Articles on this page are available in 1 other language: Spanish (6) (learn more)

Overview

Distribution

Range

S Florida and offshore islands from West Indies to nw Panama.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Patagioenas leucocephala is found primarily in the Bahamas, Cuba, Jamaica and Antigua. It breeds in smaller numbers in Hispaniola (Dominican Republic and Haiti), Puerto Rico, the Virgin Islands (to USA), the Virgin Islands (to UK), San Andres (Colombia), Isla de Providencia and the Corn Islands (Nicaragua), Cayman Islands, Anguilla (to UK), St Barthelemy (to France), and more rarely on St Martin and Guadeloupe (to France)1. Populations extend west along the Caribbean coasts of Yucatan Mexico, Belize, Honduras and north-west Panama. It reaches the USA only in the Florida Keys and the southern tip of mainland Florida1,2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Breeding range includes southern Florida from Biscayne Bay south through the Marquesas Keys (Bancroft 1992), Bahama Islands, Greater Antilles, Lesser Antilles south to Antigua, Cayman Islands, and islands and coasts of the western Caribbean, from the Yucatan Peninsula southward through Belize, Honduras, Nicaragua, and Panama (AOU 1998). Most of the population occurs in the Greater Antilles and Bahama Islands (Bancroft and Bowman 2001). In the upper Florida Keys, Florida Bay is the primary nesting area (Strong et al. 1991). During the nonbreeding season this pigeon occurs throughout most of the breeding range but occurs more widely (and somewhat unpredictably) in Florida and along the mainland Caribbean coast of Middle America, where some breeding islands are evacuated during winter (Howell and Webb 1995, AOU 1998). Wintering individuals appear to move nomadically in response to fruit availability (Bancroft and Bowman 2001).

In Puerto Rico, the largest present breeding concentration is along the eastern coast and northern coast (all in mangroves except at Dorado Beach), with a small nesting congregation in hardwood forest of magotes east of San Sebastian; the largest breeding concentration is on Isla Mona (Wiley 1979).

Extent of occurrence (EOO), excluding areas of water, appears to somewhat exceed 200,000 square kilometers. BirdLife International (2008) estimated EOO at 236,000 square kilometers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Size

Length: 34 cm

Weight: 290 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
In Florida, the Bahamas, the coastal Yucatan islets and the Lesser Antilles it requires isolated offshore mangrove islets with limited disturbance for breeding, for feeding it flies to humid evergreen or semi-deciduous hardwood forests on adjacent mainland areas1,3. Elsewhere it generally occupies lower-lying forest habitats3.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nesting and foraging may occur in two distinctly different habitat types, coastal mangroves and tropical hardwood hammocks.

In Florida, most nests are in colonies typically on small mangrove islets that offer maximum protection from terrestrial predators. However, some colonies nest in remote stretches of coastal mangroves along the Florida Bay.

In the Bahamas, colonies have been described as occurring on open, rocky islets, some birds nesting on top of prickly pear cactus (Opuntia spp.) usually a few feet apart (Owre 1978). Maynard (1896) describes over 10,000 unoccupied nests present in cacti on an island less than 0.4 hectares (1 acre) in size.

In Puerto Rico, some birds breed in trees bordering a golf course (Wiley and Wiley 1979). Wiley and Wiley (1979) report that 86% of nests in one Puerto Rico location (Roosevelt Roads) were found in black mangroves, 10% in red mangroves and 4% in white mangroves. At another location (Dorado Beach), royal palm (Roystonea elata) and Australian beefwood were used most often, but Indian almond (Terminalia catappa), mango, maria, ceboruquillo (Thouinia striata), water mampoo, muneco (Cordia borinquensis), mamey (Mammea americana), jacana, mago, ucar (Bucida buceras), and gumbo limbo (Bursera simaruba) were also used for nesting. At a third location (Mona Island), over one-third of the birds nested in gumbo limbo, an equal amount in poisonwood, and the remainder in mahogany, beefwood and short-leaf fig.

