Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Brief Summary

"Cool facts"

A bird of the tropical waterways of Central and South America, the Neotropic Cormorant reaches the upper limits of its range in Texas and occasionally, the Great Plains. Although it superficially resembles North America's other freshwater cormorant, the Double-crested Cormorant, the Neotropic Cormorant stands apart in various aspects of behavior, as well as range.

The Neotropic Cormorant is the only cormorant known to plunge-dive into water to catch fish. Unlike gannets and boobies, it does not dive from great heights, restricting its dives to less than a half-meter (1.75 feet) over the water. It is not particularly successful with this technique, catching a fish only once in every six to ten plunges.

In Mexico, Neotropic Cormorants reportedly often fish cooperatively, forming a line across swift-flowing streams and striking the surface with their wings, causing fish to flee, whereupon the cormorants dive and pursue them.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Resident from Sonora, southern New Mexico, coastal Texas (north to around Dallas), and southwestern Louisiana south through Middle and South America; also Cuba and Bahamas. Casual or accidental in various localities north of main range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Neotropic Cormorant is found throughout the continent of South America, ranging as far north as the Bahamas and Cuba, north-western Mexico and southern United States1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Neotropical cormorants breed from Cape Horn, South America to northern Texas, southwestern Louisiana, and southern Arizona. In winter, they have been recorded wandering as far outside their breeding range as California, Saskatchewan, and Pennsylvania. Generally they are restricted to the southern United States, Central America, the West Indies, and South America. They are non-migratory, but are nomadic during the non-breeding season.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Howell, S. 1995. Guide to the Birds of Mexico and Northern Central America. Oxford: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Neotropical cormorants are jet black, aquatic birds, weighing between 1.2 and 1.4 kilograms. They range in length from 63.5 to 68.5 cm, with an approximate wingspan of 102 cm. A pale green gular patch at the base of the bill with a white “v” outline distinguishes them from similar species, such as double-crested cormorant (Phalacrocorax auritus). They have roughly equivalent neck and tail lengths, but are easily detectable in flight. Double-crested cormorants have shorter tails. A faint greenish shine on the upper wings and back may be detectable under correct lighting conditions. Juvenile birds lack this green shine and are generally paler. Their breasts are brown instead of black, and their beaks may appear yellower. Juveniles may be especially difficult to tell apart from other cormorant species due to their dull gular patches. There is no discernible sexual dimorphism.

Range mass: 1.2 to 1.4 kg.

Range length: 63.5 to 68.5 cm.

Average wingspan: 102 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Sibley, D. 2000. The Sibley Guide to Birds. New York: Chanticleer/Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 66 cm

Weight: 1260 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Rivers, lakes, marshes, and seacoasts. Prefers shallow clear water at low elevations (Stiles and Skutch 1989). Also occurs in montain streams and alpine lakes in South America. Nests on coastal islands, and around inland lakes, reservoirs, ponds; in living or dead trees or bushes, 1-7 m above water, mostly in tallest available trees or shrubs. Also on rocks or bare ground where woody vegetation lacking. In Louisiana, most nesting occurred in heronries.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species occupies a wide range of habitats in fresh, brackish or salt water. Its diet it equally varied, including small fish, crustaceans, frogs, tadpoles and aquatic insects, with the exact composition varying locally. It feeds mainly by pursuit-diving, but also by plung-diving at sea. It often fishes co-operatively. Breeding occurs all year round with the peak varying locally. It forms colonies, sometimes thousands of pairs strong. It forms nests in trees and bushes or on rocky ground (del Hoyo et al. 1992).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Neotropical cormorants are found in a variety of habitats, although close proximity to deep water is preferred. Availability of perches for sunning and drying their wings is also important in habitat preferences. Neotropical cormorants can be found in fresh, brackish, or salt water, bays, lagoons, streams, salt ponds, seashores, and lakes. In the United States, they are commonly found in coastal marshes and swamps. Elevation is not a concern, as birds are found from sea level wetlands to high mountain lakes in the Andes.

Range elevation: 0 to 5000 m.

