Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) Breeding range encompasses western, central and south-coastal Alaska, central and southern Yukon, northwestern British Columbia, and northeastern Siberia and Chukotka. The majority (more than 90 percent) of the population breeds in North America (Gill et al. 2002).

During the nonbreeding season, the species occurs mainly in Oceania from the Hawaiian Islands south through east and central Polynesia, also in Micronesia; it is present but not common in southern Melanesia and west to New Guinea, Australia, New Zealand and Japan (Gill et al. 2002). It also winters along the Pacific coast of North America mainly from southern California south to Revillagigedo Islands and coastal Mexico, and locally to Honduras, Costa Rica, Panama, Colombia, Peru, Galapagos Islands, and Ecuador. A significant portion of the population remains on the nonbreeding grounds for at least one year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 28 cm

Weight: 116 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Breeding: Mostly restricted to the alpine zone, usually breeds along rocky or scrubby vegetated edges of mountain streams and lakes; frequents rapidly-flowing streams and tundra habitats, wet meadows, moraine deposits, scree slopes, braided rivers, sometimes found in forest clearings away from water. Often nests on the ground in a rocky or gravelly site; in Prince William Sound, Alaska, known to nest above tide line on gravel areas of the immediate coast, and also commonly observed nesting on/near sparsely vegetated tailing piles in areas of old placer mining activity (Weeden 1965, Johnsgard 1981, Weeden 1959 in Gill et al. 2002). Nests also observed in dwarf shrub tundra near streams or lakes (Spindler et al. 1980, Gill et al. 2002).

Non-breeding: Mainly rocky shores and islands, also sandy island beaches along coast, sometimes on mudflats and along rocky streams. Occasionally found on freshwater impoundments near coast and on estuarine substrates (Gill et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Adults migrate northward from non-breeding grounds through Oceania and along U.S. Pacific coast from March-early June; subadults remain in non-breeding range through 2nd and likely 3rd year (Gill et al. 2002). Spring migrants arrive almost simultaneously along the entire Pacific coastline of Alaska in late April or early May (Kessel and Gibson 1978). Those with breeding grounds near the Bering Sea do not arrive until mid-May or later. Southward migration occurs July-October with most birds moving from Alaska, Yukon Territory and Russian Far East across the Pacific to the Hawaiian Islands, throughout Polynesia, New Zealand, eastern Australia and eastern Micronesia, and some birds moving down the Pacific coast of the Americans and the Galapagos Islands (Gill et al. 2002). Southward migration from Alaska is underway by mid-July (Kessel and Gibson 1978) (the earliest birds are adults, probably failed breeders) and lasts until October (Gabrielson and Lincoln 1959); the main exodus from Alaska is during August, after young have fledged (Kessel 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats polychaete worms, mollusks, crustaceans, insects, amphipods, and fish (Gill et al. 2002). During breeding season feeds along edges of rocky, gravelly mountain streams; apparently specializes in capturing larvae of caddisflies and aquatic dipterans (Bent 1929 and Stout 1967 in Johnsgard 1981). May wade into belly-deep water and completely submerge head while foraging. Probes in sand, mud, silt, rocky and arboreal crevices, among detritus, between and beneath submerged rocks, and among sessile invertebrates (Gill et al. 2002). During migration and non-breeding season, follows receding waves in rocky and sandy intertidal habitats. Observed catching and swallowing a 65- to 80-mm-long sculpin (Cottidae) (Gill et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 - 100,000 individuals

Comments: Global population has been estimated at 10,000-25,000, with 90 percent breeding in North America (Morrison et al. 2000, Gill et al. 2002). Morrison (1993/1994) estimated the population in Canada at about 5,000 individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

This tame shorebird breeds above timberline in Alaska, and much is still unknown about its breeding behavior (first nest was discovered in 1922). This species is better known on its coastal wintering grounds, where it was discovered more than two centuries ago.

Wandering Tattlers are basically solitary throughout their annual cycle. Associated with mountain streams and gravel bars within their breeding range, they bob and teeter while feeding and probe the water surface for insect prey, especially aquatic invertebrates (Johnsgard 1981). The Wandering Tattler's primary call is a series of clear, rippling whistles, all on one pitch (Gill et al. 2002).

In Alaska, possible predators to adult birds include Rough-legged Hawks (Buteo lagopus) and Peregrine Falcons (Falco peregrinus), and arctic ground squirrels (Spermophilus parryii) are known egg/nestling predators to co-occurring Surfbirds (Aphorize vibrate) (Gill et al. 2002). Observed responses to predators include alarm calls and freezing in one place where coloration makes birds difficult to distinguish from background; young chicks may crouch motionless or flee intruders to the brood vicinity (Gill et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Arrival and pairing on northern breeding grounds occurs from mid-May to early June, with males generally preceding females in arrival (Gill et al. 2002). Single clutch laid per season (no evidence of second broods although replacement clutch likely if initial clutch is lost early in incubation), usually 4 eggs laid in late May-early June; incubated by both sexes for 23-25 days (Weeden 1965). Hatching recorded in Alaska from June 24-July 11 (1999); precocial nestlings are tended by both parents (Gill et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tringa incana