The nest is usually located at the fork of a horizontal branch, ranging from the canopy to the ground, but usually 1-2 meters high (Wiley and Wiley 1979, Strong et al. 1991). Nest heights may vary with the risk of potential disturbance due to human activities (Wiley and Wiley 1979). The nest consists of a shallow, loosely crossed cup of twigs, lined with grass and rootlets (Ehrlich et al. 1988, Raffaele 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Because fruit production varies locally and seasonally, birds are required to constantly locate new sources of fruit and must search widely. The search for a steady supply of suitable fruiting trees influences much of the biology of this species.

Most of the Florida population is migratory. Data from five years of roadside surveys indicate that up to 90% of the U.S. breeding population leaves the Keys in winter (Bancroft et al. 1994). According to evidence from band returns and radio-telemetry, white-crowned pigeons nesting in the Upper Florida Keys first migrate to the Bahamas then fly south (Bancroft 1992). Birds nesting in the Lower Florida Keys may fly to Cuba rather than the Bahamas (Barbour 1923). While a small portion of the population spends the nonbreeding season in south Florida, most return to the Florida Keys in April and early May (Bancroft 1996).

In Puerto Rico and the Virgin Islands, white-crowned pigeons are most common in spring and summer when visitants from other islands augment local numbers and breed. Where food is available year round birds are resident, and most localities where the species breeds have a few birds throughout the year (Raffaele 1983.) Banding recoveries indicate that birds migrate between islands in the Caribbean (between Puerto Rico, St. Croix, and Vieques) and that some may move to interior mountain forest during the nonbreeding season (Wiley 1979).

White-crowned pigeons make daily flights from nesting and roosting sites to feeding areas (Gosse 1847, Gundlach 1874, Maynard 1896, Bent 1932, Barbour 1943, Johnston 1975). Birds will travel from the keys to mainland Florida in search of ripening fruit (AOU 1998, Kale 1978). Adult pigeons may fly more than 20 kilometers on foraging trips (G. Bancroft and A. Strong, unpubl. data), and may fly farther when fruit is scarce (Bancroft et al 2000). In Puerto Rico, Wiley and Wiley (1979) observed birds to fly 1-8 kilometers from mangrove roosting and nesting areas to scrub forest to feed and drink.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Birds depend upon fruiting plants and trees in tropical hardwood forests for their food supply. Diet includes the fruit of over 37 species of trees and shrubs (Bancroft et al. 1994).

The nestling diet is dependent primarily on four species of trees, poisonwood (Metopium toxiferum), blolly (Gaupira discolor), strangler fig (Ficus aurea) and short-leaf fig (F. citrifolia), making the relative abundance of these species very important. Poisonwood is by far the most important due to its high lipid content. The number of nesting pairs, nesting success, and survivorship of young have been observed to increase when poisonwood fruits ripen (Bancroft 1991).

White-crowned pigeons also consume the fruits of fiddlewood (Citharexylum fruiticosum), coco plum (Chrysobalanus isac), gumbo limbo (Bursera simaruba), pigeon plum (Coccoloba diversifolia), sea grape (Coccoloba uvifera), snowberry (Chiococca alba), mastic (Matichodendron foetidissimum), and the fruit of royal Palms (Roystonea regia, Kale 1978). White-crowned pigeons may also eat the "seeds" (fruits?) of the black mangrove (Avicennia germinans).

In Puerto Rico, the species forages on hardwood scrub slopes and canyons in mountain forest; it roosts and nests mainly in mangroves and may disperse into interior forest during the nonbreeding season (Wiley 1979). In Jamaica, it occurs in lowland forest of all types, especially the less arid types, and throughout wet limestone forest; it is a summer visitor to montane forest (Lack 1976). See Lack (1976) for species of fruits eaten in Jamaica.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: Number of occurrences has not been determined using standardized criteria, but this species is represented by a fairly large number of occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 - 1,000,000 individuals

Comments: Total adult population size is unknown but apparently exceeds 100,000. Bancroft and Bownman (2001) and Rich et al. (2004) reported population size as 15,000 in the United States (Florida). Population estimates for other regions are relatively old. Blankenship (1977) reported that the Bahamas may have as many as 30,000 pairs. Arendt et al. (1979) estimated that theDominican Republic may have 5,000-10,000 pairs. In the mid-1970s in Puerto Rico, the estimated breeding population was 6,000 on Isla Mona, about 4,000 on Puerto Rico proper, 300 on Isla Culebra, and 400 on Isla Vieques (Wiley 1979). The largest nesting population is probably in Cuba (Bancroft and Bowman 2001).

