Articles on this page are available in 2 other languages: Chinese (Simplified) (7), Spanish (4) (learn more)

Physical Description

Diagnostic Description

Description

Length: 40-41 cm. Plumage: general colour blackish green; grey below; throat white; buff to chestnut line down foreneck; erectile feathers on crown. Immature dark brown spotted white above, buff and dark brown streaking below. Bare parts: iris yellow, deep orange when breeding; lores green to blue, yellow when breeding; bill black above, yellow green below with black tip, entirely black when breeding; feet and legs grey brown in front, yellow behind, yellow to reddish orange when breeding. Habitat: mangrove swamps and creeks, inland waters. <388><393><391>
  • Brown, L.H., E.K. Urban & K. Newman (1982). The Birds of Africa, Volume I. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Moist Pacific Coast Mangroves Habitat

This taxon occurs in the Moist Pacific Coast mangroves, an ecoregion along the Pacific coast of Costa Rica with a considerable number of embayments that provide shelter from wind and waves, thus favouring mangrove establishment. Tidal fluctuations also directly influence the mangrove ecosystem health in this zone. The Moist Pacific Coast mangroves ecoregion has a mean tidal amplitude of three and one half metres,

Many of the streams and rivers, which help create this mangrove ecoregion, flow down from the Talamanca Mountain Range. Because of the resulting high mountain sediment loading, coral reefs are sparse along the Pacific coastal zone of Central America, and thus reef zones are chiefly found offshore near islands. In this region, coral reefs are associated with the mangroves at the Isla del Caño Biological Reserve, seventeen kilometres from the mainland coast near the Térraba-Sierpe Mangrove Reserve. The Térraba-Sierpe, found at the mouths of the Térraba and Sierpe Rivers, is considered a wetland of international importance.

Because of high moisture availability, the salinity gradient is more moderate than in the more northern ecoregion such as the Southern dry Pacific Coast ecoregion. Resulting mangrove vegetation is mixed with that of marshland species such as Dragonsblood Tree (Pterocarpus officinalis), Campnosperma panamensis, Guinea Bactris (Bactris guineensis), and is adjacent to Yolillo Palm (Raphia taedigera) swamp forest, which provides shelter for White-tailed Deer (Odocoileus virginianus) and Mantled Howler Monkeys (Alouatta palliata). Mangrove tree and shrub taxa include Red Mangrove (Rhizophora mangle), Mangle Caballero (R. harrisonii) R. racemosa (up to 45 metres in canopy height), Black Mangrove (Avicennia germinans) and Mangle Salado (A. bicolor), a mangrove tree restricted to the Pacific coastline of Mesoamerica.

Two endemic birds listed by IUCN as threatened in conservation status are found in the mangroves of this ecoregion, one being the Mangrove Hummingbird (Amazilia boucardi EN), whose favourite flower is the Tea Mangrove (Pelliciera rhizophorae), the sole mangrove plant pollinated by a vertebrate. Another endemic avain species to the ecoregion is the  Yellow-billed Cotinga (Carpodectes antoniae EN).  Other birds clearly associated with the mangrove habitat include Roseate Spoonbill (Ajaia ajaja), Gray-necked Wood Rail (Aramides cajanea), Rufous-necked Wood Rail (A. axillaris), Mangrove Black-hawk (Buteogallus anthracinus subtilis),Striated Heron (Butorides striata), Muscovy Duck (Cairina moschata), Boat-billed Heron (Cochlearius cochlearius), American White Ibis (Eudocimus albus), Amazon Kingfisher (Chloroceryle amazona), Mangrove Cuckoo (Coccyzus minor), Yellow Warbler (Setophaga petechia), and Black-necked Stilt (Himantopus mexicanus VU) among other avian taxa.

Mammals although not as numerous as birds, include species such as the Lowland Paca (Agouti paca), Mantled Howler Monkey (Alouatta palliata), White-throated Capuchin (Cebus capucinus), Silky Anteater (Cyclopes didactylus), Central American Otter (Lontra longicaudis annectens), White-tailed Deer (Odocoileus virginianus), feeds on leaves within A. bicolor and L. racemosa forests. Two raccoons: Northern Raccoon (Procyon lotor) and Crab-eating Raccoon (P. cancrivorus) can be found, both on the ground and in the canopy consuming crabs and mollusks. The Mexican Collared Anteater (Tamandua mexicana) is also found in the Moist Pacific Coast mangroves.