Habitat Regions: temperate ; tropical ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 65 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 13.353 - 15.966
  Nitrate (umol/L): 0.390 - 3.951
  Salinity (PPS): 33.310 - 33.476
  Oxygen (ml/l): 5.741 - 6.095
  Phosphate (umol/l): 0.374 - 0.674
  Silicate (umol/l): 2.355 - 5.723

Graphical representation

Temperature range (°C): 13.353 - 15.966

Nitrate (umol/L): 0.390 - 3.951

Salinity (PPS): 33.310 - 33.476

Oxygen (ml/l): 5.741 - 6.095

Phosphate (umol/l): 0.374 - 0.674

Silicate (umol/l): 2.355 - 5.723
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May make seasonal or erratic movements at the northern and southern extremes of the range (Johnsgard 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Apparently eats mainly fishes; also amphibians and dragonfly nymphs. At Galveston Bay, Texas, about 50% of diet was CYPRINODON VARIEGATUS (King 1989). At Sabine Lake, Texas, sailfin molly was most important, with CYPRINODON, FUNDULUS, GAMBUSIA, MICROPOGON, and MUGIL making up the rest of the diet; these are small, abundant species of protected inlets and ponds (Morrison et al., cited by Johnsgard 1993). May fish in strong surf or cooperatively in lines in rivers (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Some research suggests that neotropical cormorants are aquatic generalists, eating fish, frogs, tadpoles, and dragonfly nymphs. Other research indicates that fish and shrimp comprise an overwhelming majority of their diets. To forage, neotropical cormorants generally pursuit dive. However, in large flock feeding situations, birds also engage in plunge-diving techniques. Sometimes birds may even line up to "herd" fish. Studies show adults are more adept feeders than juveniles, who take some time to learn effective foraging methods.

Animal Foods: amphibians; fish; insects; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

  • King, K. 1989. Food habits and organochlorine contaminants in the diet of Olivaceous Cormorants in Galveston Bay, Texas. Southwestern Naturalist, 34: 338-343.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Interspecific competition with double-crested cormorants could contribute to limiting the extent of their northern range. An interesting mutualism between neotropical cormorants and roseate spoonbills (Ajaia ajaja) has been observed in Texas, in which individuals of both species group together for more effective predator protection. Moreover, studies have shown that neotropical cormorant guano provides vital biotic sustenance for aquatic ecosystems, and helps maintain nutrient levels.

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Raccoons and grackles, both great-tailed and boat-tailed, feed on eggs and young. However, grackles seem to raid nests only after human disturbance has caused the cormorants to abandon their nests for a short period. Interestingly, neighbors tend to protect other birds’ nests when the parents leave to forage.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Sociable, but more often alone or in pairs along forested rivers (Hilty and Brown 1986). Typically forages singly. In Argentina, young dispersed mainly within 650 km of natal site (see Johnsgard 1993). In Texas, raccoons and boat-tailed grackles prey on eggs and young.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The majority of intraspecific communication is through vocalizations. When alarmed, neotropical cormorants emit a simple guttural call. During flock feeding, calls are common. Males are generally more vocal than females, but both sexes are usually silent outside of the breeding season. Hatchlings use food-begging calls to beg for food. Neotropical cormorants also communicate through visual displays, primarily during courtship.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Surface dive

Dives from surface, using feet for propulsion through water. Catches fish under water, then takes prey to surface and swallows it headfirst. Also plunge-dives from above water.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Most active between sunrise and sunset.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest reported wild neotropical cormorant was caught after being banded for 12 years and 7 months. Generally, mortality rates are highest in the initial stages of life. Fledglings often die when parents abandon their nest following human disturbance, starvation, or storms. At this point predators such as common raccoons (Procyon lotor) and grackles (Quiscalus) exploit open, unprotected nests.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
151 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12.6 years (wild) Observations: Oldest bird in banding studies was 12.6 years-old (Clapp et al. 1982). Some authors consider the northern subspecies, to which the longevity records refers to, as a separate species called *Phalacrocorax olivaceus*.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In Texas, egg records extend from early February to mid-October, with a peak between April and August (Johnsgard 1993). Breeding is nearly complete by late June in Colombia; some nesting begins in April in Panama (Hilty and Brown 1986). Clutch size is 2-6 (reportedly usually 4 but mean 2.9 in Texas). Incubation averages about 24-25 days. Young are tended by both sexes (Palmer 1962), independent by 12 weeks. Renests if clutch is lost. In Texas, 43% of chicks fledged (see Johnsgard 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Neotropical cormorants are monogamous throughout the breeding season. They engage in intricate displays to attract mates. Males choose the nest site and females assess the location, either accepting or rejecting the offered nest. Courtship displays are characterized by birds waving their wings and calling. A variety of different displays exist, including the gaping display (necks are stretched upward and calls are made), pointing (the neck slowly and silently sways), kink throated display (an arched neck posture), and both pre-takeoff and post-landing displays. Monogamy is thought to be annual, as neotropical cormorants pick new mates each year.

