Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Caracaras are present along the Mexican - American Border, from Baja California to Eastern Texas, then south to Panama. There are also isolated populations in Cuba, the Isle of Pines, Louisiana, and in Central Florida

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) RESIDENT: in central and southern Florida, Cuba, and the Isle of Pines, and from northern Baja California, southern Arizona, Sonora, Sinaloa, Zacatecas, Nuevo Leon, central and southern Texas, and southwestern Louisiana, south locally through Central America and throughout most of South America, south to northern and central Peru and northern Brazil. Casual north to central New Mexico and southwestern Mississippi. Records from Washington, Oregon, and California, and north to Wyoming, Ontario, Pennsylvania, New York, and New Jersey are of individuals of "questionable origin" (AOU 1998, 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Amazon basin to e Peru, Tierra del Fuego and Falkland Islands.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The crested caracara is about the same size as an osprey, but it has shorter wings. It has a length of approximately 53 to 58 centimeters, with a wingspan of approximately 1.2 meters. Caracaras can be identified by thier long yellow legs, and their large, hooked, bluish bill. Caracaras have black crowns and crests, with red facial skin. Thier tails are banded, alternating black and white, with a wide black terminal band. The ends of the primaries and at the base of the neck are also banded. Immature birds appear similar, but their coloring is duller overall. Both sexes of the birds are similarily plumaged.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 58 cm

Weight: 953 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

No other similar bird has all of the following characteristics: black crown, white neck, black belly, whitish tail with black band at end, and a white patch at the end of the dark wings.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Baja California Desert Habitat

This taxon is found in the Baja California Desert ecoregion, located on most of the western side of the Baja Peninsula, containing varied habitats such as mountains, plains and coastal dunes. This desert is one of the largest and best preserved in Mexico, and due to its isolation, contains a high level of species richness and endemism. A series of ophiolytes  (formations of gabrum, ultramafic rocks, and volcanic lava) surround the most prominent orographic feature: The San Andres mountain range. Overall, the climate is arid with variable temperature. The isolated nature of the peninsula, and its proximity to the sea, maintains a measure of humidity, and creates a stable diurnal temperature.

The predominant vegetation associations are composed of xeric scrub, which have been subdivided in diverse categories according to dominant species and the ecological conditions in which they occur. Thick-stemmed trees and shrubs, growing on rocky volcanic soils, cover the highest parts of the mountain ranges. Dominant plant species are Ambrosia camphorata, Common Stork's-bill (Erodium cicutarium), and Astragalus prorifer.  The Boojumtree (Fouquieria columnaris) can be also found at elevations up to 1200m. Many species of cacti are present. Dominant species within the Baja California Desert vary with elevation. Epiphytes such as Small Ballmoss (Tillandsia recurvata) and Cudbear (Rocella tinctoria) grow in low elevation, humid areas, and account for a majority of the perennial vegetation. Areas previously submerged under the sea (in the Miocene era) are now covered by highly saline and alkaline-tolerant species, such as Ambrosia magdalenae, El Vizcaino Agave (Agave vizcainoensis), Datilillo (Yucca valida), Pitaya Agria (Stenocereus gummosus), and Porter's Muhly (Muhlenbergia porteri). Dune vegetation includes Creosote Bush (Larrea tridentata), Barclay's Saltbush (Atriplex barclayana), Rush Milkweed (Asclepias subulata) and Nicolletia trifida.

There are a number of reptilian taxa found in the Baja California Desert including the endemic Baja California Brush Lizard (Urosaurus lahtelai). The Baja California Legless Lizard (Anniella geronimensis EN) is also endemic to the ecoregion, and is restricted to a narrow strip around 87 kilometres (km) long, ranging from about six km north of Colonia Guerrero, southerly to a point south of Punta Baja at the northern edge of Bahia El Rosario. This legless lizard extends to at most four km inland in the Arroyo Socorro, but otherwise found only in the coastal zone; A. geronimensis also occurs on Isla San Gerónimo. Also found here is the San Lucan Leaf-toed Gecko (Phyllodactylus unctus NT), a species not endemic to the ecoregion, but restricted to the southern Baja Peninsula and the Gulf of California islands of Partida Sur, Gallo, Espiritu Santo, Ballena, Gallina and Cerralvo.