Birdflife International (2008) reported the global number of mature individuals as 550,000 and cited the Partners in Flight: North American Landbird Conservation Plan (Rich et al. 2004) as the justification, but that document deals only with the United States and Canada and does not provide population estimates for other regions.


Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

This species is an obligate frugivore and an extremely important component of south Florida ecosystem, dispersing seeds of many trees, shrubs, and vines. It is strongly associated with the plant species diversity of tropical hardwood hammocks and plays an important role in maintaining the diversity of the hammock ecosystem by eating the fleshy fruits and dispersing the seeds between hammocks. Seed dispersal between habitat patches leads to greater species diversity in the hammocks and provides for future supplies of fruit-bearing plants. Because different species fruit at different periods throughout the year, seed dispersal may ensure a more steady food supply throughout the year (Strong and Bancroft 1994).

Young and eggs are preyed upon by red-winged blackbirds (Blankinship 1977, Sprunt 1977, Bancroft and Bowman, unpubl. data), raccoons, red-tailed hawks, pearly-eyed thrashers, and crows).

White crowned pigeons are a known host for Trichomonas gallinae. One study showed that over 88% of captured wild birds were carriers of this parasite, but that white-crowned pigeons are probably resistant to trichomoniasis under natural conditions (Kocan and Sprunt 1971). Birds in Puerto Rico are often infected by warble fly (Philornia pici) larvae,which may kill young or retard their development (Wiley and Wiley 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Flights from night roost begin shortly after sunrise, returns by shortly after sunset (Wiley 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 14.4 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

In Florida and throughout the range, birds often nest colonies or loose aggregations, usually with no more than one nest per tree. However, in at least in some regions of Puerto Rico, this species does not appear to be colonial (Wiley and Wiley 1979).

Breeding activity typically begins during the late dry and early wet season but ends well before the end of the wet season. In Florida, the first nesting period begins in mid- to late May (when Ficus are increasing) and extends into June, and the second nesting period begins in July (when poisonwood fruits ripen) and extends into August. Active nests can be found through September (Bancroft 1992, Bancroft et al. 2000). The nesting season in more southerly locations is often longer (Wiley and Wiley 1979, Jeffrey-Smith 1972).

Geographical and annual variation in timing of appears to be related to the types of fruit available and their quantity (Bancroft and Bowman 2001)A large peak in nesting activity coincides with the availability of ripe poisonwood, and to a lesser extent, blolly fruits (Bancroft et al. 2000). Unlike other pigeon species, white-crowned pigeons do not supplement their frugivorous diet with insects during the breeding season. As a result, poisonwood appears to be extremely important due to its high energy and protein content.

This species has a monogamous mating system. Individual adult females lay usually two glossy white eggs, sometimes one, and may have up to four broods per year. Young are altricial. Incubation averages 13-14 days. Both sexes incubate; female attends nest at night, male attends nest from mid-morning through early evening). Young leave nest at about 2.5-3 weeks, are independent 2-15 days later, and are fed by parents until about 28-40 days old. Young birds are fed crop milk for 3 days and then receive a milk-fruit mixture (Ehrlich et al. 1988).

Wiley and Wiley (1979) reported that nesting success was as high as 1.4 chicks fledged/active nest and as low as 0.3 chicks fledged/active nest. Nesting success varied considerably among four study seasons from a high of 67.8% to a low of 25.9%.

Strong and Bancroft (1994a) found that young birds in the Florida Keys typically remained on their natal key until 26 days of age where they continued to be fed by their parents. Young dispersed more than 20 kilometers during the first 10 days of post-dispersal. Strong and Bancroft suggested that some parental contact may be maintained during postfledging dispersal and that adult birds may be leading young to feeding sites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Patagioenas leucocephala

