Articles on this page are available in 1 other language: Spanish (19) (learn more)

Overview

Distribution

Range

Lowland rainforests of se Mexico to nw Colombia (Chocó).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Columba nigrirostris
Catalog Number: USNM 148301
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Adult
Preparation: Skin: Whole
Collector(s): E. Arce
Locality: Chiriqui, Panama, North America
  • Type: Ridgway. June 29, 1915. Proc. Biol. Soc. Washington. 28: 139.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Patagioenas nigrirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTAATTTTCGGCGCATGGGCCGGCATAGTTGGCACCGCACTTAGCCTCCTCATTCGTGCAGAACTAGGACAGCCAGGTACTCTCCTAGGAGATGACCAAATCTATAATGTAATTGTTACAGCCCATGCTTTCGTAATAATCTTCTTTATGGTCATACCCATCATAATCGGAGGCTTTGGAAACTGATTGGTCCCCCTTATAATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTACTACCCCCATCCTTCCTCCTCCTCCTAGCCTCCTCCACAGTCGAAGCTGGTGCAGGAACAGGATGAACCGTTTACCCCCCTCTAGCCGGTAATCTAGCCCACGCAGGAGCCTCCGTAGACCTCGCCATCTTCTCACTCCACCTTGCTGGTGTCTCCTCTATCCTGGGGGCCATTAACTTTATCACAACTGCCATCAACATAAAACCACCAGCTCTCTCACAATACCAAACCCCTCTATTCGTATGATCAGTCCTTATCACTGCTGTCCTCCTTCTCCTATCCCTCCCAGTCCTTGCCGCCGGCATCACAATACTGCTCACAGACCGAAACCTTAACACTACCTTCTTCGACCCTGCTGGTGGAGGTGACCCAGTACTATACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Patagioenas nigrirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 50,000-499,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Short-billed pigeon

The short-billed pigeon (Patagioenas nigrirostris)[2] is a largish pigeon which breeds from southern Mexico south to northwestern Colombia. It is a member of a clade of Patagioenas that contains the smaller and rather plain species with characteristic calls[2] that constitute the subgenus Oenoenas.[3]

It is found in lowland forest canopy and semi-open woodland, and builds a rudimentary platform nest out of twigs 5–30 m (16–98 ft) high in a tree or amongst vines. It lays one white egg.

The short-billed pigeon is 26.5 cm (10.4 in) long and weighs 150 g (5.3 oz). It is unpatterned and mainly wine-purple in colour, becoming browner on the belly and more olive-brown on the back. The tail and primary flight feathers are blackish, the bill is black, and the legs and eyes are purple-red. The female is slightly duller and browner than the male, and the juvenile bird has a greyish brown head, neck and breast, with cinnamon scaling on the head and upperparts.

The short-billed pigeon has a complex, loud and high-pitched call coo... cu-COO k’CO coohoo; this is usually uttered singly or at least with considerable pauses between calls.[3] It is normally sighted in pairs as it forages in the tree tops for mistletoe, fruits and berries, but may also be seen on tracks and roadsides seeking grit or small invertebrates.

In southern Central America, this species is replaced at higher altitudes by its close relative, the very similar ruddy pigeon, Patagioenas subvinacea. They can be distinguished by the slower, more complex "song" of the short-billed pigeon.[3]

References[edit]

  1. ^ BirdLife International (2012). "Patagioenas nigrirostris". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Johnson, Kevin P.; de Kort, Selvino; Dinwoodey, Karen, Mateman, A. C.; ten Cate, Carel; Lessells, C. M. & Clayton, Dale H. (2001): A molecular phylogeny of the dove genera Streptopelia and Columba. Auk 118(4): 874-887. PDF fulltext
  3. ^ a b c Mahler, Bettina & Tubaro, Pablo L. (2001): Relationship between song characters and morphology in New World pigeons. Biol. J. Linn. Soc. 74(4): 533–539. doi:10.1006/bijl.2001.0596 (HTML abstract)
  • Stiles, F. Gary & Skutch, Alexander Frank (1989): A guide to the birds of Costa Rica. Comistock, Ithaca. ISBN 0-8014-9600-4
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!