There are only a few amphibians found in the ecoregion. Anuran taxa occurring here include: California Chorus Frog (Pseudacris cadaverina); Pacific Chorus Frog (Pseudacris regilla); and Canyon Treefrog (Hyla arenicolor). Also found here is the Plateau Toad (Anaxyrus compactilis), an endemic to the lower central Mexican Plateau and Baja California Desert; another toad occurring in the ecoregion is the Western Toad (Anaxyrus boreas NT). The Channel Islands Slender Salamander (Batrachoseps pacificus) was earlier thought to occur in this ecoregion, but genetic data shows that this taxon is strictly endemic to the Channel Islands of California.

Endemic mammals include San Quintín Kangaroo Rat (Dipodomys gravipes CR), and Baja California Rock Squirrel (Spermophilus atricapillus EN). Other mammals that are classified as special status are the Lesser Long-nosed Bat (Leptonycteris yerbabuenae VU). Some shallow coastal saltwater lagoons protruding into the Baja California Desert along the Pacific Ocean provide key breeding habitat for the Grey Whale (Eschrichtius robustus CR). One of the largest such breeding waters is the remote San Ignacio Lagoon, extending many kilometres inland and rarely exceeding fifteen metres in depth.

Important sites for avian conservation include the Ojo de Liebre lagoon, along the Pacific coast, which is home to millions of overwintering ducks and geese. Bird species in the Baja California Desert include such notable raptor taxa as Golden Eagle (Aquila chrysaetos), Peregrine Falcon (Falco peregrinus), Southern Crested Caracara (Caracara plancus), Osprey (Pandion haliaeutus), and Burrowing Owl (Athene cunicularia).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

The crested caracaras are birds of open countryside. Their typical habitats are either comprised of dry prairie with some wetter areas or agricultural environments. Caracaras spread themselves thinly over a wide area, with each pair maintaining a large territory.

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Open country, including pastureland, cultivated areas, and semidesert, in both arid and moist habitats but more commonly in the former (AOU 1983); also coastal lowlands and beaches in some areas. Often occurs on the ground in company of vultures (National Geographic Society 1983).

Florida: associated with open country; dry prairie with scattered cabbage palms (SABAL PALMETTO), wetter prairies, and to some extent also improved pastures and sometimes even rather wooded areas having associated limited areas of open grassland (Johnsgard 1990); center of range is the Kissimmee Prairie, an area of shallow ponds and sloughs with scattered hummocks of live oaks and cabbage palms (see Johnsgard 1990).

Nests in trees, usually in site concealed among branches or palm fronds (often in cabbage palm in Florida, oak or YUCCA in Texas), or in cacti; 2.5-15+ m above ground. In treeless areas may nest on rock ledge or under overhanging rocks, or on ground in secluded site such as marsh island. In Texas, typically nests in brush or woodlands on prairies or hill slopes (Oberholser 1974). Nests often are reused from year to year (Johnsgard 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The caracara is an opportunistic feeder, its diet consists of both carrion and living prey. The living prey is usually small turtles, turtle eggs, fish, insects, frogs, lizard, snakes, small birds, and some small mammals. Sometimes, when trying to capture a larger animal, pairs will unite their forces. Caracaras have also been observed eating with vultures.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds opportunistically on carrion (and associated insect larvae), various live vertebrates, insects, and worms (Bent 1938, Evans 1982). Commonly utilizes road kills. May "rob" food from vultures. See Palmer (1988) for accounts of predation on eggs of birds and turtles. Pairs may hunt together.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population size is very large but unknown. Using 1986 Christmas Bird Count data, Johnsgard (1990) estimated the U.S. population at 2280 birds, with nearly all of these in Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Maintains large territory, usually with mate. In Florida, home range width for breeding adults varied from 4.6-9.8 kilometers, average 6 kilometers (Morrison 1996). Most activity occurred within 2-3 kilometers of nest (Morrison 1996). May aggregate (especially at carrion) in groups of up to about 10 in nonbreeding season. Prebreeders occasionally form aggregations (Palmer 1988). Density was estimated at 4.8 birds per 40 ha in eastern Mexico (see Johnsgard 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Range lifespan

Status: wild:
25.8 (high) years.

