Articles on this page are available in 2 other languages: Spanish (4), Chinese (Simplified) (7) (learn more)

Overview

Distribution

United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Length: 40-41 cm. Plumage: general colour blackish green; grey below; throat white; buff to chestnut line down foreneck; erectile feathers on crown. Immature dark brown spotted white above, buff and dark brown streaking below. Bare parts: iris yellow, deep orange when breeding; lores green to blue, yellow when breeding; bill black above, yellow green below with black tip, entirely black when breeding; feet and legs grey brown in front, yellow behind, yellow to reddish orange when breeding. Habitat: mangrove swamps and creeks, inland waters. <388><393><391>
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The majority of this species is sedentary although northern breeding populations are migratory and populations in Africa may perform local movements relating to seasonal rainfall1. The timing of breeding varies geographically but often occurs during the rains in the tropics1, 2. The species is highly territorial and often forages and nests singly1, 2, occasionally also nesting in loosely spaced single-species groups of 5-15 pairs, or even in larger breeding aggregations of several hundred (300-500)1 pairs2. Habitat The species shows a preference for forested water margins2, 3 such as mangrove-lined shores and estuaries, or dense woody vegetation fringing ponds, rivers, lakes and streams1, 2, 3. Other suitable habitats include river swamps, canals, artificial ponds, salt-flats2, mudflats, tidal zones, exposed coral reefs1, reedbeds, grassy marshland, pastures, rice-fields and other flooded cultivation1. Diet Its diet varies considerably over its range1 but usually consists predominantly of fish1, 2 as well as amphibians1 (e.g. frogs)2, insects1 (e.g. water beetles, grasshoppers and dragonflies)2, spiders, leeches, crustaceans (e.g. crabs and prawns), molluscs1, earthworms, polychaete worms, birds2, small reptiles and mice1. Breeding site The nest is a small, shallow structure of twigs2 placed well hidden amongst the branches of trees or bushes (especially mangroves Rhizophora spp. and Avicennia spp., or Allocasuarina spp., Myoporum spp., Callistemon spp., Hibiscus spp., Casuarina spp., Syzygium spp. and Inga spp.)2 0.3-10 m above the surface of water or above the ground1.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Butorides striata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTAATCTTCGGAGCATGAGCTGGTATAATTGGAACCGCCCTAAGCCTACTTATCCGAGCTGAACTTGGTCAACCAGGAACACTCCTAGGGGACGACCAAATCTATAATGTAATCGTCACCGCTCATGCTTTCGTAATAATCTTCTTCATAGTAATGCCTATCATAATCGGGGGATTCGGGAACTGATTAGTCCCTCTTATAATTGGTGCCCCCGACATAGCATTCCCCCGCATGAACAACATAAGCTTCTGACTCTTACCACCATCATTCATACTCCTGCTAGCCTCATCCACAGTTGAAGCAGGAGCAGGTACAGGTTGAACCGTCTACCCACCATTAGCCGGTAACCTGGCCCACGCCGGAGCCTCAGTTGACCTAGCTATCTTTTCACTTCACTTAGCAGGTGTATCCTCTATCCTAGGGGCAATTAATTTCATTACAACCGCTATTAACATAAAACCCCCATCCCTATCACAATATCAAACTCCCCTATTCGTATGATCCGTCTTAATCACTGCCGTCTTACTCCTACTCTCACTTCCAGTCCTTGCCGCAGGTATTACAATATTACTAACTGACCGAAACCTAAACACCACATTCTTTGATCCTGCTGGAGGTGGAGACCCAGTCCTCTATCAACACCTCTTCTGATTCTTCGGACATCCAGAAGTCTATATCCTAATCCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Butorides striata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2005
    Least Concern
  • 2004
    Not Recognized
  • 2000
    Not Recognized
  • 1994
    Not Recognized
  • 1988
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder and regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by human disturbance, pesticides1 and habitat destruction (e.g. the loss of mangroves)2. Utilisation The species is taken for food in some areas1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Striated Heron

The Striated Heron (Butorides striata) also known as Mangrove Heron, Little Heron or Green-backed Heron, is a small heron. Striated Herons are mostly non-migratory and noted for some interesting behavioral traits. Their breeding habitat is small wetlands in the Old World tropics from west Africa to Japan and Australia, and in South America. Vagrants have been recorded on oceanic islands, such as Chuuk and Yap in the Federated States of Micronesia, the Marianas and Palau; the bird recorded on Yap on February 25, 1991, was from a continental Asian rather than from a Melanesian population, while the origin of the bird seen on Palau on May 3, 2005 was not clear.[2]

This bird was long considered to be conspecific with the closely related North American species, the Green Heron, which is now usually separated as B. virescens, as well as the Lava Heron of the Galápagos Islands (now B. sundevalli, but often included in B. striata, e.g. by BirdLife International[3]); collectively they were called "green-backed herons".