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATACCTAATTTTCGGCGCATGAGCTGGCATAGTTGGCACCGCACTTAGCCTTCTCATTCGCGCAGAATTAGGACAACCAGGTACTCTTCTAGGAGATGACCAAATCTACAACGTAATTGTTACAGCCCATGCTTTCGTAATAATCTTCTTCATGGTTATGCCCATCATAATCGGAGGCTTTGGAAACTGACTAGTCCCCCTCATAATCGGCGCCCCCGACATAGCATTCCCGCGAATAAATAACATAAGCTTTTGACTACTACCTCCATCCTTCCTACTCCTCCTAGCCTCCTCCACAGTCGAAGCTGGTGCAGGAACAGGATGAACCGTATACCCCCCTCTAGCTGGCAATCTAGCCCACGCAGGAGCCTCCGTAGACCTCGCCATCTTCTCTCTCCATCTTGCTGGTGTCTCCTCCATCCTAGGGGCCATCAACTTTATCACGACTGCCATCAACATAAAACCACCAGCCCTCTCACAATACCAAACCCCCCTGTTCGTGTGATCAGTCCTCATCACCGCCGTTCTCCTTCTCCTATCTCTCCCAGTCCTTGCCGCTGGCATCACAATACTACTCACAGACCGAAACCTCAACACTACCTTCTTCGACCCTGCTGGTGGAGGTGACCCAGTATTATATCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Patagioenas leucocephala

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
BirdLife International

Reviewer/s
Mahood, S., Butchart, S.

Contributor/s
Rosenberg, K., Butcher, G., Wells, J.

Justification
This species is classified as Near Threatened because although it has quite a wide range, it is restricted to low-lying areas where deforestation and habitat degradation are most intense. Together with hunting pressure, this is thought to be causing a moderately rapid population reduction.

History
  • 2004
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Occurs throughout the Caribbean/Bahama region; probably continuing to decline overall as a result of habitat loss/fragmentation and harvesting, although populations appear to be stable or increasing in some areas; most of range lies within rapidly developing countries that do not protect habitat or adequately manage for this species; dependence on two distinct habitat types for nesting and foraging, as well as daily and seasonal movement patterns, increases difficulty of providing adequate protection.

Other Considerations: Despite the lack of data on population trends, the increasing rarity of this species has afforded it endangered or threatened status with several state and national agencies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Rich et al (2003)

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Based on ongoing habitat loss and hunting/harvesting in many parts of the range, this species likely is declining in area of occupancy, number of subpopulations, and population size, but the rate of decline is unknown. BirdLife International (2008) reported the trend as declining (past and future) at 20-29% over 10 years or three generations and based that conclusion on Breeding Bird Survey (BBS) data, but the BBS encompasses only a tiny fraction of the pigeon's range (only Florida) and so is not suitable for global trend estimation. Also, white-crowned pigeons are too poorly sampled by the roadside protocol of the Breeding Bird Survey in Florida to determine population trend. Nevertheless, the current rate of decline probably is less than 30 percent over 10 years or three generations.

Global Long Term Trend: Decline of 30-70%

Comments: Trends are poorly documented, but this species appears to have declined in abundance, number of subpopulations, and area of occupancy throughout large portions of the range; current extent of occurrence is similar to the historical extent (Bancroft and Bowman 2001). The magnitude of decline is unknown but probably exceeds 25 percent.

Arendt et al. (1979) listed populations as decreasing in the Bahamas, Cuba, Haiti, Dominican Republic, Puerto Rico, the U.S. and British Virgin Islands, Anguilla, St. Martin, and Nicaragua; and increasing or stable in Florida, the Cayman Islands, Jamaica, Barbuda, Antigua, Mexico, Belize, Honduras, and Panama. In some areas, such as Florida and the Virgin Islands, hunting bans and protection of habitat have resulted in population expansions (Bancroft and Bowman 2001).

Once an abundant breeder in Puerto Rico and the Virgin Islands, the white-crowned pigeon is now considered rare on Puerto Rico and uncommon on the larger, more populated of the Virgin Islands (Raffaele 1983). Wetmore (1916) described the species as formerly one of the most abundant species in Puerto Rico, but only in a few isolated localities. However, it is still relatively common in some mangroves, particularly on smaller, more undisturbed islands and some remote coastlines throughout coastal Puerto Rico and the Virgin Islands (Raffaele 1983).