Mating System: monogamous

Neotropical cormorants have comparatively long breeding seasons, lasting from June to mid-October in Texas, April to June in Argentina, and October to November along the Patagonian coast. Males choose nest sites in small trees or other structures. Normally nests are located between 0.9 and 6.1 meters in height. While males choose nest sites and bring nest material, it is the female that actually constructs the nest. Portions of previous nests are often re-used. Nests are usually composed of a thick outer layer of twigs and sticks, lined with soft grasses and seaweed. The mean external diameter of nests is 34.4 cm, with a height of 14.2 cm. Neotropical cormorants nest communally, spacing nests at a minimum of 70 to 75 cm apart. Colonies may be massive, up to several thousand individuals. Eggs are oval, with light blue and chalky white hues. Average dimensions are 54.54 by 33.68 mm. Mean clutch size is 3 to 4 eggs, though the range is from 1 to 7. An average of 2.1 young survive past the first ten days after hatching. Eggs are laid at two day intervals. Incubation begins after two days and lasts 23 to 26 days with a mean of 24.6. Eggs hatch asynchronously.

Breeding interval: Neotropical cormorants breed once yearly.

Breeding season: Neotropical cormorants have comparatively long breeding seasons lasting from June to mid-October in Texas, April to June in Argentina, and October to November along the Patagonian coast.

Range eggs per season: 1 to 7.

Average eggs per season: 3-4.

Range time to hatching: 23 to 26 days.

Average time to hatching: 24.6 days.

Average fledging age: 8 weeks.

Average time to independence: 11 weeks.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Neotropical cormorant hatchlings are altricial and are attended to for eleven weeks. At 8 weeks the young are capable of swimming and diving. By twelve weeks the young are completely independent. Until then, the parents brood, feed, and protect their chicks. In the heat, the chicks are shaded, and, in the cold, they are brooded. Chicks emit a distinctive call for feeding, and both parents respond by regurgitating liquid into their mouths. As the chicks develop, they are eventually fed whole fish. Studies document 3 to 8 feedings per day. Parents engage in no nest sanitation techniques and feces and rotten fish frequently build up in the nest.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Morrison, M. 1979. Breeding biology and specific mortality of Olivaceous Cormorants. Southwestern Naturalist, 24: 259-266.
  • Quintana, F. 2004. Diving behaviour and foraging areas of the neotropic cormorant at the marine colony in Patagonia, Argentina. Wilson Bulletin, 116: 83-88.
  • Telfair, R., M. Morrison. 1999. "Neotropic Cormorant (Phalacrocorax brasilianus)" (On-line). The Birds of North America Online. Accessed June 12, 2007 at http://bna.birds.cornell.edu/BNA/account/Neotropic_Cormorant/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phalacrocorax brasilianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTCATCTTCGGCGCCTGAGCTGGCATAGTCGGAACTGCCCTTAGCTTGCTTATCCGCGCAGAACTCGGTCAACCAGGAACCCTCCTTGGAGATGACCAAATCTACAATGTAATTGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATGGTAATGCCCATTATAATCGGAGGATTCGGAAACTGACTGGTCCCCCTCATAATCGGCGCCCCCGACATAGCATTCCCACGTATAAACAACATAAGCTTCTGACTCCTTCCACCATCATTCCTCCTCTTATTAGCCTCCTCTACAGTAGAAGCAGGCGCAGGTACAGGATGAACGGTATATCCACCCCTAGCCGGAAACCTAGCCCATGCTGGAGCCTCAGTTGACCTAGCCATCTTCTCCCTTCACTTAGCAGGGGTCTCCTCAATCCTAGGAGCAATCAACTTCATCACAACTGCCATTAACATAAAACCCCCAGCCCTATCACAATACCAAACACCGCTGTTCGTTTGATCCGTACTAATCACCGCAGTCTTACTCTTACTCTCACTCCCAGTCCTTGCTGCCGGAATCACCATACTCCTAACAGACCGAAACCTAAACACAACATTCTTTGACCCTGCTGGAGGAGGAGACCCAGTCCTATACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phalacrocorax brasilianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Neotropical cormorants were evaluated as species of least concern in 2001 by BirdLife International due to their large range (18 million km^2) and large population size (estimated 2 million individuals). However, the species is protected under the Migratory Bird Treaty Act. Neotropical cormorants still face human threats, as they are hunted, poisoned by pesticides, and driven from their habitats.