Contents

Description and ecology

Juvenile, subspecies unknown. al-Qurm park (Oman)
Striated Heron photographed in Abu Dhabi, UAE
Subspecies B. s. spodiogaster, illustration by Keulemans, 1898

Adults have a blue-grey back and wings, white underparts, a black cap and short yellow legs. Juveniles are browner above and streaked below.

These birds stand still at the water's edge and wait to ambush prey, but are easier to see than many small heron species. They mainly eat small fish, frogs and aquatic insects. They sometimes use bait, dropping a feather or leaf carefully on the water surface and picking fish that come to investigate[4].

They nest in a platform of sticks measuring between 20–40 cm long and 0.5–5 mm thick. The entire nest measures some 40–50 cm wide and 8–10 cm high outside, with an inner depression 20 cm wide and 4–5 cm deep. It is usually built in not too high off the ground in shrubs or trees but sometimes in sheltered locations on the ground, and often near water. The clutch is 2–5 eggs, which are pale blue and measure around 36 by 28 mm.[5]

An adult bird was once observed in a peculiar and mysterious behavior: while on the nest, it would grab a stick in its bill and make a rapid back-and-forth motion with the head, like a sewing machine's needle. The significance of this behavior is completely unknown: While such movements occur in many other nesting birds where they seem to compact the nest, move the eggs, or dislodge parasites, neither seems to have been the case in this particular Striated Heron.[5]

Young birds will give a display when they feel threatened, by stretching out their necks and pointing the bill skywards. In how far this would deter predators is not known.[5]

Widespread and generally common, the Striated Heron is classified as a Species of Least Concern by the IUCN; this holds true whether the Lava Heron is included in B. striata or not.[3]

Footnotes

  1. ^ BirdLife International (2012). "Butorides striata". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106003737/0. Retrieved 5 July 2012.
  2. ^ Wiles et al. (2000), VanderWerf et al. (2006)
  3. ^ a b BLI (2008)
  4. ^ Norris (1975), Boswall (1983), Walsh et al. (1985), Robinson (1994)
  5. ^ a b c Greeney & Merino M. (2006)

References

  • Boswall, J. (1983): Tool-using and related behavior in birds: more notes. Avicultural Magazine 89: 94–108.
  • Greeney, Harold F. & Merino M., Paúl A. (2006): Notes on breeding birds from the Cuyabeno Faunistic Reserve in northeastern Ecuador. Boletín de la Sociedad Antioqueña de Ornitología 16(2): 46–57. PDF fulltext
  • Norris, D. (1975): Green Heron (Butorides virescens) uses feather lure for fishing. American Birds 29: 652–654.
  • Robinson, S.K. (1994): Use of bait and lures by Green-backed Herons in Amazonian Peru. Wilson Bulletin 106(3): 569–571
  • Walsh, J.F.; Grunewald, J. & Grunewald, B. (1985): Green-backed Herons (Butorides striatus) possibly using a lure and using apparent bait. J. Ornithol. 126: 439–442.
  • Wiles, Gary J.; Worthington, David J.; Beck, Robert E. Jr.; Pratt, H. Douglas; Aguon, Celestino F. & Pyle, Robert L. (2000): Noteworthy Bird Records for Micronesia, with a Summary of Raptor Sightings in the Mariana Islands, 1988–1999. Micronesica 32(2): 257–284. PDF fulltext
  • VanderWerf, Eric A.; Wiles, Gary J.; Marshall, Ann P. & Knecht, Melia (2006): Observations of migrants and other birds in Palau, April–May 2005, including the first Micronesian record of a Richard's Pipit. Micronesica 39(1): 11–29. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!