Articles on this page are available in 1 other language: Spanish (9) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Patagioenas cayennensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATATCTAATTTTCGGCGCATGAGCCGGCATAGTTGGCACCGCACTTAGTCTCCTCATTCGCGCAGAACTAGGACAACCAGGCACTCTCCTGGGAGACGACCAAATCTACAATGTAATTGTTACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTCATACCCATCATAATCGGAGGCTTTGGAAACTGATTAGTTCCCCTTATAATCGGCGCCCCCGACATAGCATTCCCACGAATAAATAACATAAGCTTTTGACTACTACCCCCATCTTTCCTCCTTCTCCTGGCTTCTTCCACAGTCGAAGCTGGTGCAGGAACAGGATGAACCGTATACCCTCCCCTAGCCGGCAACCTAGCCCACGCAGGAGCTTCTGTAGACCTTGCCATCTTCTCCCTCCATCTTGCTGGTGTCTCTTCCATCCTGGGAGCCATCAACTTTATCACAACTGCCATTAACATAAAACCACCAGCCCTCTCACAATATCAAACCCCCCTATTCGTATGATCAGTCCTCATCACCGCCGTCCTCCTTCTCCTATCCCTCCCAGTCCTCGCCGCCGGCATTACAATACTACTCACAGATCGGAACCTTAACACTACCTTCTTCGACCCTGCCGGTGGAGGTGACCCAGTATTATACCAACACCTCTTCTGATTCTTTGGCCACCCCGAAGTCTACATCCTAATTTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Patagioenas cayennensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Columba cayennensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight (A. Panjabi in litt. 2008)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pale-vented Pigeon

The Pale-vented Pigeon (Patagioenas cayennensis) is a large pigeon (family Columbidae) found in the tropical American. Formerly often placed in Columba, it actually belongs to a clade of the older New World genus Patagioenas. With its relatives it represents an evolutionary radiation extending through most of the warm-temperate to tropical Americas. Grey-hued birds, even their males generally lack iridescent display plumage, although the present species has some coppery gloss on the nape.[2]

It is a resident breeder from southern Mexico south to Bolivia and northern Argentina and on Tobago and Trinidad, although it is very localised on the latter island. Vagrants are occasionally seen in adjacent regions; for example, the species is noted to stray into Uruguay from Argentina and occasionally from Brazil, but it has never been noted to breed or even maintain a permanent presence in the former country.[3][4][5][6]

Description

The Pale-vented Pigeon is 30–32 cm long and weighs normally 230–250 g. Adult males have a mainly dull purple head, breast and upperpart plumage, with copper glossing on the nape and a whitish throat. The lower back and tail are dark grey and the lower underparts are pale grey. The bill is black and the legs, iris and eyering are red. The female is similar, but duller than the male, and immatures are greyish-brown, very dull, and mainly greyish brown.

The southern subspecies P. c. andersoni has white lower underparts, rather than the pale grey of nominate P. c. cayennensis.

The call is a row of soft kuk kuk croo-ooos; the initial short kuk is characteristic for the "cayennensis group" of Patagioenas. Altogether, this species' song is intermediate between that of its close relatives the Plain (P. inornata) and Red-billed Pigeons (P. flavirostris).[2][7]

It may in the field resemble a Scaled Pigeon (P. speciosa), which has a similar display flight. These two large species are also the only pigeons in their range which are often seen flying in the open away from forests. But of course P. cayennensis lacks the scaly appearance, and the calls[7] and appearance from close by indicate that the two are not particularly close relatives among their congeners.

Ecology

The Pale-vented Pigeon is common at forest edges, riverbanks, and other partially open areas with some trees. It feeds mainly on small fruits, berries and seed. This is a fairly solitary bird, but may form small flocks at drinking areas. Its flight is high, fast and direct, with the regular beats and an occasional sharp flick of the wings which are characteristic of pigeons in general.

It also has a breeding display with a semi-circular glide down to its original perch. It builds a small twig nest in a small tree, and normally lays one white egg.

Widespread and common, it is classified a Species of Least Concern by the IUCN.[1]

References

  1. ^ a b BirdLife International (2012). "Patagioenas cayennensis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106002484. Retrieved 16 July 2012.
  2. ^ a b Johnson, Kevin P.; de Kort, Selvino; Dinwoodey, Karen, Mateman, A. C.; ten Cate, Carel; Lessells, C. M. & Clayton, Dale H. (2001): A molecular phylogeny of the dove genera Streptopelia and Columba. Auk 118(4): 874-887. DOI:10.1642/0004-8038(2001)118[0874:AMPOTD]2.0.CO;2 PDF fulltext
  3. ^ ffrench, Richard; O'Neill, John Patton & Eckelberry, Don R. (1991): A guide to the birds of Trinidad and Tobago (2nd edition). Comstock Publishing, Ithaca, N.Y.. ISBN 0-8014-9792-2
  4. ^ Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
  5. ^ Stiles, F. Gary & Skutch, Alexander Frank (1989): A guide to the birds of Costa Rica. Comistock, Ithaca. ISBN 0-8014-9600-4
  6. ^ Azpiroz, Adrián B. & Menéndez, José L. (2008): Three new species and novel distributional data for birds in Uruguay. Bull. B.O.C. 128(1): 38-56.
  7. ^ a b Mahler, Bettina & Tubaro, Pablo L. (2001): Relationship between song characters and morphology in New World pigeons. Biol. J. Linn. Soc. 74(4): 533–539. doi:10.1006/bijl.2001.0596 (HTML abstract)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!