Average lifespan

Status: wild:
211 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 37.6 years (captivity) Observations: A specimen of a Brazilian caracara classified as *Polyborus tharus* lived 37.6 years in captivity (Flower 1938). Record longevity in the wild is 17.6 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Bonds between adult caracaras are strong, persisting until one of the mates dies. Together, the pair of caracaras will maintain a large territory. The nesting site is usually in a cabbage palm tree, and the nest is a bulky structure made with slender vines and sticks. The breeding season for caracaras is from January to March, and the usual clutch being two or three eggs. Incubation is about 32 days, and the young do not leave the nest until they are at least eight weekes old. The family of caracaras can be observed together for at least three months after the young fledge. There is usually only one brood, but two are not unusual.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg dates: late December-early April (mainly late January-February) in Florida (but nestling several weeks old has been observed in late December), late January-early June (peak March-April) in Texas, March-August in Mexico, mostly dry season in Colombia. Clutch size usually is 2-3. Incubation lasts about 30-32 days, by both sexes but probably mostly by female. Young are tended by both parents, leave nest at about 8 weeks; Johnsgard (1990) questioned that the nestling period is this long. Family stays together about 2-3 months after fledging. Usually one brood each season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caracara plancus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTATACCTACTCTTCGGAGCATGAGCCGGTATAGTTGGCACCGCCCTTAGCCTACTCATCCGTGCAGAACTAGGCCAACCCGGAACTCTCCTGGGAGACGACCAAATTTACAACGTAATCGTCACCGCCCATGCCTTCGTAATAATTTTCTTCATAGTAATGCCTATCATAATCGGCGGCTTTGGAAACTGATTAGTCCCCCTTATAATCGGTGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTACCCCCATCCTTTCTCCTACTACTAGCCTCCTCCACAGTAGAAGCTGGAGTCGGTACCGGATGAACCGTATACCCTCCCCTAGCAGGCAACCTAGCCCACGCCGGCGCCTCAGTAGACTTGGCCATCTTCTCCCTCCACTTAGCAGGAGTATCCTCCATCCTAGGGGCAATCAACTTCATCACAACAGCTATCAACATAAAACCACCAGCCCTCTCACAGTACCAAACCCCCCTCTTTGTCTGATCTGTACTTATCACTGCTGTCCTCCTCCTACTCTCACTACCAGTTCTTGCCGCAGGCATTACCATACTGCTAACCGACCGAAACCTAAACACCACATTCTTCGACCCAGCCGGCGGAGGCGATCCTATCCTATACCAACACCTATTCTGATTCTTCGGCCACCCTGAAGTCTACATCCTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Caracara plancus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Due to the drastic decrease in habitat, the caracara population has plummeted. The development of citrus groves, tree plantations, improved pastures, and other commercial and agricultural uses are destroying the caracara's natural habitat. Also, the increase amount of traffic in the caracara's natural habitat has resulted in many birds being hit by automobiles. Another significant factor into the decline of the caracara population is the fact that they have a low reproductive rate and face a small gene pool.

Many caracaras live on private lands in Florida, a few wandering to the east into Cape Canaveral and Merritt Island. Some pairs are being monitored on Federal Land, the Air Force's Avon Park bombing range in Polk and Highlands County.

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Common in many areas of the very extensive range (southern U.S. to South America); population trend varies regionally; probably increasing with deforestation in some areas, declining with agricultural and other development elsewhere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: In the U.S., declines have been associated with conversion of habitat to agriculture, residential development, and illegal shooting and trapping; increase in roads and traffic has resulted in increased mortality as the birds feed on road kills. Range has expanded in tropical America concurrent with deforestation; invasion of woody species with overgrazing tends to degrade habitat and result in declines (Ellis et al. 1988). In Texas, Dickinson (1995, Wilson Bull. 107:761-762) observed two instances of red imported fire ant predation on caracara hatchlings.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Ellis et al. (1988) recommended using supplemental feeding and modifying habitats to encourage recolonization of previously occupied areas and movement into new areas.

Florida: see recovery plan (1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There is not any documented evidence that Caracara cheriway hinders the human economy.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is not any documented evidence that Caracara cheriway benefits humans economically.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern crested caracara

The northern crested caracara (Caracara cheriway), also called the northern caracara and crested caracara,[3] is a bird of prey in the family Falconidae. It was formerly considered conspecific with the southern caracara (C. plancus) and the extinct Guadalupe caracara (C. lutosa) as the "crested caracara". It has also been known as the Audubon's caracara. As with its relatives, the Northern caracara was formerly placed in the genus Polyborus. Unlike the Falco falcons in the same family, the caracaras are not fast-flying aerial hunters, but are rather sluggish and often scavengers.

