Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Range

Amazon basin to e Peru, Tierra del Fuego and Falkland Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 37.6 years (captivity) Observations: A specimen of a Brazilian caracara classified as *Polyborus tharus* lived 37.6 years in captivity (Flower 1938). Record longevity in the wild is 17.6 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caracara plancus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTATACCTACTCTTCGGAGCATGAGCCGGTATAGTTGGCACCGCCCTTAGCCTACTCATCCGTGCAGAACTAGGCCAACCCGGAACTCTCCTGGGAGACGACCAAATTTACAACGTAATCGTCACCGCCCATGCCTTCGTAATAATTTTCTTCATAGTAATGCCTATCATAATCGGCGGCTTTGGAAACTGATTAGTCCCCCTTATAATCGGTGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTACCCCCATCCTTTCTCCTACTACTAGCCTCCTCCACAGTAGAAGCTGGAGTCGGTACCGGATGAACCGTATACCCTCCCCTAGCAGGCAACCTAGCCCACGCCGGCGCCTCAGTAGACTTGGCCATCTTCTCCCTCCACTTAGCAGGAGTATCCTCCATCCTAGGGGCAATCAACTTCATCACAACAGCTATCAACATAAAACCACCAGCCCTCTCACAGTACCAAACCCCCCTCTTTGTCTGATCTGTACTTATCACTGCTGTCCTCCTCCTACTCTCACTACCAGTTCTTGCCGCAGGCATTACCATACTGCTAACCGACCGAAACCTAAACACCACATTCTTCGACCCAGCCGGCGGAGGCGATCCTATCCTATACCAACACCTATTCTGATTCTTCGGCCACCCTGAAGTCTACATCCTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Caracara plancus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2005
    Least Concern
  • 2004
    Not Recognized
  • 2000
    Not Recognized
  • 1994
    Not Recognized
  • 1988
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern Crested Caracara

The Northern Crested Caracara, Northern Caracara, or Crested Caracara (Caracara cheriway) as it is properly known where it lives in the Americas,[3][4][5] is a bird of prey in the family Falconidae. It was formerly considered conspecific with the Southern Caracara (C. plancus) and the extinct Guadalupe Caracara (C. lutosa) as the "Crested Caracara". It has also been known as the Audubon's Caracara. As with its relatives, the Northern Caracara was formerly placed in the genus Polyborus. Unlike the Falco falcons in the same family, the caracaras are not fast-flying aerial hunters, but are rather sluggish and often scavengers.

Contents

Distribution [edit]

The Northern Caracara is a resident in Cuba, northern South America (south to northern Peru and northern Amazonian Brazil) and most of Central America and Mexico, just reaching the southernmost parts of the United States, including Florida, where it is resident but listed as threatened. There have been reports of the Crested Caracara as far north as San Francisco, California.[6] and most recently near Crescent City, California. South of the US border, it is generally common. It can also be found (nesting) in the Southern Caribbean (e.g. Curaçao and Bonaire). This is a bird of open and semi-open country.

Description [edit]

The mottled breast and pinkish-purple facial skin and cere are typical of immatures

The Northern Caracara has a length of 49–58 cm (19–23 in), a wingspan of 107–130 cm (42–51 in), and weighs 800–1,300 g (1.8–2.9 lb).[7] Among caracaras, it is second in size only to the Southern Caracara.[8] A broad-winged and long-tailed, it also has long legs and frequently walks and runs on the ground. It is very cross-shaped in flight. The adult has a black body, wings, crest and crown. The neck, rump, and conspicuous wing patches are white, and the tail is white with black barring and a broad terminal band. The breast is white, finely barred with black. The bill is thick, grey and hooked, and the legs are yellow. The cere and facial skin are deep yellow to orange-red depending on age and mood. Sexes are similar, but immature birds are browner, have a buff neck and throat, a pale breast streaked/mottled with brown, greyish-white legs and greyish or dull pinkish-purple facial skin and cere. The voice of this species is a low rattle.

Adults can be separated from the similar Southern Caracara by their less extensive and more spotty barring to the chest, more uniform blackish scapulars (brownish and often lightly mottled/barred in Southern), and blackish lower back (pale with dark barring in Southern). Individuals showing intermediate features are known from the small area of contact in north-central Brazil, but intergradation between the two species is generally limited.

Habitat [edit]

Northern Caracaras inhabit various types of open and semi-open country. They typically in lowlands but can live to mid-elevation in the Northern Andes. The species is often commonest in cattle ranches with scattered trees, shelterbelts and small woods, as long as there is somewhat limited human presences. They can also be found in other varieties of agricultural land, as well as prairies, coastal woodlands (including mangroves), coconuts plantations, scrub along beach dunes and open uplands.

