Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Spanish (7) (learn more)

Overview

Brief Summary

Phalaropus fulicarius

A medium-sized (8-9 inches) wader, the female Red Phalarope in summer is most easily identified by its reddish-brown breast, mottled black-and-white upperparts, yellow bill and legs, and black head with white cheek patches. Summer males are similar but paler, especially on the breast and face. This plumage pattern, in which the female is brighter than the male, is unusual in birds. Winter birds of both sexes are light gray above and white below with conspicuous dark gray eye-stripes. This species is unmistakable in summer; in winter, it may be separated from the related Red-necked Phalarope (Phalaropus lobatus) and Wilson’s Phalarope (Phalaropus tricolor) by its lighter body as well as its shorter bill and legs. The Red Phalarope breeds along all coasts of the Arctic Ocean in North America and Eurasia. In winter, this species is found far offshore, mostly in tropical waters in the Atlantic and Pacific oceans. This species migrates over water, but a few birds winter in waters near the United States, mostly off the coast of Florida, California, and Louisiana. Red Phalaropes breed in marshy portions of coastal tundra. In winter, this species is exclusively marine, being found in deep water far from shore. This species primarily eats insects during the breeding season, switching to an entirely plankton-based diet during the winter. Due to this species’ remote breeding and wintering grounds, Red Phalaropes are seen by relatively few birdwatchers. In summer, this species may be seen walking in shallow water while picking food off of vegetation or the surface of the water. In winter, Red Phalaropes may be seen in large flocks, swimming gull-like while picking plankton off the water’s surface. This species has been known to wait for large baleen whales to locate plankton before helping themselves to leftovers. Red Phalaropes are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: western and northern Alaska, northern Yukon, northern Mackenzie, and Banks, Melville, Ellesmere, Bylot, Dundas, and northern Baffin islands, and south to eastern Keewatin, Southhampton and Mansel islands, northern Quebec, and probably northern Labrador; in Palearctic from Greenland and Iceland through arctic islands to northern Siberia. Nonbreeders summer off coasts of California and Newfoundland. NORTHERN WINTER: primarily pelagic, ranges widely, mainly in Southern Hemisphere off both coasts of South America and western Africa, also western Pacific from Japan south; primarily in productive waters of Humboldt Current off Peru and Chile, and Benguela Current off West Africa south to the Cape of Good Hope.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Red Phalarope breeds in the Arctic regions of North America and Eurasia, generally wintering pelagically off western South America and western and south-western Africa (Snow and Perrins 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Holarctic circumpolar; winters at sea in southern hemisphere.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 22 cm

Weight: 61 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Nonbreeding: primarily pelagic, occurring in migration on bays and estuaries, rarely on ponds, lakes and marshes; mainly in plankton-rich upwelling zones. May be driven to coast or inland by strong winds. In northern Alaska, postbreeding habitat was mainly gravel coastal beaches (Smith and Connors 1993). Nests on coastal tundra; hummocky moss-sedge tundra interspersed with numerous ponds; wet unpatterned tundra with strangmoor ridges for nesting. Nests on the ground in a depression that is sometimes lined with grasses or other plants. Nest may be hidden by grass that is pulled over the depression.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is a full migrant that travels via marine routes and has been observed migrating 80-160 km offshore. Adult females depart from the breeding grounds in early-June, followed by the adult males and juveniles in late-July and August, most arriving in the non-breeding quarters by the end of November. The species departs Chilean and South African seas in March, and West African and south-west African seas in April, migrating along the Arctic coasts and reoccupying breeding grounds from late-May to early-June. It may also wait 2-3 weeks at the edge of sea ice in the High Arctic waiting for the land to thaw before nesting (Snow and Perrins 1998). Once in the breeding grounds the species breeds between June and July (from mid-June to mid-July in Iceland, and from early-June to early-July in Russia). The species is gregarious at all times of the year (Snow and Perrins 1998), and will even breed in loose groups where the habitat is favourable. Habitat Breeding This species breeds close to the coast on marshy tundra with small pools, on boggy meadows with moss and grass, in marshy river valleys, or on islets in fjords. Non-breeding Outside of the breeding season this species is pelagic and frequents upwelling zones in the tropics and subtropics where plankton occurs in high concentrations (e.g. over 50,000 organisms/litre). Diet Breeding During the breeding season the diet of this species consists chiefly of invertebrates, such as adult and larval insects (e.g. beetles, caddisflies, dipteran flies, bugs), molluscs, crustaceans, annelid worms, spiders, mites, jellyfish (Johnsgard 1981) and occasionally plant material (seeds) when animal matter is scarce. Non-breeding During this season the species feeds at sea on plankton, including amphipods less than 2 mm long, Hydrozoa and small fish from the water surface or just below. Breeding site The nest is a shallow cup or scrape on the ground in short vegetation (e.g. sedges or grasses) and is usually close to or surrounded by water (Johnsgard 1981, Snow and Perrins 1998).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4142 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3283 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.830 - 24.813
  Nitrate (umol/L): 0.065 - 10.218
  Salinity (PPS): 30.381 - 36.491
  Oxygen (ml/l): 4.729 - 9.061
  Phosphate (umol/l): 0.037 - 1.079
  Silicate (umol/l): 0.565 - 16.169

