Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Actitis macularius

Named for the dark-spotted breast of breeding individuals, the Spotted Sandpiper in summer is also characterized by its medium-length yellow bill, olive back, and black eye-stripes. In winter, the Spotted Sandpiper loses its spots, leaving behind a plain white breast. This is a medium-sized (7 ½ inches) sandpiper with the plump body and small head characteristic of shorebirds. Males and females are similar to one another in all seasons. One of the most widely-distributed sandpiper species in North America, Spotted Sandpipers breed from northern Canada and Alaska down to northern California, New Mexico, Missouri, and Virginia. In winter, this species migrates south to southern California, the desert southwest, and coastal regions of the southeast. Some populations winter as far south as Central America and the Caribbean. The Spotted Sandpiper’s wide distribution is influenced by its ability to inhabit a variety of shoreline habitats, including streams, ponds, and waterlogged grasslands. By contrast, Spotted Sandpipers prefer freshwater habitats during the summer breeding season. In winter, they may also be found near saltwater, particularly on mudflats and lagoons. Spotted Sandpipers are most easily observed foraging along the water’s edge. There, they may be seen bobbing up and down as they probe the mud for small insect larvae and crustaceans, which make up the majority of their diet. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Spotted sandpipers (Actitis macularius) are found throughout North and Central America, including the western Caribbean islands. Their breeding range extends from the northern Arctic to the southern United States. Their wintering grounds range from the extreme southern United States to southern South America, along with all the Caribbean islands. Spotted sandpipers live year-round along the western coast of the United States and in parts of California. They are found in very small numbers across parts of Europe, Russia, Siberia and on Canton and Marshall Islands in the Pacific Ocean.

Biogeographic Regions: nearctic (Native ); palearctic ; neotropical (Native ); oceanic islands

  • Oring, L., E. Gray, J. Reed. 1997. Spotted Sandpiper (Actitis macularia). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 289. Philadelphia, PA: The Academy of Natural Sciences, and Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: northern and western Alaska eastward through northeastern Manitoba to Newfoundland, south to southern Alaska, Oregon, southern California, central Arizona, southern New Mexico, Texas, northern portions of Gulf states, Virginia, eastern Maryland, and North Carolina. NON-BREEDING: southwestern British Columbia, western Washington, southern Arizona, southern New Mexico, southern Texas, Gulf coast, and coastal South Carolina south to West Indies and South America (to northern Chile, northern Argentina, and Uruguay). A few nonbreeders may summer in winter range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; from northern Labrador to the Gulf States
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Spotted sandpipers (Actitis_macularius) are found throughout North and Central America, including the western Caribbean islands. Their breeding range extends from the northern Arctic to the southern United States. Their wintering grounds range from the extreme southern United States to southern South America, along with all the Caribbean islands. Spotted sandpipers live year-round along the western coast of the United States and in parts of California. They are found in very small numbers across parts of Europe, Russia, Siberia and on Canton and Marshall Islands in the Pacific Ocean.

Biogeographic Regions: nearctic (Native ); palearctic ; neotropical (Native ); oceanic islands

  • Oring, L., E. Gray, J. Reed. 1997. Spotted Sandpiper (Actitis macularia). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 289. Philadelphia, PA: The Academy of Natural Sciences, and Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds North America; winters to s South America.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Spotted sandpipers are medium-sized sandpipers, 10 to 18 cm long with wingspans of 37 to 40 cm. Females are 20 to 25% larger than males, weighing 43 to 50 g compared to 34 to 41 g for males. Spotted sandpipers are brown to olive gray on their crown, nape, back and wings, and bright white on their face, throat, chest and belly. Their common name derives from the bold black spots on their white undersides. Females tend to have larger spots that extend lower on the belly compared to males. While in flight, spotted sandpipers display a white wing-stripe and a plain rump and tail.

Range mass: 34 to 50 g.

Range length: 10 to 18 cm.

