Articles on this page are available in 1 other language: Spanish (8) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetura spinicaudus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAATCTTTGGAGCATGAGCCGGTATAGTAGGAACCGCCCTCAGCCTACTTATCCGAGCAGAACTTGGGCAGCCAGGGACCCTCCTAGGAGATGATCAAATCTACAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTCATACCAATTATGATCGGAGGATTTGGAAACTGACTAGTCCCACTTATAATTGGAGCACCCGACATGGCCTTCCCACGAATGAACAACATAAGCTTCTGACTCCTTCCCCCATCATTCCTTCTCCTACTAGCCTCTTCAACAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTATACCCCCCGCTAGCTGGTAATCTAGCCCACGCAGGGGCATCAGTAGACCTCGCCATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCTATCCTGGGTGCAATCAACTTCATCACAACTGCCATCAACATAAAACCACCCGCCCTCTCACAATACCAAACACCCCTATTCGTATGATCTGTCCTCATCACCGCCGTCCTACTACTACTCTCCCTCCCCGTCCTCGCCGCAGGCATCACCATACTCCTAACCGATCGCAACTTAAACACCACATTCTTCGACCCAGCTGGAGGAGGTGACCCTATCCTATACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetura spinicaudus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Band-rumped swift

The band-rumped swift (Chaetura spinicaudus) is a small swift. Until 1998, it was known as Chaetura spinicauda. At that time, the previously considered subspecies Costa Rican swift, Chaetura fumosa, was split from this species and the scientific name was modified from C. spinacauda to C. spinacaudus.

It breeds in forested areas from Costa Rica south and east to Colombia, Ecuador, Venezuela, the Guianas, Trinidad and northeast Brazil. The nest is a half saucer of twigs glued to the inside of a tree hole or similar shaded location with saliva.

The band-rumped swift is a speedy slender bird, 11.5 cm long, weighing 15 g. The upperparts are blackish with a whitish band across the rump, and the underparts are dark brown with a paler throat. It has a short tail.

It feeds in flight on flying insects, often low over roads or clearings in the morning or evening, rising high above the forest, often with other swifts, in the middle of the day.

It has a chittering csinck call.

References[edit]

  • Swifts by Chantler and Driessens, ISBN 1-873403-83-6
  • ffrench, Richard (1991). A Guide to the Birds of Trinidad and Tobago (2nd edition ed.). Comstock Publishing. ISBN 0-8014-9792-2. 
  • Hilty, Steven L (2003). Birds of Venezuela. London: Christopher Helm. ISBN 0-7136-6418-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!