Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Chinstrap penguins make their home around the Antarctic Peninsula and the coastal islands of the continent. Mainly, you find them on the South Shetland Islands, South Orkney Island and South Sandwich (Welch 1997).

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species has a circumpolar distribution, being found in Antarctica, the South Sandwich Islands (Islas Sandwich del Sur), the South Orkneys, South Shetland and South Georgia (Georgia del Sur), Bouvet Island (to Norway) and the Balleny Islands (del Hoyo et al. 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Circumpolar Antarctic seas and adjacent islands.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Chinstrap penguins are white on the front and throat but have a black back. A thin band of black plumage runs from one side of the head to the other, right below each reddish eye and unites under the bill. Chicks have grey backs and white fronts. The male and female Chinstraps are monomorphic, as are all other penguins, thus make it hard to tell them apart without non-morphological cues. They stand about 72 cm tall and weigh about 3.5 to 5 kg. Adult weight varies during the year. When the penguin is in the molting season they gain the most weight and when they are in the brooding period they lose the most. Chinstrap penguins are able to withstand extreme cold due to the insulation provided by their short, densely packed feathers. This in turn forms a waterproof coat. Underneath these feathers, a thick layer of fat or blubber also serves as storage for energy. These adaptations help protect them against the extreme cold conditions of the Antarctic by minimizing heat loss in icy cold waters (Hale 1999, Muller-Schwarze 1984, Welch 1997).

Range mass: 3000 to 5000 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Chinstrap Penguins often live on large icebergs on the open ocean. One colony on the South Sandwich Islands is said to contain over 10 million birds. They are a stable population and were last estimated to include about 7.5 million breeding pairs. (Barham and Barham 1996, Welch 1997, Woehler and Chippingdale 2000).

Terrestrial Biomes: icecap

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is solely marine and is mostly found in zones with light ice pack. Its diet is comprised almost exclusively of Antarctic krill, but it will also take fish and other species of crustaceans when possible. Prey capture is apparently by pursuit-diving up to a depth of 70 m, but mostly less than 45 m. It breeds on irregular rocky coasts in ice free areas, forming large colonies of hundreds and thousands of birds and beginning laying in November at the earliest (del Hoyo et al. 1992).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 984 specimens in 1 taxon.
Water temperature and chemistry ranges based on 580 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.465 - 9.412
  Nitrate (umol/L): 10.652 - 30.562
  Salinity (PPS): 33.651 - 34.197
  Oxygen (ml/l): 6.657 - 8.188
  Phosphate (umol/l): 1.048 - 2.119
  Silicate (umol/l): 4.584 - 89.471

Graphical representation

Temperature range (°C): -1.465 - 9.412

Nitrate (umol/L): 10.652 - 30.562

Salinity (PPS): 33.651 - 34.197

Oxygen (ml/l): 6.657 - 8.188

Phosphate (umol/l): 1.048 - 2.119

Silicate (umol/l): 4.584 - 89.471
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The Chinstrap's diet is quite simple and consists of small shoaling animals: krill, small fish and other roaming marine crustacea. Chinstrap penguins' prey is 95% krill and about 5% of the other species mentioned (Barham and Barham 1996; Welch 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Category

Breeding
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The nests they build on icebergs are roughly circular consisting of stones and are typically 40 cm in diameter and up to 15 cm high. Chinstrap penguins usually lay two eggs, generally two to four weeks later than other pygoscelid species in the same area. The Chinstraps complete their breeding cycle by February or March and go back to the pack ice during winter. The eggs are hatched by both parents in shifts of 5 to 10 days. After 33 to 35 days the chicks hatch and they stay in the nests for 20 to 30 days before joining their crèches (groups of young penguins huddling together for warmth and protection). At 50 to 60 days of age, after molting, the chicks finally go to sea (Barham and Barham 1996, Hale 1999).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pygoscelis antarcticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCCTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGTACCCTCTACCTAATCTTTGGCGCATGAGCAGGTATAGCCGGAACCGCTCTAAGCCTGCTCATTCGCGCAGAGCTTGGCCAACCTGGAACCCTCCTAGGAGATGACCAAATCTACAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATACCCATCATGATCGGAGGATTCGGAAACTGACTAGTGCCACTTATAATCGGCGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTGCTACCCCCATCCTTCCTACTCCTACTAGCCTCATCCACAGTAGAAGCAGGGGCTGGCACAGGATGAACTGTGTACCCACCACTAGCAGGTAACCTAGCCCACGCTGGTGCTTCAGTAGACCTAGCTATCTTCTCCCTCCACCTAGCAGGAGTCTCCTCCATCCTAGGGGCTATCAATTTTATCACCACTGCCATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTTATTACAGCCGTTCTCCTACTACTTTCACTCCCTGTGCTCGCTGCTGGCATCACTATACTACTAACTGACCGAAACCTAAACACCACCTTCTTCGACCCCGCTGGAGGGGGAGACCCAGTCCTATACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTATATATCCTAATCCTTCCAGGTTTCGGAATCATCTCCCACGTAGTAACATACTATGCAGGCAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTGTCCATCGGATTCCTCGGCTTCATCGTATGGGCCCACCACATGTTCACAGTCGGAATAGACGT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pygoscelis antarcticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

12 to 13 million Chinstrap penguins are thought to be located on the barren islands of the sub-Antarctic Region and the Antarctic Peninsula. Thus, this species is in no immediate danger. They are legally protected from hunting and egg collecting.