There are a number of amphibians in the ecoregion, including the anuran taxa: Almirante Robber Frog (Craugastor talamancae); Chiriqui Glass Frog (Cochranella pulverata); Forrer's Grass Frog (Lithobates forreri), who is found along the Pacific versant, and is at the southern limit of its range in this ecoregion. Example salamanders found in the ecoregion are the Colombian Worm Salamander (Oedipina parvipes) and the Gamboa Worm Salamander (Oedipina complex), a lowland organism that is found in the northern end of its range in the ecoregion. Reptiles including the Common Basilisk Lizard (Basiliscus basiliscus), Boa Constrictor (Boa constrictor), American Crocodile (Crocodilus acutus), Spectacled Caiman (Caiman crocodilus), Black Spiny-tailed Iguana (Ctenosaura similis) and Common Green Iguana (Iguana iguana) thrive in this mangrove ecoregion.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour The majority of this species is sedentary although northern breeding populations are migratory and populations in Africa may perform local movements relating to seasonal rainfall (del Hoyo et al. 1992). The timing of breeding varies geographically but often occurs during the rains in the tropics (del Hoyo et al. 1992, Kushlan and Hancock 2005). The species is highly territorial and often forages and nests singly (del Hoyo et al. 1992, Kushlan and Hancock 2005), occasionally also nesting in loosely spaced single-species groups of 5-15 pairs, or even in larger breeding aggregations of several hundred (300-500) (del Hoyo et al. 1992) pairs (Kushlan and Hancock 2005). Habitat The species shows a preference for forested water margins (Hancock and Kushlan 1984, Kushlan and Hancock 2005) such as mangrove-lined shores and estuaries, or dense woody vegetation fringing ponds, rivers, lakes and streams (Hancock and Kushlan 1984, del Hoyo et al. 1992, Kushlan and Hancock 2005). Other suitable habitats include river swamps, canals, artificial ponds, salt-flats (Kushlan and Hancock 2005), mudflats, tidal zones, exposed coral reefs (del Hoyo et al. 1992), reedbeds, grassy marshland, pastures, rice-fields and other flooded cultivation (del Hoyo et al. 1992). Diet Its diet varies considerably over its range (del Hoyo et al. 1992) but usually consists predominantly of fish (del Hoyo et al. 1992, Kushlan and Hancock 2005) as well as amphibians (del Hoyo et al. 1992) (e.g. frogs) (Kushlan and Hancock 2005), insects (del Hoyo et al. 1992) (e.g. water beetles, grasshoppers and dragonflies) (Kushlan and Hancock 2005), spiders, leeches, crustaceans (e.g. crabs and prawns), molluscs (del Hoyo et al. 1992), earthworms, polychaete worms, birds (Kushlan and Hancock 2005), small reptiles and mice (del Hoyo et al. 1992). Breeding site The nest is a small, shallow structure of twigs (Kushlan and Hancock 2005) placed well hidden amongst the branches of trees or bushes (especially mangroves Rhizophora spp. and Avicennia spp., or Allocasuarina spp., Myoporum spp., Callistemon spp., Hibiscus spp., Casuarina spp., Syzygium spp. and Inga spp.) (Kushlan and Hancock 2005) 0.3-10 m above the surface of water or above the ground (del Hoyo et al. 1992).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Butorides striata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTAATCTTCGGAGCATGAGCTGGTATAATTGGAACCGCCCTAAGCCTACTTATCCGAGCTGAACTTGGTCAACCAGGAACACTCCTAGGGGACGACCAAATCTATAATGTAATCGTCACCGCTCATGCTTTCGTAATAATCTTCTTCATAGTAATGCCTATCATAATCGGGGGATTCGGGAACTGATTAGTCCCTCTTATAATTGGTGCCCCCGACATAGCATTCCCCCGCATGAACAACATAAGCTTCTGACTCTTACCACCATCATTCATACTCCTGCTAGCCTCATCCACAGTTGAAGCAGGAGCAGGTACAGGTTGAACCGTCTACCCACCATTAGCCGGTAACCTGGCCCACGCCGGAGCCTCAGTTGACCTAGCTATCTTTTCACTTCACTTAGCAGGTGTATCCTCTATCCTAGGGGCAATTAATTTCATTACAACCGCTATTAACATAAAACCCCCATCCCTATCACAATATCAAACTCCCCTATTCGTATGATCCGTCTTAATCACTGCCGTCTTACTCCTACTCTCACTTCCAGTCCTTGCCGCAGGTATTACAATATTACTAACTGACCGAAACCTAAACACCACATTCTTTGATCCTGCTGGAGGTGGAGACCCAGTCCTCTATCAACACCTCTTCTGATTCTTCGGACATCCAGAAGTCTATATCCTAATCCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Butorides striata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder and regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number c.150,000-1,200,000 individuals (Wetlands International 2006), while national population estimates include: c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in China; < c.100 breeding pairs, c.50-1,000 wintering individuals and c.50-1,000 individuals on migration in Taiwan; c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in Korea; c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Japan and possibly c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by human disturbance, pesticides (del Hoyo et al. 1992) and habitat destruction (e.g. the loss of mangroves) (Kushlan and Hancock 2005). Utilisation The species is taken for food in some areas (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Striated Heron