The Florida population apparently was stable in the early 1990s (Strong et al. 1994, Wiley and Wiley 1979, Wiley 1985) but likely declined considerably with subsequent loss of nesting and foraging habitat. . For the United States, this species was listed as a "Watch List Species-Moderately abundant or widespread with declines or high threats" by Partners in Flight (Rich et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Degradation of foraging habitat is a threat to this species2. In Florida removal of poisonwood Metopium toxiferum, which can cause severe human dermatitis, affects the species as it feeds on the poisonwood's fruit1,3. C. leucocephala is an important game species through much of its range, and although hunting regulations in the Bahamas have been changed, illegal hunting seems to be a threat1. Collision with man-made objects is a major source of mortality in Florida, and pesticide use and human impact may also have detrimental effects1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: AB

Comments: The primary threats are habitat loss (both nesting and feeding) and hunting (Bancroft and Bowman 2001).

HABITAT LOSS: A pervasive threat is loss and fragmentation of hardwood forest feeding habitat and mangrove-island nesting habitat (Strong and Bancroft 1994a, Bancroft et al. 2000, Bancroft and Bowman 2001). Clearing of land for agriculture, urban areas, resorts, and other commercial activities has degraded and reduced available habitat throughout the range. Accelerated drilling and filling of mangroves and clearing of upland feeding areas continues.

Continued destruction of hardwood forest throughout the Florida Keys is likely the most serious and increasing threat to the U.S. population. Because young birds require larger patches of forest, continued fragmentation of the remaining hammocks will likely reduce successful recruitment of young birds into the population and increase the vulnerability of young and mature pigeons to predation (Strong and Bancroft 1994). Destruction and fragmentation of forest decreases fruit supplies and increases the disturbance of birds feeding in remaining trees (Bancroft 1992). Strong and Bancroft (1994b) estimated from Long Key north to the Ragged Keys over 40% of the seasonal deciduous forests and 15% of the mangrove forests have been cleared for development. Further loss of habitat will continue to threaten the south Florida population (Strong et al. 1994). Degradation of foraging habitat may already be affecting the behavior of the Florida population. The increasing numbers of birds feeding in pinelands north of Florida Bay (Ogden 1973) suggest that some birds may already be resorting to atypical habitats.

In Puerto Rico, Wiley (1985) estimated that less than 0.2% of the original forests remained. The factors that have contributed to declining populations in Puerto Rico have also affected many other species. Raffaele (1983) cited 49 of 51 avian endangerments on Puerto Rico as being precipitated by habitat destruction and disturbance.

HUNTING: Illegal harvesting of squabs and shooting of nesting adults may limit reproductive success throughout much of the range (Strong and Bancroft 1994a, Bancroft and Bowman 2001). Severe hunting pressure and collecting of squabs in the Bahamas and other Caribbean nesting grounds has reduced numbers and has been a major reason for this species' demise (Raffaele 1985). Biaggi (1970) described the species as diminishing alarmingly in Puerto Rico, presumably from pressures related to hunting (Owre 1978). Pigeons are especially vulnerable early in the nesting season because their populations are highly localized at nesting colonies and make regular flights between these sites and feeding/watering sites. In addition, recently fledged young are less wary (Wiley 1979).

HUMAN DISTURBANCE: White-crowned pigeons are very wary of human activity and are sensitive to human activity, which may deter them from potential foraging areas and may render potential nesting areas unsuitable.

PREDATION: Colonization of nesting islands by raccoons may represent a serious threat to breeding populations. Currently, the distribution of raccoons on mangrove keys is limited by the distance from the mainland or mainline keys and by the frequency of major hurricanes (Bancroft 1992). Locally, human habitation has also facilitated local increases in populations (Strong et al. 1991). It appears that, with few exceptions, white-crowned pigeons will not nest on islands that have been occupied by raccoons (Strong et al. 1991). Expansion of raccoons into more keys in Florida Bay is likely to make more islands unsuitable for nesting.

NATURAL DISTURBANCES: Because over 75% of the nesting population in the Upper Florida Keys have been estimated to breed on 16 keys, this population may be especially vulnerable to hurricanes (Strong et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
None is known.