Range wingspan: 37 to 40 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Spotted sandpipers are medium-sized sandpipers. They are 10 to 18 cm long and have wingspans of 37 to 40 cm. Females are larger than males; they weigh 43 to 50 g compared to 34 to 41 g for males. Spotted sandpipers are brown on their crown, neck, back and wings, and bright white on their face, throat, chest and belly. They are called spotted sandpipers because they have black spots on their white undersides. Females usually have larger spots than males. In flight, spotted sandpipers have a white stripe on their wings.

Range mass: 34 to 50 g.

Range length: 10 to 18 cm.

Range wingspan: 37 to 40 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 19 cm

Weight: 40 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Spotted sandpipers breed in a variety of habitats ranging in elevation from sea level to 4,700 m. Females typically defend a breeding territory that includes a shoreline (of a stream or lake, for example), a semi-open area for nesting and patches of dense vegetation. These territories may be found in sage-brush, grasslands, forests, fields, lawns and parks among other habitats.

During spring and fall migrations, spotted sandpipers prefer freshwater habitats, such as lakes, rivers and marshes, though they can also be found along the coasts and in estuaries. In winter, spotted sandpipers can be found in coastal and interior areas, nearly anywhere where water is present.

Range elevation: 0 to 4,700 m.

Habitat Regions: temperate ; tropical ; polar ; terrestrial ; saltwater or marine ; freshwater

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Wetlands: marsh

Other Habitat Features: suburban ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Seacoasts and shores of lakes, ponds, and streams, sometimes in marshes; prefers shores with rocks, wood, or debris; also mangrove edges in Caribbean. Nests near freshwater in both open and wooded areas, less frequently in open grassy areas away from water; on ground in growing herbage or low shrubby growth, or against log or plant tuft (Harrison 1978). In Minnesota, successful breeders usually returned to same area to breed the next year (Reed and Oring 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spotted sandpipers breed in a variety of habitats from sea level to 4,700 m elevation. Females usually defend a breeding territory that includes a shoreline, a partly open area for nesting and patches of dense vegetation. These territories may be found in grasslands, forests, fields, lawns and parks and other habitats.

During spring and fall migrations, spotted sandpipers prefer freshwater habitats, such as lakes, rivers and marshes. However, they also use coasts and estuaries. In winter, spotted sandpipers can be found nearly anywhere that there is water.

Range elevation: 0 to 4,700 m.

Habitat Regions: temperate ; tropical ; polar ; terrestrial ; saltwater or marine ; freshwater

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Wetlands: marsh

Other Habitat Features: suburban ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 5.940 - 20.734
  Nitrate (umol/L): 1.082 - 2.446
  Salinity (PPS): 30.572 - 35.681
  Oxygen (ml/l): 5.204 - 7.377
  Phosphate (umol/l): 0.165 - 0.377
  Silicate (umol/l): 1.546 - 1.811

Graphical representation

Temperature range (°C): 5.940 - 20.734

Nitrate (umol/L): 1.082 - 2.446

Salinity (PPS): 30.572 - 35.681

Oxygen (ml/l): 5.204 - 7.377

Phosphate (umol/l): 0.165 - 0.377

Silicate (umol/l): 1.546 - 1.811
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in northern breeding areas in April-May, departs by September-October (Bent 1929); southward migration from breeding areas begins in June (Hayman et al. 1986). Migratory status of breeding populations where present all year in Pacific states? Migrates through Costa Rica early August-October and April-late May (Stiles and Skutch 1989). Arrives in northern South America by early August, most depart by early May (Hilty and Brown 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Spotted sandpipers are opportunistic carnivores. They eat nearly all animals that are small enough for them to eat, with the exception of toad tadpoles. Examples of commonly eaten foods include midges, fish, mayflies, flies, grasshoppers, crickets, beetles, worms, caterpillars, mollusks, crustaceans, spiders, and carrion.

Spotted sandpipers forage on the ground. They capture most prey by thrusting their head forward and catching the prey in their bill. They also catch prey by pecking the ground, hopping to catch flying insects, and picking insects off of vegetation. Often, spotted sandpipers will dip insects in water before eating them, although the reason for this is unclear. Spotted sandpipers are visual hunters, mainly using sight to catch prey. When breeding, females increase their food intake to offset the energy spent producing eggs. While incubating, males increase their time dedicated to finding and catching prey by 44.9%.

