubtedly impacted North American bumblebees, these do not appear to be driving declines to anywhere near the extent they are in Great Britain. There is little that can be done to address what appears to be the greatest conservation need of the most imperiled North American bumble bees: protection from Nosema, Cirthidia, and other (mostly non-native) pathogens and parasites. For the most severely impacted species, Bombus affinis, B. franklini, and other species of subgenus Bombus, unless these can be mitigated in the near future or the species evolve some resistance, any conservation efforts are likely to be moot. Nosema could not be effectively managed in commercial hives of the closely related B. occidentalis and catastrophic outbreaks lead directly to the discontinuation of commercial use of that species. There is even less that can be done to protect wild bumble bees, and evolution of natural resistance may be needed for some species to persist in major portions, or all, of their ranges, although hypothetically the same result could be accomplished by genetic engineering. About the only suggestion now is to try to minimize contact between wild bumblebees and green house bees, especially of the same subgenus. Wild bees from near green house colonies tend to have higher infection rates than more distant ones (Colla et al., 2006). Several authors have pointed out the need for tight restrictions on the importation of bumblebees, whether of native or non-native species, that have been reared outside of North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bombus lucorum

Bombus lucorum, the white-tailed bumblebee, is a species of bumblebee that is widespread and common in the UK and continental Europe. However, the name has been widely used for many of a complex of nearly identical-looking or cryptic species of bumblebees. A recent review of all of these species worldwide has helped to clarify its distribution in Europe and northern Asia, almost to the Pacific.[2] In the north it reaches the Barent's Sea. In southern Europe however, it is an upland species, its distribution never quite reaching the Mediterranean.[3]

Description

Bombus lucorum is a large bumblebee, the queen having a length of 18 millimetres (0.71 in) – 22 millimetres (0.87 in) and a wingspan of around 36 millimetres (1.4 in). The workers are normally quite smaller. The species has a short proboscis (tongue). The predominating colour is black, with a pale yellow collar, another yellow band on the second tergite (abdominal segment), and a white tail. Both darker and paler forms exist.[4]

Ecology

The hibernating queen emerges very early, in southern Britain usually in March. The nest, which can be very large, up to 400 workers, is usually built underground, often in disused rodent nests. As many other bumblebee males, the males fly in a low patrolling circuit, depositing pheromones on grass to attract young queens. The bumblebee visits many flowers, including many garden plants, as lavender, Hebe, Rhododendron, deadnettles, thistles, vetches.[4]

References

  1. ^ "White-tailed Bumble Bee Bombus lucorum (Linnaeus, 1761)". Biolib.cz. http://www.biolib.cz/en/taxon/id70357/. Retrieved 3 July 2012.
  2. ^ P. H. Williams et al. (2012). "Unveiling cryptic species of the bumblebee subgenus Bombus s. str. world-wide with COI barcodes". Systematics and Biodiversity 10: 21–56. http://www.nhm.ac.uk/research-curation/research/projects/bombus/Williams&al12_Bombus.pdf. Retrieved 30 May 2012.
  3. ^ Pierre Rasmont. "Bombus (Bombus) lucorum (Linnaeus, 1761)". Université de Mons. http://zoologie.umh.ac.be/hymenoptera/pagetaxon.asp?tx_id=3040. Retrieved 2 January 2013.
  4. ^ a b Benton, Ted (2006). "Chapter 9: The British Species". Bumblebees. London, UK: HarperCollins Publishers. pp. 316–321. ISBN 0007174519.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: There is some disagreement over the circumscription of this species in Europe, but mostly not in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!