The Striated Heron (Butorides striata) also known as Mangrove Heron, Little Heron or Green-backed Heron, is a small heron. Striated Herons are mostly non-migratory and noted for some interesting behavioral traits. Their breeding habitat is small wetlands in the Old World tropics from west Africa to Japan and Australia, and in South America. Vagrants have been recorded on oceanic islands, such as Chuuk and Yap in the Federated States of Micronesia, the Marianas and Palau; the bird recorded on Yap on February 25, 1991, was from a continental Asian rather than from a Melanesian population, while the origin of the bird seen on Palau on May 3, 2005 was not clear.[2]

This bird was long considered to be conspecific with the closely related North American species, the Green Heron, which is now usually separated as B. virescens, as well as the Lava Heron of the Galápagos Islands (now B. sundevalli, but often included in B. striata, e.g. by BirdLife International[3]); collectively they were called "green-backed herons".

Description and ecology[edit]

Juvenile, subspecies unknown. al-Qurm park (Oman)
Galapagos Islands color morph which lacks striation
Subspecies B. s. spodiogaster, illustration by Keulemans, 1898

Adults have a blue-grey back and wings, white underparts, a black cap, a dark line extends from the bill to under the eye and short yellow legs. Juveniles are browner above and streaked below.

These birds stand still at the water's edge and wait to ambush prey, but are easier to see than many small heron species. They mainly eat small fish, frogs and aquatic insects. They sometimes use bait, dropping a feather or leaf carefully on the water surface and picking fish that come to investigate.[4]

They nest in a platform of sticks measuring between 20–40 cm long and 0.5–5 mm thick. The entire nest measures some 40–50 cm wide and 8–10 cm high outside, with an inner depression 20 cm wide and 4–5 cm deep. It is usually built in not too high off the ground in shrubs or trees but sometimes in sheltered locations on the ground, and often near water. The clutch is 2–5 eggs, which are pale blue and measure around 36 by 28 mm.[5]

An adult bird was once observed in a peculiar and mysterious behavior: while on the nest, it would grab a stick in its bill and make a rapid back-and-forth motion with the head, like a sewing machine's needle. The significance of this behavior is completely unknown: While such movements occur in many other nesting birds where they seem to compact the nest, move the eggs, or dislodge parasites, neither seems to have been the case in this particular Striated Heron.[5]

Young birds will give a display when they feel threatened, by stretching out their necks and pointing the bill skywards. How far this would deter predators is not known.[5]

Widespread and generally common, the Striated Heron is classified as a Species of Least Concern by the IUCN; this holds true whether the Lava Heron is included in B. striata or not.[3]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Butorides striata". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Wiles et al. (2000), VanderWerf et al. (2006)
  3. ^ a b BLI (2008)
  4. ^ Norris (1975), Boswall (1983), Walsh et al. (1985), Robinson (1994)
  5. ^ a b c Greeney & Merino M. (2006)

References[edit]

  • Boswall, J. (1983): Tool-using and related behavior in birds: more notes. Avicultural Magazine 89: 94–108.
  • Greeney, Harold F. & Merino M., Paúl A. (2006): Notes on breeding birds from the Cuyabeno Faunistic Reserve in northeastern Ecuador. Boletín de la Sociedad Antioqueña de Ornitología 16(2): 46–57. PDF fulltext
  • Norris, D. (1975): Green Heron (Butorides virescens) uses feather lure for fishing. American Birds 29: 652–654.
  • Robinson, S.K. (1994): Use of bait and lures by Green-backed Herons in Amazonian Peru. Wilson Bulletin 106(3): 569–571
  • Walsh, J.F.; Grunewald, J. & Grunewald, B. (1985): Green-backed Herons (Butorides striatus) possibly using a lure and using apparent bait. J. Ornithol. 126: 439–442.
  • Wiles, Gary J.; Worthington, David J.; Beck, Robert E. Jr.; Pratt, H. Douglas; Aguon, Celestino F. & Pyle, Robert L. (2000): Noteworthy Bird Records for Micronesia, with a Summary of Raptor Sightings in the Mariana Islands, 1988–1999. Micronesica 32(2): 257–284. PDF fulltext
  • VanderWerf, Eric A.; Wiles, Gary J.; Marshall, Ann P. & Knecht, Melia (2006): Observations of migrants and other birds in Palau, April–May 2005, including the first Micronesian record of a Richard's Pipit. Micronesica 39(1): 11–29. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!