Conservation Actions Proposed
Protect important breeding islets. Ensure protection of low-lying forests on larger islands where the species forages. Discourgae removal of poisonwood where possible in Florida. Enforce hunting laws. Take measures to reduce collision with man-made objects. Educational programs that encourage people to plant native, fruit-producing trees in the Florida Keys should be enacted. Investigate the effects of pesticide use on the species. Monitor key populations throughout the species range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Restoration Potential: Recent conservation efforts and the establishment of national park lands and other protected areas in the Bahamas and Caribbean where hunting pressure has been high should help ensure the survival of this species. Recovery of this species will not be possible without continuing efforts to conserve existing habitat, throughout its range. However, habitat conservation will not always be sufficient to facilitate population recoveries. In the U.S. Virgin Islands there has been no open season since 1960, and nesting areas are now protected, but the near-complete destruction of mangrove nesting habitat leaves little hope for a substantial recovery of populations (Wiley 1985). Restoration projects that improve and expand mangrove nesting habitat and foraging areas will certainly benefit this species. Efforts underway to restore ecological function to the Florida Everglades may yield benefits for this species.

Preserve Selection and Design Considerations: Primary considerations for preserve selection are protecting coastal mangroves and islets suitable for breeding and protecting the remaining large patches of tropical hardwood hammock forest from further destruction and fragmentation. Habitat destruction in the Florida Keys and mainland has increasingly fragmented suitable nesting and foraging habitat.

Most nesting habitat is protected by the Everglades National Park, but loss of foraging habitat is a continuing threat to the Florida population (Strong et al. 1991). Conservation of fragments of at least five hectares (12 acres) is a priority. Large fragments (5.01-20 ha) make up less than 15% of the available habitat on the mainline keys, yet are preferred sites for dispersing young pigeons (Strong and Bancroft 1994a, Bancroft et al. 1992). Priorities for conservation and acquisition of important tropical hardwood forest in Florida are on Key Largo (especially the southern portion where only 17% of available habitat is protected) and other mainline keys.

However, habitat protection alone may not ensure the persistence of this species (Strong and Bancroft 1994). The distribution of habitat patches also appears to have significant importance. Larger forest tracts must be available near nesting areas to provide safe areas for post-fledging dispersal of immature birds. Habitat protection for dispersing young on the Florida mainland appears relatively sufficient as most birds were found within currently protected areas.

Extensive foraging habitat is also protected within the Everglades, but foraging areas closest to most nesting islands are on the mainline Keys and in Florida Bay where significant islands of suitable habitat are surrounded by water or development and are increasingly threatened. These locations are especially important to young pigeons as they are used as primary foraging locations for dispersing young and bases for dispersal to even more isolated patches of forest (Strong and Bancroft 1994b). Reproductive success is at least partly dependent on the availability and geographic location of larger, less fragmented habitats. Because most nesting areas are islets, young birds must fly from their nesting area over water to reach a suitable foraging area. In Florida, young dispersing from breeding grounds in the upper keys dispersed in two different directions, some to the mainline keys and others to the Florida mainland (Strong and Bancroft 1994). Young dispersing for the first time showed a preference for forest fragments 5-20 ha in size, and secondarily those .06 to 5 ha in size, and avoided urban areas altogether (Bancroft 1992, Strong and Bancroft 1994). The distance between the larger hammock patches has been shown to influence the successful dispersion of young pigeons (Strong and Bancroft 1994a).

Because White-crowned Pigeons are important for medium- and long-distance seed dispersal, their conservation will contribute to the conservation of the tropical hardwood hammock forest community in general (Terborgh 1986). Strong and Bancroft (1994b) suggest that conservation efforts should begin with protection of a network of relatively large forest fragments that would allow movement of this and other species of seed-dispersing organisms between large protected areas in the northern and southwestern portions of the mainline keys. Bancroft et al. (1992) suggest that a network of protected fragments that form "stepping stones" between the nesting keys and large tracts of forest habitat may be important for maintaining a viable population. Such a system would also provide a mechanism for dispersal and gene flow of plant species which would facilitate recolonization of plant species following hurricanes.