Two recent studies show that penguins have been infected with diseases that were most likely spread by people discarding poultry. Australian scientists at Mawson Station inAntartica found antibodies for infectious bursal disease virus (IBDV) in Emperor penguin chicks (Aptenodytes forsteri) and adults of Pygoscelis adeliae, Adelie penguins. Swedish scientists found Salmonella bacteria in penguins on Bird Island.

Under the Antarctic Treaty System, the "Agreed Measures for the Conservation of Antarctic Fauna and Flora prohibit killing, wounding, capturing, or molesting any native mammal or bird in Antarctica without a permit." These "Agreed Measures" strengthen the conservation by the Protocol on Environmental Protection for the Antarctic Treaty. Annex II. This protocol prohibits the import of live poultry, and requires specific treatment for dressed poultry and its disposal. To evaluate the statues of various animals the the Conservation Assessment and Management Plan (CAMP) is used, which determines the conservation priorities for a country. During a conference in 1992 where New Zealand penguins were discussed resulted in the choices of further management, research and captive breeding programs for nine species and subspecies.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population is estimated to number at least 8 million individuals.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Penguins eat seafood that consists of 94% fish, 5% squid, and 1% crustacea. Fisheries argue that in one breeding season, all species of penguin are able to eat 7,000 tons of food, and 2,900 of that has economic value to humans (Sparks and Soper 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Today, penguins are economically important in South America and South Africa for their guano, which is used for fertilizer. Penguins in general are a big tourist attraction no matter where their home is. In the past, commercial egg collecting caused severe damage to rookeries and penguins were also slaughtered for their blubber. In some places, such as islands in the southern Indian Ocean, fishermen still use penguin meat for bait ("Penguins" 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chinstrap penguin

For other uses, see Chinstrap (disambiguation).
Chinstrap penguin colony near Orne Harbor, Antarctic Peninsula
Front view of the head
Adult with juveniles
Chinstrap penguins trying to get onto an iceberg in Antarctica

The chinstrap penguin (Pygoscelis antarctica) is a species of penguin which is found in the South Sandwich Islands, Antarctica, Deception Island, the South Orkneys, South Shetland, South Georgia, Bouvet Island and Balleny. Their name derives from the narrow black band under their heads which makes it appear as if they are wearing black helmets, making them one of the most easily identified types of penguin. Other names for them are "ringed penguins", "bearded penguins", and "stonecracker penguins" due to their harsh call.

Description[edit]

Chinstrap penguins can grow up to 68 cm (27 in) in length, and a weight of 6 kg (13.2 lbs);[2] however, their weight can drop as low as 3 kg (6.6 lbs) depending on the breeding cycle. Males are both larger and heavier than females.[3][4]

The adult chinstraps' flippers are black with a white edge; the inner sides of the flippers are white. The face is white extending behind the eyes, which are reddish-brown; the chin and throat are white as well, while the short bill is black. The strong legs and the webbed feet are pink. The chinstrap penguin's black-and-white plumage helps camouflage it in the water from predators such as seals. When seen from above, the bird's black back blends into the dark water below, while the bird's underside blends into the sunshine above when seen from below.[5]

Their diet consists of krill, shrimp, fish, and squid which they swim up to 80 km (50 mi) offshore each day to obtain. The chinstrap penguin is able to withstand swimming in freezing waters due to its tightly packed feathers, which provide a waterproof coat. Thick blubber deposits provide insulation, as well, and blood vessels in the flippers and legs have evolved intricate structures to preserve heat.[5]

They live on barren islands and during winter congregate on large icebergs of the sub-Antarctic region and the Antarctic Peninsula; however, they require solid, snow-free ground for nesting. The chinstrap penguin's primary predator is the leopard seal. The 16 million chinstrap penguins have typical lifespans of 15–23 years.

Chinstrap penguins are considered the most aggressive species of the penguin.[6]

Predators[edit]

The predator of adult chinstraps is the leopard seal. Eggs and chicks can fall prey to birds, such as the sheathbill and the brown skua. Sea lions are their main predator. All of the chinstrap's predators are sea lions, orcas, skuas, leopard seal and sharks.

Behavior[edit]

On land they build circular nests from stones, and lay two eggs, which are incubated by both the male and the female for shifts of 6 days. The chicks hatch after about 37 days, and have fluffy gray backs and white fronts. The chicks stay in the nest for 20–30 days before they go to join a crèche. At around 50–60 days old, they moult, gaining their adult feathers and go to sea.

Roy and Silo[edit]

Main article: Roy and Silo

In 2004, two male chinstrap penguins named Roy and Silo in Central Park Zoo, New York City, formed a pair-bond and took turns trying to "hatch" a rock, for which a keeper eventually substituted a fertile egg, and the pair subsequently hatched and raised the chick. Penguins by nature hatch eggs and are social creatures. Children's book And Tango Makes Three was written based on this event.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!