Animal Foods: amphibians; fish; carrion ; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly small invertebrates obtained from surface or by probing along shores or some distance inland if insects are abundant there (Cogswell 1977).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Spotted sandpipers are carnivores. They eat nearly all animals that they find that are small enough for them to eat. Some of the foods they eat are midges, fish, mayflies, Diptera, Orthoptera, Coleoptera, worms, caterpillars, Molusca, Crustacea, Araneae, and dead fish.

Spotted sandpipers search for food on the ground. They capture most prey by catching it in their bill. They also catch food by pecking the ground, hopping to catch flying insects, and picking insects off of vegetation. Spotted sandpipers eat more during the breeding season so that they have enough energy for breeding activities.

Animal Foods: amphibians; fish; carrion ; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Spotted sandpipers affect the populations of the species they eat. They also provide food for their predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spotted sandpiper eggs are vulnerable to predation by predators such as deer mice, mink, weasels, river otters, yellow-headed blackbirds, red-winged blackbirds, song sparrows and ruddy turnstones. Chicks are predated by common grackles, American crows, gulls and mink. Adult spotted sandpipers are taken by least weasels, short-tailed weasels and a variety of raptors.

When threatened, spotted sandpipers perform a display by positioning their body upright and their bill forward. They extend their wings outward and upward, raise their breast feathers, open their bill and fan their tail. Nesting spotted sandpipers may also fake an injury, known as the Broken Wing Display in order to draw predators away from their nest. The Broken Wing Display is performed by crawling low to the ground with the wings flapping on the ground and the tail spread and lowered while squealing.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Spotted sandpipers affect the populations of the species they eat. They also provide food for their predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Spotted sandpiper eggs are eaten by Peromyscus maniculatus, mustela vison, Mustela nivalis, Lutra canadensis, Xanthocephalus xanthocephalus, Agelaius phoeniceus, song sparrows and Arenaria interpres. Spotted sandpiper chicks are hunted by Quiscalus quiscula, Corvus brachyrhynchos, Larus and mustela vison. Adult spotted sandpipers are hunted by Mustela nivalis, Mustela erminea and Falconiformes.

When predators approach spotted sandpipers, the sandpipers perform a display to threaten the predator. They hold their body upright and their bill forward. Then they hold their wings out and up, puff out their breast feathers, open their bill and fan their tail. Nesting spotted sandpipers may also pretend to be injured when predators come near their nest. They act like their wing is broken and move away from their nest in order to distract the predator from the nest. This is called the Broken Wing Display.

Known Predators:

  • deer mice (Peromscus)
  • American mink (Mustela_vison)
  • American river otters (Lontra_canadensis)
  • weasels (Mustelinae)
  • diurnal raptors (Falconiformes)
  • yellow-headed blackbirds (Xanthocepahlus_xanthocephalus)
  • red-winged blackbirds (Agelaius_phoeniceus)
  • song sparrows (Melospiza_melodia)
  • common grackle (Quiscalus_quiscula)
  • American crows (Corvus_brachyrhynchos)
  • gulls (Laridae)
  • peregrine falcons (Falco_peregrinus)
  • Mustela erminea
  • Falconiformes
  • American river otter (Lontra_canadensis)
  • deer mice (Peromyscus)
  • gulls (family Laridae)
  • owls (Strigiformes)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Actitis macularia preys on:
non-insect arthropods
Actinopterygii
Mollusca
Arthropoda
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 - 1,000,000 individuals

Comments: Morrison et al. (2001) point out that, owing to its dispersed distribution, "the Spotted Sandpiper provides another good example of a species for which it is difficult to make an estimate of the population from count data alone." L. Oring (pers. comm. in Morrison et al. 2001) recommends adopting an estimate of 150,000, with a range of 50,000-250,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