Behavior [edit]

The Northern Caracara is an carnivorous scavenger that mainly feeds on carrion. The live prey they do catch is usually immobile, injured, incapacitated or young. Prey species can include small mammals, amphibians, reptiles, fish, crabs, insects, their larvae, earthworms, shellfish and young birds. Bird species that are culled can range from large, colonial nesting birds such as storks and herons to small passerines. Reptiles taken often including snakes, lizards and small freshwater turtles. This species, along with other caracaras, is one of few raptors that hunts on foot, often turning over branches and cow dung to reach food. In addition to hunting its own food on the ground, the Northern Caracara will steal from other birds, including vultures, Buteos, pelicans, ibises and spoonbills. Because they stay low to the ground even when flying, they often beat Catharus vultures to carrion and can aggressively displace single vultures of most species from small carcasses. They will occasionally follow trains or automobiles to fetch food that falls off.[8]

Northern Caracaras can usually be spotted either alone, in pairs or family parties of 3–5 birds. Occasionally roosts may contain more than a dozen caracaras and abundant food sources can cause more than 75 to gather. The nesting season is from December to May and is a bit earlier the closer the birds live to the tropics. They build large stick nests in trees such as mesquites and palms, cacti, or on the ground as a last resort.[9] The nests are bulky and untidy, 60–100 cm (24–39 in) wide and 15–40 cm (5.9–16 in) deep, often made of grasses, sticks and hay, spotted with much animal matter.[8] It lays 2 to 3 (rarely 1 to 4) pinkish-brown eggs with darker blotches, which are incubated for 28–32 days.[10]

Taxonomy [edit]

C. prelutosus fossil

Though the Northern Caracaras of our time are not divided into subspecies as their variation is clinal, prehistoric subspecies are known. Due to the confused taxonomic history of the crested caracaras, their relationships to the modern birds are in need of restudy:[citation needed]

The former almost certainly represents birds which were the direct ancestors of the living population. The latter may actually be the ancestor of the Guadalupe Caracara.[citation needed]

Florida Caracara [edit]

The state of Florida in the United States is home to a relict population of Northern Caracaras that dates to the last glacial period, which ended around 12,500 BP. At that point in time, Florida and the rest of the Gulf Coast was covered in an oak savanna. As temperatures increased, the savanna between Florida and Texas disappeared.[11] Caracaras were able to survive in the prairies of central Florida as well as in the marshes along the St. Johns River. Cabbage Palmettos are a preferred nesting site, although they will also nest in Southern Live Oaks.[12] Their historical range on the modern-day Florida peninsula included Okeechobee, Osceola, Highlands, Glades, Polk, Indian River, St. Lucie, Hardee, Desoto, Brevard, Collier, and Martin counties.[13] They are currently most common in DeSoto, Glades, Hendry, Highlands, Okeechobee and Osceola counties.[14] Loss of adequate habitat caused the Florida Caracara population to decline, and it was listed as threatened by the United States Fish and Wildlife Service in 1987.[13]

Northern Caracara in Mexico [edit]

An immature bird surveying the surroundings in Texas, USA

The Mexican ornithologist Rafael Martín del Campo proposed that the Northern Caracara was probably the sacred "eagle" depicted in several pre-Columbian Aztec codices as well as the Florentine Codex. This imagery was adopted as a national symbol of Mexico, and is seen on the flag among other places. Since the paintings were interpreted as showing the Golden Eagle, it became the national bird.[15]

References [edit]

  1. ^ BirdLife International (2012). "Caracara cheriway". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Dove, Carla J.; Banks, Richard C (1999). "A Taxonomic Study of Crested Caracaras (Falconidae)" (PDF). The Wilson Bulletin 111 (3): 330–339. 
  3. ^ AOU Check-list of North American Birds. 7th edition w. supplements. Accessed 2008-04-26
  4. ^ ABA Check-list (PDF). Version 6.8. Accessed 2008-04-26
  5. ^ Clements, James F (2007). The Clements Checklist of the Birds of the World (6th ed.). Cornell University Press. ISBN 978-0-7136-8695-1. 
  6. ^ "Rare Raptors". Golden Gate Raptor Observatory. Retrieved 2009-08-22. 
  7. ^ "Crested Caracara Life History". All About Birds. Cornell Lab of Ornithology. Retrieved 2009-08-22. 
  8. ^ a b c Ferguson-Lees, James and Christie, David A. (2001) Raptors of the World, Houghton Mifflin Harcourt, ISBN 0-618-12762-3
  9. ^ "Northern Caracara". Salt Grass Flats. Retrieved 2009-01-22. 
  10. ^ "Crested Caracara (Polyborus plancus)". Explore Birds of Prey. The Peregrine Fund. Retrieved 2009-08-20. 
  11. ^ "Chapter VIII. Florida Relict Species". Resource Guide. Indian River Lagoon Envirothon. Retrieved 2009-01-23. 
  12. ^ "Audubon’s Crested Caracara" (PDF). South Florida Ecological Services Office. United States Fish and Wildlife Service. Retrieved 2009-01-23. 
  13. ^ a b Morrison, Joan L. The Crested Caracara in the Changing Grasslands of Florida. Archbold Biological Station. 
  14. ^ "Species Spotlight: Crested Caracara". Wildlife Viewing. Florida Fish and Wildlife Conservation Commission. Retrieved 2009-01-23. 
  15. ^ González Block, Miguel A. (2004). "El Iztaccuhtli y el Águila Mexicana: ¿Cuauhti o Águila Real?". Arqueología Mexicana. Retrieved 2009-01-18.  (Iztaccuhtli should be iztaccuahtli and cuauhti should be cuauhtli.) This page shows the beginning of an article in Arqueología Mexicana XII: 70, pp. 60–65 (2004).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Southern Crested Caracara

