Overview

Distribution

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The species has a large range, breeding across the tundra of Canada, Alaska (USA), and wintering in southern North America including Mexico, and formerly Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Breeds locally on the Aleutian Islands, Semidi Islands (off Alaska Peninsula), formerly Bering Island and Kuriles; western and northern Alaska east to northern Yukon and Mackenzie Delta, south to Bristol Bay, the Alaska Peninsula, and central Yukon; and near the Arctic coast of Northwest Territories and Nunavut from Queen Maud Gulf east to Melville Peninsula, Southampton Island, and western Baffin Bay.

Winters from British Columbia south to California, east to northern Mexico and western Louisiana. Formerly wintered in Japan. Casual or accidental in Hawaii and east to the Florida panhandle, and the Atlantic coast of the United States from Mainie to South Carolina.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Branta hutchinsii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 108 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGACTATTTTCTACTAACCACAAAGATATCGGCACCCTATACCTCATCTTCGGAGCATGAGCAGGAATAGTCGGCACCGCACTCAGCCTATTAATCCGCGCAGAACTAGGACAACCAGGGACTCTCCTAGGTGACGACCAAATTTACAATGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTTATAGTCATACCCATCATGATCGGAGGATTCGGCAACTGATTAGTACCCCTCATAATCGGCGCCCCCGACATAGCATTCCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCACCATCATTCCTCCTACTACTAGCCTCGTCCACTGTAGAAGCTGGCGCCGGTACAGGCTGAACCGTATACCCTCCCCTGGCAGGTAACCTCGCCCACGCCGGGGCTTCAGTAGACCTGGCTATTTTCTCACTTCACTTAGCCGGTGTCTCCTCCATCCTTGGGGCCATCAACTTCATTACCACAGCCATTAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTATTCGTCTGATCCGTCCTGATCACTGCCATCCTACTCCTCCTATCGCTCCCCGTACTCGCCGCCGGCATCACAATATTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGGGGAGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTCTACATCCTGATTCTGCCCGGATTCGGGATCATCTCACACGTAGTCACGTACTACTCAGGCAAAAAAGAACCTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Branta hutchinsii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 108
Specimens with Barcodes: 557
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2006
    Least Concern
  • 2004
    Not Recognized
  • 2000
    Not Recognized
  • 1994
    Not Recognized
  • 1988
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
(Wetlands International 2006)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Although hunting and other direct mortality takes a substantial toll, this species has increased its range and population since the 1940s (Mowbray et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cackling Goose

The Cackling Goose (Branta hutchinsii) is a North American bird of the genus Branta of black geese, which contains species with largely black plumage, distinguishing them from the grey Anser species.

The black head and neck with white "chinstrap" distinguish this goose from all except the larger Canada Goose (Branta canadensis) and the similarly sized Barnacle Goose (B. leucopsis). There are up to 5 subspecies of Cackling Goose, of varying sizes and plumage details. Some are hard to distinguish from the Canada Goose, with which the Cackling Goose was long assumed to form one species, the Cackling Goose and the smaller Canada Goose subspecies being called the Lesser Canada Goose. The smallest 1.4 kg-Cackling Geese (B. h. minima) are much smaller than any Canada Goose, but the subspecies B. h. hutchinsii, at up to 3 kg, grows to the same size as some Canada Geese. The distinctness of the extinct population of the Komandorski and Kuril Islands B. h. asiatica is controversial. The Barnacle Goose differs in having a black breast and grey, rather than brownish, body plumage.

B. h. minima on eggs

This species is native to North America. It breeds in northern Canada and Alaska in a variety of tundra habitats. However, the nest is usually located in an elevated area near water. The eggs are laid in a shallow depression lined with plant material and down. Males can be very aggressive in defending territory. A pair may mate for life (up to around 20 years). The female looks virtually identical but is slightly lighter and has a different voice. Adult geese are often seen leading their goslings in a line with one parent at the front, and the other at the back of the "parade".

Like most geese, it is naturally migratory, the wintering range being most of the U.S., and locally in western Canada and northern Mexico. The calls overhead from large groups of Cackling Geese flying in V-shaped formation signal the transitions into spring and fall. In some areas, migration routes have changed due to changes in habitat and food sources.

Cackling Geese have occasionally reached western Europe naturally, as has been proved by ringing recoveries. The birds are of at least the subspecies hutchinsii, and possibly others. Cackling Geese are also found naturally on occasions in the Kamchatka Peninsula in eastern Siberia, eastern China, and throughout Japan.

These birds feed mainly on plant material. When feeding in water, they submerge their heads and necks to reach aquatic plants, sometimes tipping forward like a dabbling duck. Flocks of these birds often feed on leftover cultivated grains in fields, especially during migration or in winter. They also eat some insects, molluscs and crustaceans.

By the early 20th century, over-hunting and loss of habitat in the late 19th and early 20th centuries had resulted in a serious decline in the numbers of this bird in its native range. With improved game laws and habitat recreation and preservation programs, their populations have recovered in most of their range, although some local populations may still be declining, especially of the subspecies minima and leucopareia. Though the taxonomic distinctness of the Komandorski and Kuril Islands populations, which used to winter in Japan, is controversial, it is without doubt that they disappeared around 1929.

B. h. minima family

Systematics

The Cackling Goose was originally considered to be the same species or a subspecies of the Canada Goose, but in July 2004 the American Ornithologists' Union's (AOU) Committee on Classification and Nomenclature split the two into two species, making Cackling Goose into a full species with the scientific name Branta hutchinsii. The British Ornithologists Union followed suit in June 2005.

The AOU has divided the many associated subspecies between both animals. To the present species were assigned:

The distinctions between the two geese have led to a great deal of confusion and debate among ornithologists. This has been aggravated by the overlap between the small types of Canada Goose and larger types of Cackling Goose. Most interestingly, the old "Lesser Canada Goose" was believed to be a partly hybrid population, with the birds named taverneri considered a mixture of minima, occidentalis and parvipes. In addition, it has been determined that the Barnacle Goose is a derivative of the Cackling Goose lineage, whereas the Hawaiian Goose is an insular representative of the Canada Goose.

A recent proposed revision by Harold Hanson suggests splitting Canada and Cackling Goose into six species and 200 subspecies. The radical nature of this proposal has provoked surprise in some quarters; Richard Banks of the AOU urges caution before any of Hanson's proposals are accepted.[1]

For more information on the subject, see the following:

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly treated as part of B. canadensis but separated on the basis of several genetic studies. The distribution of this small-bodied form includes that of the subspecies B. c. hutchinsii, asiatica, leucopareia, taverneri, and minima as recognized by Delacour (1956).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!