Overview

Comprehensive Description

Biology

Monogonont rotifers, which include Brachionus, are cyclical parthenogens; they proliferate asexually in the laboratory forming clones, with males being much more infrequent than females.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Biogeography

Australis
Palaearctis
Nearctis
Afrotropis
Orientalis
Neotropis
Pacific

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The first time it was found by Müller (1786) indicating only the littoral zone of Denmark. The species has been reported everywhere in the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Lorica more or less pyriform, soft, dorsal and ventral plates not distinguishable, very slightly compressed dorso-laterally, smooth or stippled. Antero-dorsal lorica margin with six short spines with broad base, nearly equal in length; median spines asymmetrical, with narrow anterior part, then rounding outward and forming broad base; intermediate spines more or less symmetrical or with outer half of base larger than inner one. Antero-ventral margin with four smoothly rounded lobes, or very broad lobes with shallow, blunt spines. Posterior spines absent. Foot opening with small sub-square part dorsally and longer V-shaped part ventrally; posterior edges of foot opening obtuse. Trophi with all the characteristics of the genus, symmetrical.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Lorica length 274‒341.0 µm, width 200‒269 µm, head aperture 121‒156 µm, depth of dorsal sinus, 22‒36 µm, median antero-dorsal spines 11‒20 µm, lateral antero-dorsal spines 12‒26 µm; trophi length 42.3‒45.7 µm, rami width 39.1‒42.2 µm, fulcrum 10.6‒13.1 µm, manubrium 38.2‒45.2 µm, uncus length 22.0‒26.0 µm.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Collection specimen

neotype for Brachionus plicatilis Müller, 1786
Catalog number: NHM-2000.3020
Collection: Natural History Museum, South Kensington, London, UK
Prepared by: Ciros-Pérez, J
Sex/stage/structure: female
Preparation: Slide Preparation; Alcohol (ethanol), in vial
Specimen Count: 1

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: 189274
Collection: National Museum of Natural History, Smithsonian Institution, Washington DC, USA
Prepared by: Ciros-Pérez, J
Sex/stage/structure: female
Preparation: Slide Preparation; Microscope slide
Specimen Count: 1

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: 39729
Collection: National Museum of Natural History, Smithsonian Institution, Washington DC, USA
Prepared by: Myers, F J
Sex/stage/structure: females
Preparation: Slide Preparation; Microscope slide
Specimen Count: 6

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: 99389
Collection: National Museum of Natural History, Smithsonian Institution, Washington DC, USA
Prepared by: Turner, P N
Sex/stage/structure: females
Preparation: Slide Preparation; Microscope slide
Specimen Count: 5

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: 0005
Collection: National University of Mongolia, Ulaanbaatar, Mongolia
Prepared by: Jersabek, C D
Sex/stage/structure: females
Preparation: Slide Preparation; Microscope slide, pure Glycerine mount, NOA61 sealing, Asphaltum varnish ringing
Specimen Count: 8

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: UB154
Collection: Christian D. Jersabek, personal working collection, Salzburg, Austria
Prepared by: Jersabek, C D
Sex/stage/structure: females
Preparation: Slide Preparation; Microscope slide, pure Glycerine mount, NOA61 sealing, Asphaltum varnish ringing
Specimen Count: 4

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: UB102
Collection: Christian D. Jersabek, personal working collection, Salzburg, Austria
Prepared by: Jersabek, C D
Sex/stage/structure: females
Preparation: Slide Preparation; Microscope slide, pure Glycerine mount, NOA61 sealing, Asphaltum varnish ringing
Specimen Count: 4

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: UB101
Collection: Christian D. Jersabek, personal working collection, Salzburg, Austria
Prepared by: Jersabek, C D
Sex/stage/structure: females
Preparation: Slide Preparation; Microscope slide, pure Glycerine mount, NOA61 sealing, Asphaltum varnish ringing
Specimen Count: 4

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: UB100
Collection: Christian D. Jersabek, personal working collection, Salzburg, Austria
Prepared by: Jersabek, C D
Sex/stage/structure: females
Preparation: Slide Preparation; Microscope slide, pure Glycerine mount, NOA61 sealing, Asphaltum varnish ringing
Specimen Count: 5

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: 1047
Collection: Academy of Natural Sciences of Drexel University, Philadelphia, USA
Prepared by: Ciros-Pérez, J
Sex/stage/structure: females
Preparation: Slide Preparation
Specimen Count: 30

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: 1044
Collection: Academy of Natural Sciences of Drexel University, Philadelphia, USA
Prepared by: Ciros-Pérez, J
Sex/stage/structure: female
Preparation: Slide Preparation
Specimen Count: 1