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
BROM070-06|JGS 2201|Tringa incana| AATCGATGACTATTCTCAACCAACCACAAAGATATCGGTACCCTATACCTAATCTTCGGCGCATGAGCTGGTATAATTGGAACTGCCCTC---AGCCTCCTCATTCGCGCAGAATTAGGTCAACCGGGAACCCTACTGGGAGAC---GATCAAATTTATAATGTAATCGTTACTGCCCATGCTTTCGTAATAATTTTCTTTATGGTAATACCGATTATAATTGGCGGCTTCGGAAATTGACTAGTCCCACTCATA---ATCGGCGCGCCCGATATAGCATTTCCCCGTATAAATAACATAAGCTTTTGACTACTTCCCCCATCATTCCTTCTACTACTAGCATCCTCTACAGTAGAAGCTGGAGCCGGTACAGGATGAACAGTATATCCCCCTCTTGCCGGCAACCTAGCCCATGCCGGTGCCTCAGTAGACCTG---GCCATCTTCTCTCTCCACCTAGCAGGTGTCTCCTCCATCCTCGGTGCTATCAACTTCATCACAACCGCTATCAACATAAAACCCCCAGCCCTCTCCCAATACCAAACCCCTCTATTCGTATGATCTGTACTTATCACCGCTGTCCTTCTCTTACTCTCTCTTCCAGTTCTCGCTGCC---GGTATCACTATGTTACTAACAGACCGAAACCTAAACACCACATTCTTTGACCCAGCTGGAGGAGGAGACCCGGTTCTATACCAACATCTTTTCTGATTCTTCGGCCACCCAGAAGTTTACATTCTCATTCTACCGGGTTTCGGAATTATCTCTCACGTCGTAGCCTACTACGCAGGTAAAAAA---GAACCATTTGGATACATGGGAATAGTATGAGCTATACTATCCATTGGATTCTTAGGTTTTATCGTATGAGCCCACCACATATTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tringa incana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N4B,N4N : N4B: Apparently Secure - Breeding, N4N: Apparently Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: World population may be as small as 10,000, making this one of North America's least numerous shorebird species. Listed by the U. S. Shorebird Conservation Plan as highly imperiled with regard to its relative abundance; population trends and breeding distribution are of moderate concern (Brown et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Research Needs: Evaluate the suitability of islands and atolls in the South Pacific for restoration to Tattler non-breeding protected areas; assessment should include research on bird abundance, distribution, and habitat use, and on the effects of introduced mammals on birds and their habitats. Such research is particularly important for islands and atolls with high conservation potential, including U.S protected areas (Tibbitts et al. 2003).

Biological Research Needs: Most aspects of breeding ecology need study including annual or lifetime breeding success, age of first breeding, annual survival from fledgling to maturity, adult survival, recruitment, and longevity (Gill et al. 2002). Breeding and non-breeding habitat requirements should be explored, and the effects of placer mining on habitat availability and quality studied.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Wandering Tattler

The Wandering Tattler, Tringa incana (formerly Heteroscelus incanus: Pereira & Baker, 2005; Banks et al., 2006), is a medium-sized wading bird. It is similar in appearance to the closely related Gray-tailed Tattler, T. brevipes. The tattlers are unique among the species of Tringa for having unpatterned, greyish wings and backs, and a scaly breast pattern extending more or less onto the belly in breeding plumage, in which both also have a rather prominent supercilium.

Wandering Tattler on Great Barrier Reef in Queensland, Australia

These birds have stocky bodies with gray upperparts, underwings, face and neck and a white belly. They have short dark yellow legs and a dark gray bill. Adults in breeding plumage are heavily barred underneath.

In summer, they are found in Alaska and northwestern Canada. They nest in rocky areas along mountain streams. At other times, they are found on rocky islands in the southwest Pacific and on rocky Pacific coasts from California to South America and as far as Australia.


They feed on aquatic invertebrates such as crustaceans and marine worms. During breeding season, they also eat insects. While wading, they forage actively, making jerky bobbing movements.

The female lays 4 olive-colored eggs in a shallow depression. Both parents incubate and help feed the young, who are soon able to forage for themselves.

The call is a rapid trill of accelerating, descending notes of decreasing volume.

Wandering Tattler Pt Cartwright.ogg
Point Cartwright, SE Queensland, Australia


References

  • Banks, Richard C.; Cicero, Carla; Dunn, Jon L.; Kratter, Andrew W.; Rasmussen, Pamela C.; Remsen, J. V. Jr.; Rising, James D. & Stotz, Douglas F. (2006): Forty-seventh Supplement to the American Ornithologists' Union Check-list of North American Birds. Auk 123(3): 926–936. DOI: 10.1642/0004-8038(2006)123[926:FSTTAO]2.0.CO;2 PDF fulltext
  • Pereira, Sérgio Luiz & Baker, Alan J. (2005): Multiple Gene Evidence for Parallel Evolution and Retention of Ancestral Morphological States in the Shanks (Charadriiformes: Scolopacidae). Condor 107(3): 514–526. DOI: 10.1650/0010-5422(2005)107[0514:MGEFPE]2.0.CO;2 HTML abstract
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Tringa incana and T. brevipes were formerly placed in the genus Heteroscelus (AOU 1998).

Originally described as Scolopax incana (Gmelin, 1789). Previously placed in genera Totanus, Heteractitis, and Actitis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!