NON-BREEDING: defends individual territory; in small flocks to sleep (Stiles and Skutch 1989). Predation by single mink reduced local annual reproductive success from 30-50 chicks fledged to zero (Oring et al. 1983); mink predation was reduced significantly when a tern colony was present (Alberico et al. 1991). Normally does not flock.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Spotted sandpipers use vocalizations and physical displays to communicate. The calls of spotted sandpipers are largely variations on a weet note, that is repeated at different pitches, intensities and rates to communicate different messages. Vocalizations can be used to communicate alarm, to maintain contact with chicks, in courtship, and to distract predators from one's nest. Physical displays are used to threaten others, to solicit a mate and to show submission, among other purposes.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Spotted sandpipers use calls and body signals communicate. The calls of spotted sandpipers are all made up of a note that sounds like weet. This note can be repeated at different volumes and speeds to communicate different messages. For example, it can be used to show alarm, to attract a mate or to try to distract predators that come near the nest.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The eggs of this species weigh about 9.6 g and take about 21 days for incubation, with the time decreasing as the season progresses. When they hatch, A. macularius are covered with down and weigh about 6.0 g. Within the first day, they are walking, eating and stretching their wings. Hunting for immobile food starts at 1-2 days, and stalking moving prey begins at 3-5 days. Actitis macularius chicks are brought up mostly by the male, and feed themselves. At about 11 days, chicks start to lift off the ground. At about 15 days, chicks show weak flight, and at about 18 days, chicks can completely lift themselves off the ground and fly a significant distance. Actitis macularius begin breeding at 1 year. (Maxson and Oring, 1980; Oring, et al., 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

The eggs of this species weigh about 9.6 g and take about 21 days for incubation, with the time decreasing as the season progresses. When they hatch, Actitis macularia are covered with down and weigh about 6.0 g. Within the first day, they are walking, eating and stretching their wings. Hunting for immobile food starts at 1-2 days, and stalking moving prey begins at 3-5 days. Actitis macularia chicks are brought up mostly by the male, and feed themselves. At about 11 days, chicks start to lift off the ground. At about 15 days, chicks show weak flight, and at about 18 days, chicks can completely lift themselves off the ground and fly a significant distance. Actitis macularia begin breeding at 1 year. (Maxson and Oring, 1980; Oring, et al., 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The oldest known spotted sandpiper lived at least 12 years. Most do not live nearly that long.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
109 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest known spotted sandpiper lived at least 12 years. Most do not live nearly that long.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
109 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spotted sandpipers are polyandrous. Females of this species may mate with upwards of 4 mates each year. Females may begin with one mate with whom they share parental responsibilities. As additional males arrive, females compete for additional mates, leaving the males to perform the majority of parental care.

Mating System: polyandrous

Spotted sandpipers breed between May and August. Females establish a breeding territory about 4 days before males begin arriving. They then court a mate, and the pair builds a nest together. The nests are built in the ground and consist of weeds or stems padding a shallow depression in the dirt. They are typically located in marshes, on coastlines, and near other water sources. The female then lays a clutch of 4 eggs (occasionally 3). Each female may lay up to 5 clutches per year. The eggs are incubated for 19 to 22 days (average 21 days) by the male and by the female to a lesser extent. The chicks are precocial; they are able to walk within four hours of hatching and are able to feed themselves soon thereafter. They are brooded primarily by the male for the first several days after hatching. The young sandpipers remain with their parent(s) for at least 4 weeks after hatching. After becoming independent, the young sandpipers join post-breeding flocks. These sandpipers will be able to breed the next summer when they are about 1 year old.

Breeding interval: Female spotted sandpipers can lay up to 5 clutches per breeding season.

Breeding season: Spotted sandpipers breed between May and August.

Range eggs per season: 20 (high) .

Average eggs per season: 20.

Range time to hatching: 19 to 22 days.

Average time to hatching: 21 days.

Range fledging age: 1 to 24 hours.

