Overview

Distribution

Range Description

The species has a large range, breeding across the tundra of Canada, Alaska (USA), and wintering in southern North America including Mexico, and formerly Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Breeds locally on the Aleutian Islands, Semidi Islands (off Alaska Peninsula), formerly Bering Island and Kuriles; western and northern Alaska east to northern Yukon and Mackenzie Delta, south to Bristol Bay, the Alaska Peninsula, and central Yukon; and near the Arctic coast of Northwest Territories and Nunavut from Queen Maud Gulf east to Melville Peninsula, Southampton Island, and western Baffin Bay.

Winters from British Columbia south to California, east to northern Mexico and western Louisiana. Formerly wintered in Japan. Casual or accidental in Hawaii and east to the Florida panhandle, and the Atlantic coast of the United States from Mainie to South Carolina.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Branta hutchinsii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 108 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGACTATTTTCTACTAACCACAAAGATATCGGCACCCTATACCTCATCTTCGGAGCATGAGCAGGAATAGTCGGCACCGCACTCAGCCTATTAATCCGCGCAGAACTAGGACAACCAGGGACTCTCCTAGGTGACGACCAAATTTACAATGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTTATAGTCATACCCATCATGATCGGAGGATTCGGCAACTGATTAGTACCCCTCATAATCGGCGCCCCCGACATAGCATTCCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCACCATCATTCCTCCTACTACTAGCCTCGTCCACTGTAGAAGCTGGCGCCGGTACAGGCTGAACCGTATACCCTCCCCTGGCAGGTAACCTCGCCCACGCCGGGGCTTCAGTAGACCTGGCTATTTTCTCACTTCACTTAGCCGGTGTCTCCTCCATCCTTGGGGCCATCAACTTCATTACCACAGCCATTAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTATTCGTCTGATCCGTCCTGATCACTGCCATCCTACTCCTCCTATCGCTCCCCGTACTCGCCGCCGGCATCACAATATTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGGGGAGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTCTACATCCTGATTCTGCCCGGATTCGGGATCATCTCACACGTAGTCACGTACTACTCAGGCAAAAAAGAACCTTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Branta hutchinsii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 108
Specimens with Barcodes: 557
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Not Recognized (NR)
  • Not Recognized (NR)
  • Not Recognized (NR)
  • Not Recognized (NR)