Distribution[edit]

The Northern caracara is a resident in Cuba, northern South America (south to northern Peru and northern Amazonian Brazil) and most of Central America and Mexico, just reaching the southernmost parts of the United States, including Florida, where it is resident but listed as threatened. There have been reports of the crested caracara as far north as San Francisco, California.[4] and, in 2012, near Crescent City, California.[5] South of the US border, it is generally common. It can also be found (nesting) in the Southern Caribbean (e.g. Curaçao and Bonaire). This is a bird of open and semi-open country.

Description[edit]

The mottled breast and pinkish-purple facial skin and cere are typical of immatures

The northern caracara has a length of 49–58 cm (19–23 in), a wingspan of 107–130 cm (42–51 in), and weighs 800–1,300 g (1.8–2.9 lb).[6] Among caracaras, it is second in size only to the southern caracara.[7] Broad-winged and long-tailed, it also has long legs and frequently walks and runs on the ground. It is very cross-shaped in flight. The adult has a black body, wings, crest and crown. The neck, rump, and conspicuous wing patches are white, and the tail is white with black barring and a broad terminal band. The breast is white, finely barred with black. The bill is thick, grey and hooked, and the legs are yellow. The cere and facial skin are deep yellow to orange-red depending on age and mood. Sexes are similar, but immature birds are browner, have a buff neck and throat, a pale breast streaked/mottled with brown, greyish-white legs and greyish or dull pinkish-purple facial skin and cere. The voice of this species is a low rattle.

Adults can be separated from the similar southern caracara by their less extensive and more spotty barring to the chest, more uniform blackish scapulars (brownish and often lightly mottled/barred in the southern), and blackish lower back (pale with dark barring in the southern). Individuals showing intermediate features are known from the small area of contact in north-central Brazil, but intergradation between the two species is generally limited.

Habitat[edit]

Northern caracaras inhabit various types of open and semi-open country. They typically live in lowlands but can live to mid-elevation in the Northern Andes. The species is most common in cattle ranches with scattered trees, shelterbelts and small woods, as long as there is a somewhat limited human presence. They can also be found in other varieties of agricultural land, as well as prairies, coastal woodlands (including mangroves), coconuts plantations, scrub along beach dunes and open uplands.

Behavior[edit]

Northern caracaras fighting. Painted by John James Audubon.

The northern caracara is an carnivorous scavenger that mainly feeds on carrion. The live prey they do catch is usually immobile, injured, incapacitated or young. Prey species can include small mammals, amphibians, reptiles, fish, crabs, insects, their larvae, earthworms, shellfish and young birds. Bird species that are culled can range from large, colonial nesting birds such as storks and herons to small passerines. Reptiles taken often including snakes, lizards and small freshwater turtles. This species, along with other caracaras, is one of few raptors that hunts on foot, often turning over branches and cow dung to reach food. In addition to hunting its own food on the ground, the northern caracara will steal from other birds, including vultures, Buteos, pelicans, ibises and spoonbills. Because they stay low to the ground even when flying, they often beat Cathartes vultures to carrion and can aggressively displace single vultures of most species from small carcasses. They will occasionally follow trains or automobiles to fetch food that falls off.[7]

Northern caracaras can usually be spotted either alone, in pairs or family parties of 3–5 birds. Occasionally roosts may contain more than a dozen caracaras and abundant food sources can cause more than 75 to gather. The nesting season is from December to May and is a bit earlier the closer the birds live to the tropics. They build large stick nests in trees such as mesquites and palms, cacti, or on the ground as a last resort.[8] The nests are bulky and untidy, 60–100 cm (24–39 in) wide and 15–40 cm (5.9–15.7 in) deep, often made of grasses, sticks and hay, spotted with much animal matter.[7] It lays 2 to 3 (rarely 1 to 4) pinkish-brown eggs with darker blotches, which are incubated for 28–32 days.[9]

Taxonomy[edit]

C. prelutosus fossil

Though the northern caracaras of our time are not divided into subspecies as their variation is clinal, prehistoric subspecies are known. Due to the confused taxonomic history of the crested caracaras, their relationships to the modern birds are in need of restudy:[citation needed]