Range time to independence: 4 (low) weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous ; sperm-storing

Male spotted sandpipers provide the majority of parental care. Females contribute in varying amounts to nest building, incubation and raising the chicks during the fledgling stage.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Protecting: Male, Female); pre-independence (Protecting: Male, Female)

  • Cialdini, R., G. Orians. 1944. Nesting studies of the Spotted Sandpiper. Passenger Pigeon, 6: 79-81.
  • Hays, H. 1972. Polyandry in the Spotted Sandpiper. Living Bird, 11: 43-57.
  • Klekowski, E., L. Klekowski. 1997. "Spotted Sandpiper, *Actitis macularia*" (On-line). Accessed April 7, 2002 at http://www.bio.umass.edu/biology/conn.river/spotted.html.
  • Oring, L., E. Gray, J. Reed. 1997. Spotted Sandpiper (Actitis macularia). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 289. Philadelphia, PA: The Academy of Natural Sciences, and Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size commonly 4. Incubation 20-21 days, mainly by male; female may lay clutch for more than 1 male. Male may change mate if nest fails (Oring et al. 1983). Young attended by male, leave nest soon after hatching, fly at 13-16 days (Terres 1980). Sexually mature in one year, may live up to 12 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spotted sandpipers are polyandrous (one female mates with several males). Females spotted sandpipers may have 1 to 4 or more mates each season. Females begin each season with one mate. However, as more males arrive, the females compete to attract additional mates. When females have several mates, they do not do much parental care. Instead, the males do most of the work of incubating the eggs and raising the chicks.

Mating System: polyandrous

Spotted sandpipers breed between May and August. Females arrive first in the spring, and establish a breeding territory. The males arrive about 4 days later. The females try to attract a male mate. Once a male and female have formed a breeding pair, they build a nest together in the female's territory. The nests are just a shallow bowl-shape scraped out of the ground and padded with weeds and stems. They are usually built near water.

The female lays a clutch of 4 eggs (sometimes 3). Each female may lay up to 5 clutches per year. The eggs are incubated for 19 to 22 days (average 21 days). The male does most of the incubating, but the female may help. The chicks are well-developed when they hatch. They are able to walk just four hours after hatching, and are able to feed themselves soon after that. The male broods the chicks for a few days after hatching to protect them and keep them warm. The young sandpipers stay with their parents for at least 4 weeks. After they become independent, the young sandpipers join flocks with other spotted sandpipers. Spotted sandpipers usually begin breeding when they are about 1 year old.

Breeding interval: Female spotted sandpipers can lay up to 5 clutches per breeding season.

Breeding season: Spotted sandpipers breed between May and August.

Range eggs per season: 20 (high) .

Average eggs per season: 20.

Range time to hatching: 19 to 22 days.

Average time to hatching: 21 days.

Range fledging age: 1 to 24 hours.

Range time to independence: 4 (low) weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sperm-storing

Male spotted sandpipers do most of the work to incubate the eggs and raise the chicks.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Protecting: Male, Female); pre-independence (Protecting: Male, Female)

  • Cialdini, R., G. Orians. 1944. Nesting studies of the Spotted Sandpiper. Passenger Pigeon, 6: 79-81.
  • Hays, H. 1972. Polyandry in the Spotted Sandpiper. Living Bird, 11: 43-57.
  • Klekowski, E., L. Klekowski. 1997. "Spotted Sandpiper, *Actitis macularia*" (On-line). Accessed April 7, 2002 at http://www.bio.umass.edu/biology/conn.river/spotted.html.
  • Oring, L., E. Gray, J. Reed. 1997. Spotted Sandpiper (Actitis macularia). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 289. Philadelphia, PA: The Academy of Natural Sciences, and Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Actitis macularius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNTGTACCTAATTTTTGGCGCATGAGCTGGCATAGTCGGAACCGCTCTCAGCCTACTCATTCGTGCAGAACTAGGCCAACCAGGGACCCTACTAGGAGATGACCAAATCTACAACGTAATCGTCACCGCCCATGCTTTCGTTATAATCTTTTTCATAGTAATACCAATTATGATCGGCGGCTTTGGAAACTGACTAGTCCCACTCATAATTGGTGCACCCGACATAGCATTTCCCCGCATAAACAACATAAGCTTCTGACTTCTTCCTCCATCGTTCCTATTACTTCTTGCATCATCCACAGTAGAAGCTGGAGCTGGCACAGGATGAACGGTATATCCACCCCTCGCTGGCAACCTAGCCCATGCTGGAGCTTCAGTAGATCTAGCCATTTTTTCTCTTCACCTAGCAGGTGTCTCCTCCATCCTCGGTGCCATCAATTTCATCACAACTGCTATTAACATAAAACCCCCAGCCCTTTCTCAATACCAAACCCCATTATTCGTATGATCAGTACTCATCACCGCCGTTCTACTCCTACTTTCCCTCCCAGTCCTCGCTGCCGGCATTACTATACTATTAACAGATCGAAACCTAAACACAACATTTTTTGATCCTGCCGGAGGAGGAGACCCAGTTTTATATCAACATCTTTTCTGATTCTTCGGCCACCCAGAAGTTTACATCTTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Actitis macularius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Spotted sandpipers are common and widespread. Global population estimates appear to be stable at about 250,000 individuals. Threats to spotted sandpipers include pesticide poisoning, hunting and injury and foot loss due to leg-banding.

