Overview

Brief Summary

Biology

Just as the habitat preferences of this pigeon differ between the islands, its breeding season seems to also vary. In Cuba, Haiti and the Dominican Republic, breeding occurs between April and July, whilst in Puerto Rico breeding appears to occur all year round. The Puerto Rican population also differs by normally laying a single egg, compared to an average of two eggs on the other islands. It builds fragile stick nests in trees, (including mangroves, pines and hardwoods), or on epiphytic plants, where the eggs are incubated for 13 – 15 days. Fledging occurs after 21 - 23 days (2). The plain pigeon has a varied diet, consisting of fruits, berries, seeds, buds, leaves and flowers. It sometimes feeds on the ground, but spends the majority of its time feeding in the trees (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This large pigeon is about the size and shape of a domestic pigeon, and appears pale blue-grey at a distance (3). When closer up, it can be identified by a subtle wine-colouring on its wings and breast, and a white margin on the leading-edge of the wing (4). It has a dark grey to black tail and bill, dark red legs and interestingly coloured eyes; the iris is a ring of pale blue, surrounded by a ring of dark blue and then a ring of pale orange. Females are slightly paler than male plain pigeons, and juveniles can be distinguished by their more brown colouring (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Patagioenas inornata was once abundant and widespread in the Caribbean, but has undergone considerable declines. In Cuba, it was widespread, but has now declined; it was thought to be now restricted to six areas: the Guanahacabibes (c.100 pairs, the largest population) and Zapata peninsulas, the sierras de Najasa and del Chorrillo, cayos Romano and Sabinal and the Esteros de Birama3, but has subsequently been found at another eleven localities13. In Jamaica, it was scarce as early as 18402, and is now rare and local. On Puerto Rico (to USA), it numbered less than 100 in the 1970s, but had increased to c.700 by 19968 and recent information suggests that this population totalled 1497-6106 individuals during 1997-200110. This population increase is attributed to increased food and nesting habitat availability following the recovery of second growth forests, resulting from the abandonment of marginally productive pasture and cropland as Puerto Rico gradually became industrialised from the 1940s onwards10. In the Dominican Republic, extensive searches in 1986 failed to find the species, and sites with records in the 1970s had been cleared. However, it has been recently described as locally common9, especially in the Sierra de Baoruco4,5. In Haiti, there have been reports of birds in significant numbers, although numbers in Hispaniola overall are not reported to be increasing11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The plain pigeon is found only in the Greater Antilles. Three subspecies of the plain pigeon are recognised; Patagioenas inornata inornata is found on Cuba, Dominican Republic and Haiti, Patagioenas inornata exigua exists only on Jamaica, and Patagioenas inornata wetmorei is restricted to Puerto Rico (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found mainly in lowland forest, mangrove and swampy areas in Cuba, highland pine and broadleaf forest, and occasionally coastal desert and mangroves in Hispaniola, and wet limestone forests in west, and drier woodlands in southern Jamaica2. In Puerto Rico, it formerly occurred in primary lowland forests, but now mainly inhabits secondary growth, pasture and farmland1. Breeding is during April-July in Cuba and Hispaniola, and year-round in Puerto Rico1.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in a variety of habitats, which differ between islands. It is found mainly in lowland forest, mangrove and swampy areas in Cuba, highland pine and broadleaf forest, and occasionally coastal desert and mangroves in the Dominican Republic and Haiti, montane rainforests in Jamaica, and in secondary forest, pasture and farmland in Puerto Rico (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Patagioenas inornata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCTATATTTAATCTTCGGTGCATGAGCCGGCATAGTTGGCACCGCACTTAGCCTCCTCATTCGCGCAGAACTAGGACAACCAGGCACTCTTCTAGGAGACGATCAAATCTACAATGTAATTGTTACAGCCCATGCCTTCGTAATAATTTTCTTTATAGTTATGCCCATCATAATCGGAGGCTTTGGAAACTGATTAGTTCCCCTTATAATTGGTGCCCCCGACATAGCATTCCCACGAATGAACAACATAAGCTTTTGACTACTACCCCCATCTTTCCTCCTTCTCCTAGCTTCTTCCACAGTCGAAGCTGGTGCAGGAACAGGATGAACCGTATACCCTCCCCTAGCCGGCAACCTAGCCCACGCAGGAGCTTCCGTAGACCTTGCCATCTTCTCCCTCCATCTTGCCGGTGTCTCCTCCATCCTAGGGGCCATCAACTTTATCACAACTGCCATTAACATAAAACCACCAGCTCTCTCACAATACCAAACCCCCCTATTCGTATGATCAGTCCTCATCACTGCCGTCCTCCTTCTCCTATCCCTCCCAGTCCTTGCCGCCGGCATTACAATACTGCTCACAGACCGGAACCTTAACACCACCTTCTTCGACCCTGCCGGTGGAGGTGACCCAGTATTATACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Patagioenas inornata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
BirdLife International

Reviewer/s
Mahood, S., Butchart, S.