Graphical representation

Temperature range (°C): -0.830 - 24.813

Nitrate (umol/L): 0.065 - 10.218

Salinity (PPS): 30.381 - 36.491

Oxygen (ml/l): 4.729 - 9.061

Phosphate (umol/l): 0.037 - 1.079

Silicate (umol/l): 0.565 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northward migration usually well offshore along both coasts of North America; arrives on nesting ground in late May or early June (mostly June in Arctic Canada) (Terres 1980), females arriving before males. Passes through east-central Pacific February-April in large numbers (Pratt et al. 1987). Females leave breeding areas in late June and July; males depart usually early July to mid-August; juveniles depart nesting areas mid-August to early September (Johnson and Herter 1989). In North America, much more numerous along Pacific coast than along Atlantic coast, especially September-December and in some years in spring (Hayman et al. 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on insects and crustaceans; also eats larval fishes and small jellyfishes. Obtains food from ocean surface, wet tundra, and marine littoral zone. In northern Bering Sea in spring, forages opportunistically in littoral zone (Haney and Stone 1988); littoral foraging also by juveniles in fall in Beaufort and Chukchi seas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Morrison et al. (2001) estimated the total population to be about 1 million, but this species is poorly surveyed in migration, and the population may actually be considerably more than this.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Nonbreeding: occurs singly, in small scattered flocks, or sometimes in flocks of >1000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Four eggs are laid June-July. The male incubates the eggs for 18-20 days (Terres 1980). Female usually deserts male as soon as clutch complete, may attempt to mate again. Nestlings are precocial and downy. Young are capable of first flight about 16-18 days after hatching. Usually nests in small colonies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Phalaropus fulicarius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Phalaropus fulicarius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTTATCAACCGATGACTATTCTCAACCAACCACAAAGACATTGGTACCCTATACCTAATCTTCGGTGCATGAGCCGGCATAGTTGGAACCGCCCTTAGCCTGCTTATCCGCGCAGAACTAGGTCAACCAGGGACCCTTTTAGGAGACGACCAGATCTACAATGTAATCGTTACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCGATCATGATTGGTGGCTTCGGAAACTGATTAGTACCCCTCATAATCGGCGCCCCCGATATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCCCCCTCATTCCTACTTCTACTAGCATCATCCACAGTAGAAGCTGGGGCCGGAACAGGGTGAACAGTATATCCCCCTCTTGCTGGCAACCTAGCTCATGCTGGTGCTTCAGTAGACTTAGCCATCTTCTCCCTTCACCTAGCAGGTGTCTCATCCATTCTTGGTGCCATTAATTTCATTACAACCGCCATCAACATAAAACCTCCAGCCCTCTCCCAATACCAAACCCCTCTATTCGTATGATCAGTGCTCATTACCGCTGTCCTACTTCTACTCTCCCTTCCCGTCCTCGCCGCCGGTATTACTATACTACTAACAGACCGAAACCTAAACACCACATTCTTCGACCCGGCCGGAGGCGGAGATCCAGTTCTATACCAGCATCTTTTCTGATTTTTCGGCCACCCCGAAGTTTATATTCTAATCTTACCAGGCTTTGGAATTATCTCCCACGTTGTAGCCTACTACGCAGGTAAAAAAGAACCATTTGGATATATAGGAATAGTATGAGCCATACTATCTATCGGATTCCTAGGCTTTATCGTCTGAGCTCATCACATATTCACAGTAGGAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3B - Vulnerable

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor? and winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number c.1,100,000-2,000,000 individuals (Wetlands International 2006), while the population in Russia has been estimated at c.10,000-1 million breeding pairs and > c.1,000 individuals on migration (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red Phalarope

The red phalarope (called grey phalarope in Europe), Phalaropus fulicarius, is a small wader. This phalarope breeds in the Arctic regions of North America and Eurasia. It is migratory, and, unusually for a wader, migrating mainly on oceanic routes and wintering at sea on tropical oceans.

Red phalarope is about 21 cm (8 inches) in length, with lobed toes and a straight bill, somewhat thicker than that of red-necked phalarope. The breeding female is predominantly dark brown and black above, with red underparts and white cheek patches. The bill is yellow, tipped black. The breeding male is a duller version of the female. Young birds are light grey and brown above, with buff underparts and a dark patch through the eye. In winter, the plumage is essentially grey above and white below, but the black eyepatch is always present. The bill is black in winter. Their call is a short beek.

The typical avian sex roles are reversed in the three phalarope species. Females are larger and more brightly coloured than males. The females pursue males, compete for nesting territory, and will aggressively defend their nests and chosen mates. Once the females lay their olive-brown eggs, they begin their southward migration, leaving the males to incubate the eggs and care for the young. Three to six eggs are laid in a ground nest near water. The young mainly feed themselves and are able to fly within 18 days of birth.

When feeding, a red phalarope will often swim in a small, rapid circle, forming a small whirlpool. This behaviour is thought to aid feeding by raising food from the bottom of shallow water. The bird will reach into the outskirts of the vortex with its bill, plucking small insects or crustaceans caught up therein. They sometimes fly up to catch insects in flight. On the open ocean, they are found in areas where converging ocean currents produce upwellings and are often found near groups of whales. Outside of the nesting season they often travel in flocks.

This species is often very tame and approachable.

The red phalarope is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

References[edit]

  • Shorebirds by Hayman, Marchant and Prater ISBN 0-395-60237-8
    • Bull, John; Farrand, Jr., John (April 1984). The Audubon Society Field Guide to North American Birds, Eastern Region. New York: Alfred A. Knopf. ISBN 0-394-41405-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: In Old World literature this species is known as gray phalarope (AOU 1983). Combined allozyme, morphologic, and mtDNA data suggest that Wilson's phalarope evolved shortly after the phalarope lineage itself arose and that the phalaropes are monophyletic, with the red and red-necked phalaropes being sister taxa (Dittman and Zink 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!