Spotted sandpipers are not threatened or endangered. They are listed as a species of "least concern" by the IUCN, and are not listed under any of the CITES appendices. They are, however, protected under the U.S. Migratory Bird Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spotted sandpipers are pretty common and have a large range. There are about 250,000 spotted sandpipers in the world. Spotted sandpipers are not threatened or endangered. They are, however, protected under the U.S. Migratory Bird Act.

IUCN Red List of Threatened Species: no special status

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of spotted sandpipers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spotted sandpipers eat a wide variety of insects. It is possible that they help control insects that humans view as pests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

We do not know of any way that spotted sandpipers harm people.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Spotted sandpipers eat a wide variety of insects. It is possible that they help control insects that humans view as pests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spotted sandpiper

The spotted sandpiper (Actitis macularius syn. Actitis macularia) is a small shorebird, 18–20 cm (7.1–7.9 in) long. Together with its sister species, the Common Sandpiper (A. hypoleucos) they make up the genus Actitis. They replace each other geographically; stray birds may settle down with breeders of the other species and hybridize.

Their breeding habitat is near fresh water across most of Canada and the United States. They migrate to the southern United States and South America, and are very rare vagrants to western Europe. These are not gregarious birds and are seldom seen in flocks.

The call of the Spotted Sandpiper

Problems playing this file? See media help.

Adults have short yellowish legs and an orange bill with a dark tip. The body is brown on top and white underneath with black spots. Non-breeding birds, depicted below, do not have the spotted underparts, and are very similar to the Common Sandpiper of Eurasia; the main difference is the more washed-out wing pattern visible in flight and the normally light yellow legs and feet of the Spotted Sandpiper. The Actitis species have a distinctive stiff-winged flight low over the water.

Spotted Sandpipers nest on the ground. During each summer breeding season, females may mate with and lay clutches for more than one male, leaving incubation to them. This is called polyandry. Male parents of first clutches may father chicks in later male's clutchs, probably due to sperm storage within female reproductive tracts, which is common in birds. Females that fail to find additional mates usually help incubate and rear chicks. "Prior to incubation, blood plasma concentrations of testosterone and dihydrotestosterone are substantially higher in males than in females" and these levels plummet 25-fold in males as incubation proceeds.[2] Additionally, mated females have testosterone concentrations that are 7 times higher than those of unmated females.[3]

These birds forage on ground or water, picking up food by sight. They may also catch insects in flight. They eat insects, crustaceans and other invertebrates. As they forage, they can be recognized by their constant nodding and teetering.

Gallery[edit]

References[edit]

  1. ^ BirdLife International (2012). "Actitis macularius". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Nelson RJ. 2005. Introduction to Behavioral Endocrinology. Sinauer Associates: Massachusetts. p 115.
  3. ^ Nelson RJ. 2005. Introduction to Behavioral Endocrinology. Sinauer Associates: Massachusetts. p 115.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Considered conspecific with Old World A. HYPOLEUCOS by some authors (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!