Contributor/s
Kirwan, G., Latta, S., Sutton, A., Kirkconnell, A., Mitchell, A., Rimmer, C.

Justification
This species has a moderately small population, and may be declining in some areas owing to habitat loss and hunting. It therefore qualifies as Near Threatened.

History
  • 2005
    Near Threatened
  • 2004
    Vulnerable
  • 2000
    Vulnerable
  • 1996
    Endangered
  • 1994
    Endangered
  • 1988
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List 2006 (1), and listed as Endangered on the U.S. Endangered Species Act 1967 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Rivera-Milan et al. (2003) reported 1,497-6,106 individuals.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Hunting, logging and clearance for plantation agriculture, combined with the devastating effects of hurricanes, have reduced populations1. Few birds are shot in Jamaica and this does not appear to explain the species's current scarcity on the island2. Nest predation may affect reproduction in key areas on Puerto Rico12.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The plain pigeon was once abundant and widespread throughout the Greater Antilles, but has since suffered a severe decline in numbers, and populations have become fragmented (4). This has been attributed to logging and the clearance of land for agricultural plantations, which has reduced the amount of suitable habitat available for the plain pigeon (1). Hunting has also been blamed for the decline of the plain pigeon (1). It has a surprisingly unwary nature, and therefore is an easy target for hunters (6). Furthermore, the devastating effects of hurricanes have contributed to the decline of this Caribbean bird (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
A recovery programme is underway in Puerto Rico7. Funding is being sought for conservation in Cockpit Country, Jamaica2. It is legally protected in Cuba (but this is not enforced), and has been recorded from several protected areas, including the Guanahacabibes Biosphere Reserve, where it has been the subject of an education programme.

Conservation Actions Proposed
Survey to assess numbers and distribution, especially in Cuba and Jamaica2,6. Assess the impact of illegal hunting2. Conserve the Cockpit Country, and southern dry limestone forests and woodlands, in Jamaica2. Design and implement education programmes in Cuba to reduce hunting pressures6. Enforce habitat protection in the Sierra de Bahoruco National Park in Dominican Republic.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In 2005, the plain pigeon was down-listed from Vulnerable to Near Threatened, according to the IUCN Red List (1). This is primarily due to a recovery programme implemented in Puerto Rico, after being listed as Endangered on the U.S. Endangered Species Act 1967 (3). A captive breeding programme which started in 1983 resulted in the release of a few birds into the wild in 1993. However, the area of Puerto Rico where most birds occur is still threatened by habitat loss and human disturbance (4), and therefore further conservation measures are still required. Elsewhere, little conservation action is occurring. The plain pigeon is protected against hunting throughout its range, but this is generally not enforced, and therefore illegal hunting still occurs (6). Surveys to assess the numbers of this species and its distribution are required, (1), as is protection from further habitat destruction and hunting (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Plain Pigeon

The Plain Pigeon (Patagioenas inornata) is a species of bird in the Columbidae family. It is found in Cuba, the Dominican Republic, Haiti, Jamaica, and Puerto Rico. Its natural habitats are forest, woodland, coastal desert, mangrove and swampy areas. It is threatened by habitat loss.

Contents

Description

The Plain Pigeon is a large-bodied bird (38 cm [15 in]) that superficially resembles the common city pigeon. At a distance it appears pale blue-gray overall. The head, hindneck, breast, and part of the folded wing are colored with a red-wine wash. When folded, the wing shows a white leading edge; in flight, it forms a conspicuous wing bar. Legs and feet are dark red. The female is slightly smaller and duller than the male. Juveniles are browner overall, with pale wing margins and dark eyes.

Taxonomy

The Plain Pigeon is thought to represent a fairly recent island adaptation of the Red-billed Pigeon (P. flavirostria) or the Maranon Pigeon (P. oenops), found in Central and South America. Three subspecies of the Plain Pigeon are recognized: P. i. inornata from Cuba and Hispaniola, P. i. exigua from Jamaica, and P. i. wetmorei from Puerto Rico.

Puerto Rican Plain Pigeon

During the 1970s, the Puerto Rican Plain Pigeon (P. i. wetmorei) was on the brink of extinction. A conservation program was introduced to save the species and now it numbers a few thousand individuals.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!