The former almost certainly represents birds which were the direct ancestors of the living population. The latter may actually be the ancestor of the Guadalupe caracara.[citation needed]

Florida caracara[edit]

The state of Florida is home to a relict population of northern caracaras that dates to the last glacial period, which ended around 12,500 BP. At that point in time, Florida and the rest of the Gulf Coast was covered in an oak savanna. As temperatures increased, the savanna between Florida and Texas disappeared.[10] Caracaras were able to survive in the prairies of central Florida as well as in the marshes along the St. Johns River. Cabbage palmettos are a preferred nesting site, although they will also nest in southern live oaks.[11] Their historical range on the modern-day Florida peninsula included Okeechobee, Osceola, Highlands, Glades, Polk, Indian River, St. Lucie, Hardee, DeSoto, Brevard, Collier, and Martin counties.[12] They are currently most common in DeSoto, Glades, Hendry, Highlands, Okeechobee and Osceola counties.[13] Loss of adequate habitat caused the Florida caracara population to decline, and it was listed as threatened by the United States Fish and Wildlife Service in 1987.[12]

Northern caracara in Mexico[edit]

An immature bird surveying the surroundings in Texas, USA

The Mexican ornithologist Rafael Martín del Campo proposed that the northern caracara was probably the sacred "eagle" depicted in several pre-Columbian Aztec codices as well as the Florentine Codex. This imagery was adopted as a national symbol of Mexico, and is seen on the flag among other places. Since the paintings were interpreted as showing the Golden Eagle, it became the national bird.[14]

References[edit]

  1. ^ BirdLife International (2012). "Caracara cheriway". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Dove, Carla J.; Banks, Richard C. (1999). "A Taxonomic Study of Crested Caracaras (Falconidae)" (PDF). The Wilson Bulletin 111 (3): 330–339. 
  3. ^ "Common Names for Crested Caracara (Caracara cheriway)". Encyclopedia of Life. Retrieved 10 January 2014. 
  4. ^ "Rare Raptors". Golden Gate Raptor Observatory. Retrieved 22 August 2009. 
  5. ^ "caracara sighting record". Project Noah. 13 February 2012. 
  6. ^ "Crested Caracara". All About Birds. Cornell Lab of Ornithology. Retrieved 2009-08-22. 
  7. ^ a b c Ferguson-Lees, James; Christie, David A. (2001). Raptors of the World. Houghton Mifflin Harcourt. ISBN 0-618-12762-3. 
  8. ^ "Northern Caracara". Salt Grass Flats. Retrieved 22 January 2009. [dead link]
  9. ^ "Crested Caracara (Polyborus plancus)". Explore Birds of Prey. The Peregrine Fund. Retrieved 20 August 2009. 
  10. ^ "Chapter VIII. Florida Relict Species". Resource Guide. Indian River Lagoon Envirothon. Retrieved 23 January 2009. [dead link]
  11. ^ "Audubon’s Crested Caracara" (PDF). South Florida Ecological Services Office. United States Fish and Wildlife Service. Retrieved 23 January 2009. 
  12. ^ a b Morrison, J.L. (October 2004). "The Crested Caracara in the changing grasslands of Florida". In Noss, R. "Land of Fire and Water: The Florida Dry Prairie Ecosystem". Proceedings of the Florida Dry Prairie Conference, October 2004. Sebring, Florida. pp. 211–215. 
  13. ^ "Species Profile: Crested Caracara". Florida Fish and Wildlife Conservation Commission. Retrieved 10 August 2014. 
  14. ^ González Block, Miguel A. (2004). "El Iztaccuahtli y el Águila Mexicana: ¿Cuauhtli o Águila Real?". Arqueología Mexicana (in Spanish) XII (70): 60–65. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Southern crested caracara

The southern crested caracara (Caracara plancus), also known as the southern caracara or carancho, is a bird of prey in the family Falconidae. The classification of this species and name have evolved. It was formerly placed in the genus Polyborus. The use of the name formerly extended to two subspecies: the northern caracara (C. cheriway) of the southern United States, Mexico, Central America and northern South America, and the extinct Guadalupe caracara (C. lutosa) as subspecies. As the name is defined, the range of the southern caracara is restricted to central and southern South America.

