Overview

Distribution

C and E Ethiopia, Somalia (lorti)

Angola to S Kenya, south to NE half Namibia and across N South Africa (caudatus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dry open woodland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Movements and dispersal

Resident

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Coracias caudatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Coracias caudatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTACCTAATTTTCGGGGCGTGAGCGGGCATGGTTGGAACCGCCCTCAGCCTACTCATCCGCGCAGAACTCGGTCAACCAGGGACCCTACTAGGAGACGACCAGATCTACAATGTAATCGTCACTGCTCACGCCTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATCGGGGGCTTCGGAAACTGACTAGTCCCTCTTATAATTGGTGCTCCAGACATAGCATTCCCCCGTATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTTCTCCTACTAGCTTCCTCCACCGTAGAAGCTGGTGCTGGTACAGGGTGAACAGTCTACCCCCCTCTAGCCGGTAATCTAGCCCACGCTGGGGCTTCTGTGGACCTAGCCATCTTCTCCCTACACCTCGCTGGAATCTCATCAATCCTAGGCGCAATTAACTTCATTACTACTGCCATCAACATAAAACCCCCAGCCCTATCCCAATATCAAACCCCCCTATTCGTATGATCCGTGCTAATCACAGCCGTCCTACTATTACTCTCACTACCCGTCCTCGCTGCCGGCATTACAATACTCCTTACAGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAGTTCTATACCAACACCTATTCTGATTCTTTGGCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is reported to be abundant, common or frequent (del Hoyo et al. 2001).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lilac-breasted Roller

The Lilac-breasted Roller (Coracias caudatus) is a member of the roller family of birds. It is widely distributed in sub-Saharan Africa and the southern Arabian Peninsula, preferring open woodland and savanna; it is largely absent from treeless places. Usually found alone or in pairs, it perches conspicuously at the tops of trees, poles or other high vantage points from where it can spot insects, lizards, scorpions, snails, small birds and rodents moving about at ground level.[2] Nesting takes place in a natural hole in a tree where a clutch of 2–4 eggs is laid, and incubated by both parents, who are extremely aggressive in defence of their nest, taking on raptors and other birds. During the breeding season the male will rise to great heights, descending in swoops and dives, while uttering harsh, discordant cries.

The sexes are alike in coloration. Juveniles do not have the long tail feathers that adults do.

This species is the national bird of Botswana and Kenya.

References[edit]

  1. ^ BirdLife International (2012). "Coracias caudatus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Lilac-breasted Roller". Edinburgh Zoo. 2011. Retrieved 4 October 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!