The Southern Crested Caracara (Caracara plancus), also known as the Southern Caracara or Carancho, is a bird of prey in the family Falconidae. The classification of this species and name have evolved. It was formerly placed in the genus Polyborus. The use of the name formerly extended to two subspecies: the Northern Caracara (C. cheriway) of the southern United States, Mexico, Central America and northern South America, and the extinct Guadalupe Caracara (C. lutosa) as subspecies. As the name is presently defined, the range of the Southern Caracara is restricted to central and southern South America.

Contents

Description

A flying Southern Caracara showing the distinctive light 'windows' in the wings

It has a total length of 50–65 cm (20–26 in) and a wingspan of 120–132 cm (47–52 in). Weight is 0.9-1.6 kg (2-3.5 lbs).[2] Individuals from the colder southern part of its range average larger than those from tropical regions (as predicted by Bergmann's rule) and are the largest type of caracara. The cap, belly, thighs, most of the wings and tail-tip are dark brownish, the auriculars, throat and nape are whitish-buff, and the chest, neck, mantle, back, uppertail-coverts, crissum and basal part of the tail are whitish-buff barred dark brownish. In flight, the outer primaries show a large conspicuous whitish-buff patch ('window'), as in several other species of caracaras. The legs are yellow and the bare facial skin and cere are deep yellow to reddish-orange. Juveniles resemble adults, but are paler, with streaking on the chest, neck and back, grey legs, and whitish, later pinkish-purple, facial skin and cere.

It can be separated from the similar Northern Caracara by its more extensive barring on the chest, brownish and often lightly mottled/barred scapulars (all blackish in Northern), and pale lower back with dark barring (uniform blackish in Northern). Individuals showing intermediate features are known from the small area of contact in north-central Brazil, but intergradation between the two species is generally limited.

Behavior

A Southern Caracara being mobbed by a Fork-tailed Flycatcher

A bold, opportunistic raptor, the Southern Crested Caracara is often seen walking around on the ground looking for food. It mainly feeds on carcasses of dead animals, but will steal food from other raptors, raid bird nests, and take live prey if the possibility arises (mostly insects or other small prey, but at least up to the size of a Snowy Egret). It is dominant over the Black and Turkey Vulture at carcasses. It is typically solitary, but several individuals may gather at a large food source (e.g. dumps). Breeding takes place in the austral spring/summer in the southern part of its range, but timing is less strict in warmer regions. The nest is a large open structure, typically placed on the top of a tree or palm, but sometimes on the ground. Average clutch size is two eggs.

Range and habitat

In Brazil

The Southern Crested Caracara occurs from Tierra del Fuego in southernmost South America north to the Amazon River region and southern Peru. An isolated population occurs on the Falkland Islands. It avoids the Andean highlands and dense humid forest, such as the Amazon rainforest, where it is largely restricted to relatively open sections along major rivers. Otherwise, it occurs in virtually any open or semi-open habitat and is often found near humans.

Status

Throughout most of its range, it is common to very common. It is likely to benefit from the widespread deforestation in tropical South America. It is therefore considered to be of Least Concern by BirdLife International.


References

  • Dove, C. & R. Banks. 1999. A Taxonomic study of Crested Caracaras (Falconidae). Wilson Bull. 111(3): 330-339. Available online (PDF)
  • Ferguson-Lees, J., D. Christie, P. Burton, K. Franklin & D. Mead (2001). Raptors of the World. Christopher Helm. ISBN 0-7136-8026-1
  • Restall, R., C. Rodner, & M. Lentino (2006). Birds of Northern South America. Vol. 1 & 2. Helm, London. ISBN 0-7136-7242-0 (vol. 1); ISBN 0-7136-7243-9 (vol. 2)
  • Schulenberg, T., D. Stotz, D. Lane, J. O'Neill, & T. Parker III (2007). Birds of Peru. Helm, London. ISBN 978-0-7136-8673-9
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!