Description[edit]

A flying southern caracara showing the distinctive light 'windows' in the wings

It has a total length of 50–65 cm (20–26 in) and a wingspan of 120–132 cm (47–52 in). Weight is 0.9-1.6 kg (2-3.5 lbs).[2] Individuals from the colder southern part of its range average larger than those from tropical regions (as predicted by Bergmann's rule) and are the largest type of caracara. The cap, belly, thighs, most of the wings and tail-tip are dark brownish, the auriculars, throat and nape are whitish-buff, and the chest, neck, mantle, back, uppertail-coverts, crissum and basal part of the tail are whitish-buff barred dark brownish. In flight, the outer primaries show a large conspicuous whitish-buff patch ('window'), as in several other species of caracaras. The legs are yellow and the bare facial skin and cere are deep yellow to reddish-orange. Juveniles resemble adults, but are paler, with streaking on the chest, neck and back, grey legs, and whitish, later pinkish-purple, facial skin and cere.

It can be separated from the similar northern caracara by its more extensive barring on the chest, brownish and often lightly mottled/barred scapulars (all blackish in northern), and pale lower back with dark barring (uniform blackish in northern). Individuals showing intermediate features are known from the small area of contact in north-central Brazil, but intergradation between the two species is generally limited.

Behavior[edit]

A southern caracara being mobbed by a fork-tailed flycatcher

A bold, opportunistic raptor, the southern crested caracara is often seen walking around on the ground looking for food. It mainly feeds on carcasses of dead animals, but will steal food from other raptors, raid bird nests, and take live prey if the possibility arises (mostly insects or other small prey, but at least up to the size of a snowy egret). It is dominant over the black and turkey vulture at carcasses. It is typically solitary, but several individuals may gather at a large food source (e.g. dumps). Breeding takes place in the austral spring/summer in the southern part of its range, but timing is less strict in warmer regions. The nest is a large open structure, typically placed on the top of a tree or palm, but sometimes on the ground. Average clutch size is two eggs.

Range and habitat[edit]

In Brazil

The southern crested caracara occurs from Tierra del Fuego in southernmost South America north to the Amazon River region and southern Peru. An isolated population occurs on the Falkland Islands. It avoids the Andean highlands and dense humid forest, such as the Amazon rainforest, where it is largely restricted to relatively open sections along major rivers. Otherwise, it occurs in virtually any open or semi-open habitat and is often found near humans.

Status[edit]

Throughout most of its range, it is common to very common. It is likely to benefit from the widespread deforestation in tropical South America. It is therefore considered to be of Least Concern by BirdLife International.


References[edit]

  • Dove, C. & R. Banks. 1999. A Taxonomic study of Crested Caracaras (Falconidae). Wilson Bull. 111(3): 330-339. Available online (PDF)
  • Ferguson-Lees, J., D. Christie, P. Burton, K. Franklin & D. Mead (2001). Raptors of the World. Christopher Helm. ISBN 0-7136-8026-1
  • Restall, R., C. Rodner, & M. Lentino (2006). Birds of Northern South America. Vol. 1 & 2. Helm, London. ISBN 0-7136-7242-0 (vol. 1); ISBN 0-7136-7243-9 (vol. 2)
  • Schulenberg, T., D. Stotz, D. Lane, J. O'Neill, & T. Parker III (2007). Birds of Peru. Helm, London. ISBN 978-0-7136-8673-9
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in C. plancus, but recognized as a separate species by AOU (2000) on the basis of analyses of plumage, morphology, and reported hybridization by Dove and Banks (1999). C. plancus, now referred to as the Southern Caracara, is restricted to southern Peru and central Brazil south to Tierra del Fuego and the Falkland Islands (AOU 2000).

Formerly included in the genus Polyborus, but that name has no standing because it is based on a type species that is not identifiable (AOU 1993, Banks and Browning 1995).

The Florida population was listed by USFWS as part of subspecies Polyborus plancus audubonii, but this taxon evidently is no longer accepted; audubonii was not mentioned as a distinctive "group" or subspecies by AOU (1983, 1998, 2000) nor by Sibley and Monroe (1990). Johnsgard (1990) included audubonii in subspecies cheriway, and Sibley and Monroe and AOU (1998) included it (unnamed) in the cheriway group. Palmer (1988) recognized audubonii as a valid subspecies. Extinct form on Guadalupe Island now recognized as a distinct species C. lutosa (AOU 2000, Dove and Banks 1999, Sibley and Monroe 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!