Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

This species has a circumpolar distribution, being found in Antarctica, the South Sandwich Islands (Islas Sandwich del Sur), the South Orkneys, South Shetland and South Georgia (Georgia del Sur), Bouvet Island (to Norway) and the Balleny Islands1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Chinstrap penguins make their home around the Antarctic Peninsula and the coastal islands of the continent. Mainly, you find them on the South Shetland Islands, South Orkney Island and South Sandwich (Welch 1997).

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Chinstrap penguins are white on the front and throat but have a black back. A thin band of black plumage runs from one side of the head to the other, right below each reddish eye and unites under the bill. Chicks have grey backs and white fronts. The male and female Chinstraps are monomorphic, as are all other penguins, thus make it hard to tell them apart without non-morphological cues. They stand about 72 cm tall and weigh about 3.5 to 5 kg. Adult weight varies during the year. When the penguin is in the molting season they gain the most weight and when they are in the brooding period they lose the most. Chinstrap penguins are able to withstand extreme cold due to the insulation provided by their short, densely packed feathers. This in turn forms a waterproof coat. Underneath these feathers, a thick layer of fat or blubber also serves as storage for energy. These adaptations help protect them against the extreme cold conditions of the Antarctic by minimizing heat loss in icy cold waters (Hale 1999, Muller-Schwarze 1984, Welch 1997).

Range mass: 3000 to 5000 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is solely marine and is mostly found in zones with light ice pack. Its diet is comprised almost exclusively of Antarctic krill, but it will also take fish and other species of crustaceans when possible. Prey capture is apparently by pursuit-diving up to a depth of 70 m, but mostly less than 45 m. It breeds on irregular rocky coasts in ice free areas, forming large colonies of hundreds and thousands of birds and beginning laying in November at the earliest1.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Chinstrap Penguins often live on large icebergs on the open ocean. One colony on the South Sandwich Islands is said to contain over 10 million birds. They are a stable population and were last estimated to include about 7.5 million breeding pairs. (Barham and Barham 1996, Welch 1997, Woehler and Chippingdale 2000).

Terrestrial Biomes: icecap

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 984 specimens in 1 taxon.
Water temperature and chemistry ranges based on 580 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.465 - 9.412
  Nitrate (umol/L): 10.652 - 30.562
  Salinity (PPS): 33.651 - 34.197
  Oxygen (ml/l): 6.657 - 8.188
  Phosphate (umol/l): 1.048 - 2.119
  Silicate (umol/l): 4.584 - 89.471

Graphical representation

Temperature range (°C): -1.465 - 9.412

Nitrate (umol/L): 10.652 - 30.562

Salinity (PPS): 33.651 - 34.197

Oxygen (ml/l): 6.657 - 8.188

Phosphate (umol/l): 1.048 - 2.119

Silicate (umol/l): 4.584 - 89.471
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Chinstrap's diet is quite simple and consists of small shoaling animals: krill, small fish and other roaming marine crustacea. Chinstrap penguins' prey is 95% krill and about 5% of the other species mentioned (Barham and Barham 1996; Welch 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

The nests they build on icebergs are roughly circular consisting of stones and are typically 40 cm in diameter and up to 15 cm high. Chinstrap penguins usually lay two eggs, generally two to four weeks later than other pygoscelid species in the same area. The Chinstraps complete their breeding cycle by February or March and go back to the pack ice during winter. The eggs are hatched by both parents in shifts of 5 to 10 days. After 33 to 35 days the chicks hatch and they stay in the nests for 20 to 30 days before joining their crèches (groups of young penguins huddling together for warmth and protection). At 50 to 60 days of age, after molting, the chicks finally go to sea (Barham and Barham 1996, Hale 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pygoscelis antarcticus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
BROMB032-06|886224|Pygoscelis antarcticus| AACCGATGATTATTCTCAACCAACCACAAAGATATCGGTACCCTCTACCTAATCTTTGGCGCATGAGCAGGTATAGCCGGAACCGCTCTA---AGCCTGCTCATTCGCGCAGAGCTTGGCCAACCTGGAACCCTCCTAGGAGAT---GACCAAATCTACAACGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATACCCATCATGATCGGAGGATTCGGAAACTGACTAGTGCCACTTATA---ATCGGCGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTGCTACCCCCATCCTTCCTACTCCTACTAGCCTCATCCACAGTAGAAGCAGGGGCTGGCACAGGATGAACTGTGTACCCACCACTAGCAGGTAACCTAGCCCACGCTGGTGCTTCAGTAGACCTA---GCTATCTTCTCCCTCCACCTAGCAGGAGTCTCCTCCATCCTAGGGGCTATCAATTTTATCACCACTGCCATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTTATTACAGCCGTTCTCCTACTACTTTCACTCCCTGTGCTCGCTGCT---GGCATCACTATACTACTAACTGACCGAAACCTAAACACCACCTTCTTCGACCCCGCTGGAGGGGGAGACCCAGTCCTATACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTATATATCCTAATCCTTCCAGGTTTCGGAATCATCTCCCACGTAGTAACATACTATGCAGGCAAAAAA---GAACCATTCGGCTACATAGGAATAGTATGAGCCATACTGTCCATCGGATTCCTCGGCTTCATCGTATGGGCCCACCACATGTTCACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pygoscelis antarcticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
BirdLife International

Reviewer/s
Calvert, R., Symes, A., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2009
    Least Concern
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

12 to 13 million Chinstrap penguins are thought to be located on the barren islands of the sub-Antarctic Region and the Antarctic Peninsula. Thus, this species is in no immediate danger. They are legally protected from hunting and egg collecting.

Two recent studies show that penguins have been infected with diseases that were most likely spread by people discarding poultry. Australian scientists at Mawson Station inAntartica found antibodies for infectious bursal disease virus (IBDV) in Emperor penguin chicks (Aptenodytes forsteri) and adults of Pygoscelis adeliae, Adelie penguins. Swedish scientists found Salmonella bacteria in penguins on Bird Island.

Under the Antarctic Treaty System, the "Agreed Measures for the Conservation of Antarctic Fauna and Flora prohibit killing, wounding, capturing, or molesting any native mammal or bird in Antarctica without a permit." These "Agreed Measures" strengthen the conservation by the Protocol on Environmental Protection for the Antarctic Treaty. Annex II. This protocol prohibits the import of live poultry, and requires specific treatment for dressed poultry and its disposal. To evaluate the statues of various animals the the Conservation Assessment and Management Plan (CAMP) is used, which determines the conservation priorities for a country. During a conference in 1992 where New Zealand penguins were discussed resulted in the choices of further management, research and captive breeding programs for nine species and subspecies.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: least concern

  • 2000. "Penguins" (On-line). Accessed Oct. 23, 2000 at http://www.seaworld.org/Penguins/pageone.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Penguins eat seafood that consists of 94% fish, 5% squid, and 1% crustacea. Fisheries argue that in one breeding season, all species of penguin are able to eat 7,000 tons of food, and 2,900 of that has economic value to humans (Sparks and Soper 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Today, penguins are economically important in South America and South Africa for their guano, which is used for fertilizer. Penguins in general are a big tourist attraction no matter where their home is. In the past, commercial egg collecting caused severe damage to rookeries and penguins were also slaughtered for their blubber. In some places, such as islands in the southern Indian Ocean, fishermen still use penguin meat for bait ("Penguins" 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!