Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Patagioenas picazuro

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATATCTAATCTTCGGCGCATGAGCCGGCATAGTTGGCACCGCACTTAGTCTCCTCATTCGCGCAGAACTAGGACAACCAGGCACTCTCCTGGGAGACGACCAAATCTACAACGTAATTGTTACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTCATACCCATCATAATCGGAGGCTTTGGAAACTGATTAGTCCCCCTTATAATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGTTTTTGACTACTACCTCCATCTTTCCTCCTTCTTCTGGCTTCTTCCACAATCGAAGCTGGTGCAGGAACAGGGTGAACCGTATACCCTCCCCTAGCCGGCAACCTAGCCCACGCAGGAGCTTCCGTAGACCTTGCCATCTTCTCCCTCCATCTTGCCGGTGTCTCTTCCATCCTAGGGGCCATCAACTTTATCACAACTGCCATTAACATAAAACCACCAGCCCTCTCACAATACCAAACCCCCCTGTTCGTATGATCAGTCCTCATCACCGCCGTCCTCCTTCTCCTATCCCTCCCAGTCCTTGCCGCCGGCATTACAATACTGCTCACAGACCGGAACCTTAACACTACCTTCTTCGACCCTGCCGGTGGAGGCGACCCAGTATTATACCAACACCTCTTCTGATTCTTTGGCCACCCTGAAGTCTACATCCTAATTTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Patagioenas picazuro

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Picazuro Pigeon

The Picazuro Pigeon (Patagioenas picazuro) is a pigeon native to South America.

Description[edit]

Patagioenas picazuro is a brown bird with white dashes on the back of its neck and darker brown wing patterns. It is similar in appearance to the Spotted Dove.

Distribution[edit]

The Picazuro Pigeon is found in Argentina, Bolivia, Brazil, Paraguay and Uruguay. It has an estimated global extent of occurrence of 5,800,000 km² and although an accurate population count has not taken place, it is believed that the species is common and the population is thought to be increasing. Picazuro Pigeons survive in a variety of habitats; from woodland and forest to agricultural land.

Diet[edit]

This species feeds mainly on the ground and like most other pigeons eats seeds and grain.

Reproduction[edit]

Picazuro Pigeons nest in every month of the year. A fragile nest is built from sticks and one egg is laid. Both parents incubate the egg. Once the egg has hatched, the chick is fed on crop milk and then regurgitated seeds.

References[edit]

  • InfoNatura: Birds, mammals, and amphibians of Latin America [web application]. 2004. Version 4.1 . Arlington, Virginia (USA): NatureServe. Available: [1]. (Accessed: April 7, 2007 ).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!