Management Requirements: HABITAT: In Florida and throughout the range of this species proposed elimination and alteration of any extensive stretch of coastal mangroves or mangroves islets should subject to careful review for impact to this species (Bancroft 1996). Locally, much can be done to maintain adequate food supplies by maintaining fruiting tree species in and around urban areas. Fig (FICUS spp.) trees are often are removed from residential areas because their extensive root systems interfere with septic systems. Poisonwood (Metopium toxiferum) is also removed because human contact with its sap causes severe itching (Scrulock 1987, Bancroft et al. 2000). Preservation and/or planting of poisonwood in urban areas may significantly benefit White-crowned Pigeon populations because of the availability of poisonwood fruit appears to determine how successful a nesting season will be. Blolly (Guapira discolor) and strongbark (Bourreria ovata) are also important food supplies and should be encouraged in suburban areas (Bancroft 1992).

HUNTING: In many Caribbean countries, hunted for subsistence or as a game species. Sport hunting in Caribbean countries has traditionally taken place during the breeding season when the birds are most predictable in locality. Where numbers of this species have declined significantly, reducing the season lengths or temporarily suspending hunting seasons seem a necessity. In addition, they are easily mistaken for Scaly-naped Pigeons (Columba squamosa) so, if hunting for Scaly-naped Pigeons is permitted, some White-crowned Pigeons will also be killed (Wiley 1985). Maintaining viable populations is also in the interest of hunters and the governments of these countries(Owre 1978). Interest from ecotourists and birders visiting these countries indicating their desire to see these birds along with the economic benefits of these visitors may influence the formulation of protective policies. Because most Florida White-crowned Pigeons spend part of the year outside the United States, the hunting policies of Caribbean countries may directly affect the population of birds breeding in Florida.

Monitoring Programs: Inadequately sampled by the BBS to extrapolate population trends. In addition to the methodology developed by Strong et al. (1994), the National Audubon Society has conducted a number of studies on the White-crowned Pigeon. Using a standardized counting methodology they obtained a thorough population estimate for the area east of a line running from Long Key to Cape Sable (does not include the Lower Keys) in 1991. Boat-based counts at nesting/roosting sites have been conducted. Road-based surveys were conducted between 1986 and 1991 using the BBS technique. The National Audubon Society's Christmas Bird Count has a limited ability to monitor wintering populations.

Management Research Needs: Research is needed on the effect of hydrologic changes on mangrove habitat structure in Florida Bay and how this may affect pigeon breeding. (Science Subgroup 1997).

Biological Research Needs: Better information is needed on: basic demography and causes of local population fluctuations; critical nesting and foraging habitats; movement patterns and winter distribution of large nesting populations and how this varies within and among years; habitat trends (Owre 1978, Bancroft 1992, Bancroft and Bowman 2001).

Two major facets of the ecology of Florida white-crowned pigeons remain to be studied (Bancroft 1992). First, little is known about the ecological requirements of birds on their wintering grounds. Second, more understanding of the factors that affect survivorship of adults and juveniles may be critical for the development of management plans to maintain a healthy breeding population of this bird in Florida. (Bancroft 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: This species occurs in many protected areas, including the Key Deer and Great White Heron national wildlife refuges and Everglades National Park, Florida, USA, which protects many small islands used for nesting. Foraging habitat is less well protected, though some occurs on federally and state-owned lands in Florida. The protected status of Everglades National Park has probably helped ensure the survival of white-crowned pigeons in south Florida by protecting both foraging and nesting habitats (Strong et al. 1991).

Migratory habits expose birds to different degrees of protection in various countries.

Needs: Protection needs include (1) protection of foraging and nesting habitat, including the discouragement of human and raccoon activity on mangrove nesting islands, (2) regulation of hunting and harvest pressure in Caribbean jurisdictions, and (3) in Florida, protection of poisonwood trees and the encouragement of blolly (Guapira) and strongbark (Bourreria ovata) in suburban areas as food sources (Bancroft 1992, Bancroft et al. 2000). In Florida, protection of large forest fragments, especially on southern Key Largo, should be a priority (Strong and Bancroft 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: This is an important game species in many areas outside the United States (Bancroft and Bowman 2001). Squabs have been harvested for livestock feed in the Dominican Republic (Wiley 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: Found nowhere else in the United States except extreme south Florida and the Florida Keys where they breed in coastal mangrove forests and islets. Birds depend on mangrove forests for nesting and roosting habitat and inland tropical hardwood hammocks for the fruiting trees and plants that are its main food source. The persistence of this species is threatened by loss of both habitat types due to development, dredging, and other habitat alteration. In Florida, most nesting habitat is protected by the Everglades National Park, but several remaining large patches of hammock forest, especially on the upper mainline keys, remain unprotected, and are important to the persistence of the White-crowned Pigeon in Florida. Elsewhere in its range, habitat destruction and degradation as well as hunting pressure continue to threaten its persistence.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-crowned Pigeon