US Migratory Bird Act: protected

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population is estimated to number 2,000,000 individuals.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: See King (1989) for information on contamination with DDE and PCB in Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Many fishermen think that neotropical cormorants decimate fish populations, thereby depleting fish reserves. These birds are often shot near fisheries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Some fishermen use neotropical cormorants to locate abundant fish schools. Their guano may even help augment biomass in aquatic ecosystems.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Neotropic cormorant

The Neotropic cormorant or olivaceous cormorant (Phalacrocorax brasilianus) is a medium-sized cormorant found throughout the American tropics and subtropics, from the middle Rio Grande and the Gulf and Californian coasts of the United States south through Mexico and Central America to southern South America. It also breeds on the Bahamas, Cuba and Trinidad. It can be found both at coasts (including some mangrove areas) and on inland waters. There are at least two subspecies: P. b. mexicanus from Nicaragua northwards and P. b. brasilianus further south.

Taxonomy[edit]

The species was documented in 1658 by Willem Piso after travels in Brazil. This formed the basis for the description and naming of the species by Johann Friedrich Gmelin in 1789. Many later authors preferred to use the name Phalacrocorax olivaceus based on Alexander von Humboldt's 1805 description because the identity of Piso's birds was considered uncertain. Recently, many authorities such as the American Ornithologists' Union have begun to use Phalacrocorax brasilianus after M. Ralph Browning argued that Piso's description and paintings do indeed refer to the Neotropic cormorant.[2]

Description[edit]

Flying in Argentina

This bird is 64 cm (25 in) long with a 100 cm (39 in) wingspan. Adults males weigh from 1.1 to 1.5 kg (2.4 to 3.3 lb), adult females 50 to 100 g (1.8 to 3.5 oz) less. Birds of the southern populations tend to be bigger than the more northerly birds. It is small and slender, especially compared to the larger, heavier-looking double-crested cormorant. It has a long tail and frequently holds its neck in an S-shape. Adult plumage is mainly black, with a yellow-brown throat patch. During breeding, white tufts appear on the sides of the head, there are scattered white filoplumes on the side of the head and the neck, and the throat patch develops a white edge. The upper wings are somewhat grayer than the rest of the body. Juveniles are brownish in color.

Behaviour[edit]

Neotropic cormorants in New Mexico

Its diet consists mainly of small fish, but will also eat tadpoles, frogs, and aquatic insects. Information about its prey is sparse, but inland birds seem to feed on small, abundant fish in ponds and sheltered inlets, less than 10 cm (3.9 in) in length, with an individual weight of a gram or two, such as Poecilia species especially the sailfin molly Poecilia latipinna. This cormorant forages for food by diving underwater, propelling itself by its feet. Its dives are brief, between 5 and 15 seconds. It is also known to forage in groups, with several birds beating the water with their wings to drive fish forward into shallows.

Neotropic cormorants are monogamous and breed in colonies. The nest is a platform of sticks with a depression in the center circled with twigs and grass. It is built a few meters above the ground or water in bushes or trees. Up to five chalky, bluish-white eggs are laid. Most pairs lay three eggs, but the mean number hatched is less than two. The eggs soon become nest-stained. Both sexes incubate for about 25–30 days, and both parents feed the young until around the 11th week. By week 12, they are independent. One brood is raised per year.

Unlike other cormorants, this bird can often be seen perching on wires.

This bird is largely a permanent resident, with some birds occasionally wandering north in the warmer months.

References[edit]

Two cormorants in flight, in the Pearl Islands of Panama
  • Johnsgaard, P. A. (1993), Cormorants, darters and pelicans of the world. Washington DC: Smithsonian Institution Press.
  • Kaufman, Kenn; Lives of North American Birds. Houghton Mifflin Company, New York, NY (1996). ISBN 0-395-77017-3
  • World Wildlife Fund. 2010. Petenes mangroves. eds. Mark McGinley, C.Michael Hogan & C. Cleveland. Encyclopedia of Earth. National Council for Science and the Environment. Washington DC
  • Alsop, Fred J. III; Birds of Texas. Smithsonian Handbooks: DK Publishing, Inc. (2002). ISBN 0-7894-8388-2
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly known as the olivaceous cormorant, P. olivaceus (see AOU 1991, Browning 1989, Banks and Browning 1995). See Siegel-Causey (1988) for an analysis of relationships within the family. Siegel-Causey (1988) proposed removing this species from the genus Phalacrocorax and including it in the genus Hypoleucus; DeBenedictis (1990, Birding 21:166-168) concluded that the taxonomic ranks of many groups recognized by Siegel-Causey (1988) are inflated and inconsistent with other taxonomic data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!