The White-crowned Pigeon (Patagioenas leucocephala, formerly Columba leucocephala) is a species of bird in the family Columbidae (doves and pigeons).[2][3] It inhabits the northern and central Caribbean islands and some places on the North and Central American mainland. John James Audubon painted the pigeons, including the watercolour in his work Birds of America, published in the early 19th century.

A juvenile white-crowned pigeon, photographed in Louisville Zoo, Kentucky

The white-crowned pigeon can measure 29–35 cm (11–14 in) in length, span 48–59 cm (19–23 in) across the wings, and weigh 150–301 g (5.3–10.6 oz). It is around the same size as the common Rock Pigeon, but weighs a bit less since it is generally less chunky and has a relatively longer tail.[4][5] The adult is dark grey, with green and white bars on the nape, a brilliant white crown to the head, a white iris, and a pale-tipped red bill. Juveniles are a less dark shade of grey, lack the nape pattern and white iris, and show only a few pale feathers on the crown. The song is row of a Mourning Dove-like woo pop woooo calls; this species is a member of a diverse clade of Patagioenas which vary much in appearance, but are united by their triple coos (except in the Scaled Pigeon).[2][6]

It is a resident breeder mainly in the Bahamas, Cuba, Jamaica and Antigua. It breeds in smaller numbers in Hispaniola, Puerto Rico, the Virgin Islands, the Cayman Islands, Anguilla and other Caribbean islands. It also breeds along the Caribbean coast of Central America. In the United States it is found only in the Florida Keys and the southern tip of mainland Florida.

The main threat to this species is hunting. In Florida a major cause of mortality is collision with man-made objects. Another main threat to this species is loss of habitat. The White-crowned Pigeon needs two distinct habitats, one for nesting and one for feeding. They typically breed in coastal red mangroves (Rhizophora mangle), which continue to be clear-cut for crops such as sugarcane. Agriculture and deforestation have become a problem for the species' feeding grounds, typically inland hardwood forests. The bird is very skittish, and is known to simply abandon its nest when it is encroached upon.

Like the extinct Passenger Pigeon this species "illustrates a very important principle of conservation biology: it is not always necessary to kill the last pair of a species to force it to extinction. These birds are "threatened by the slaughter of nesting birds on its Caribbean breeding grounds."[7]

References

  1. ^ BirdLife International (2012). "Patagioenas leucocephala". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b Johnson, Kevin P.; de Kort, Selvino; Dinwoodey, Karen, Mateman, A. C.; ten Cate, Carel; Lessells, C. M. and Clayton, Dale H. (2001). "A molecular phylogeny of the dove genera Streptopelia and Columba" (PDF). Auk 118 (4): 874–887. doi:10.1642/0004-8038(2001)118[0874:AMPOTD]2.0.CO;2. 
  3. ^ Brands, S. J. "Columba leucocephala". Systema Naturae 2000. Retrieved July 22, 2005. 
  4. ^ Gibbs, David, Pigeons and Doves. A&C Black (2001), ISBN 978-1-873403-60-0
  5. ^ [1]
  6. ^ Mahler, Bettina; Tubaro, Pablo L. (2001). "Relationship between song characters and morphology in New World pigeons". Biological Journal of the Linnean Society 74 (4): 533–539. doi:10.1006/bijl.2001.0596. 
  7. ^ Ehrlich, Paul R.; Dobkin, David S.; Wheye, Darryl (1988). "The Passenger Pigeon". Stanford University. Retrieved March 3, 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: On the basis of studies by Johnson and Clayton (2000) and Johnson et al. (2001) of nuclear and mitochondrial DNA, and a review of morphological (Ridgway 1916), serological (Cumley and Irwin 1944), and behavioral (Johnston 1962) characters, we place New World pigeons formerly included in Columba in a separate genus, Patagioenas Reichenback, 1853 (AOU 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!