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: 0535
Collection: Academy of Natural Sciences of Drexel University, Philadelphia, USA
Prepared by: Myers, F J
Sex/stage/structure: females
Preparation: Slide Preparation
Specimen Count: 9

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: 1106
Collection: Academy of Natural Sciences of Drexel University, Philadelphia, USA
Prepared by: Bennetch, L M
Sex/stage/structure: females
Preparation: Slide Preparation
Specimen Count: 9

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: 0282
Collection: Academy of Natural Sciences of Drexel University, Philadelphia, USA
Prepared by: Myers, F J
Sex/stage/structure: females
Preparation: Slide Preparation
Specimen Count: 4

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collection specimen

Non-type voucher specimen for Brachionus plicatilis Müller, 1786
Catalog number: 0274
Collection: Academy of Natural Sciences of Drexel University, Philadelphia, USA
Prepared by: Myers, F J
Sex/stage/structure: females
Preparation: Slide Preparation
Specimen Count: 3

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 5 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0.75

Graphical representation

Depth range (m): 0 - 0.75
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Brachionus plicatilis lives and swims in the plankton. Habitats vary from oligohaline to euryhaline, some of them are temporary while others are permanent.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

This species is herbivorous and feeds microalgae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

This species, general speaking, is cosmopolite and it has been found inhabiting several brackish and saline ponds, lagoons, lakes and marshed. Brackish or saltwater species, usually in littoral regions. Oligohaline to euryhaline, thalassic and athalassic in ponds, lagoons, lakes and marshes, also in highly alkaline soda lakes; temporary and permanent waters. Planktonic. Feeding on Cyanobacteria, unicellular algae and flagellates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brachionus plicatilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 181 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACTTTATTTTTGGAATCTGAGCTGGGCTCATTGGTCTCAGGATAAGATTCCTTATTCGTCTTGAGTTAGGGGTCGTGGGCTCTTACTTAGGTGAT---GAGCACCTTTACAATGTCTTAGTAACTGCACACGCCTTTGTAATGATTTTCTTCATAGTTATGCCTGTGTCAATGGGAGGATTTGGTAATTGGTTAATTCCTCTGATGCTAGGTGTTGCTGACATGGCTTTCCCTCGTATAAATAACTTATCCTTTTGGCTGTTAGTGCCAGCCTTTATGTTTCTTCTGTTGTCCTCCGCTATTGATGCAGGGGCCGGTACCGGTTGAACCGTGTACCCACCTTTATCGGATTCTACTTATCACGCAGGTGTTTCTGTTGATTTAGCGATTTTTAGCCTCCATCTATCTGGTATTTCTTCTATTCTAGGTAGAATTAACTTTCTTACTACTATTATTTGTTCTCGTACAAAGAGGGTCTCTTTAGACCGTCTGCCCTTGATGCTTTGAGCTATTGCTGTTACGGCTGTTCTCCTAATCACTAGACTTCCAGTGTTAGCTGGGGCTATCACAATGCTCTTAACAGATCGTAATTTTAATACTTCCTTCTTTGATCCAGCCGGTGGAGGTAACCCGGTGTTGTACCAACATCTCTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Brachionus plicatilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 196
Specimens with Barcodes: 196
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brachionus plicatilis

Brachionus plicatilis is a euryhaline (tolerate a wide range of salinity) rotifer in the Family Brachionidae, and is possibly the only commercially important rotifer, being raised in the aquaculture industry as food for fish larvae. It has a broad distribution in salt lakes around the world and has become a model system for studies in ecology and evolution.

Reproduction

Brachionus species can normally reproduce asexually and sexually (cyclical parthenogenesis). Sexual reproduction (termed Mixis) is usually induced when population density increases. Mixis in Brachionus plicatilis has been shown to be induced by a density-dependent chemical cue.[1]


Genome size

Haploid '1C' genome sizes in the Brachionus plicatilis species complex range at least from 0.056 to 0.416 pg.[2]

The complete mitochondrial genome of B. plicatilis sensu strictu NH1L has been sequenced.[3]


Cryptic species complex

DNA sequencing studies in 2002 revealed Brachionus plicatilis to be a cryptic species complex comprising approximately 10 separate species, each of which has been diverging for several million years.[4] A recent study identified 22 potential different species within the Plicatilis species complex. The species, rather than the complex, is now usually referred to as Brachionus plicatilis s. s. (sensu stricto).



List of the 22 suspected species of the B. plicatilis cryptic species complex - Species names and clade in () [5][6]

  1. * B01: B. 'Tiscar', S.? (B)
  2. * B02: unnamed, S. 6 (B)
  3. * B03: B. 'Persia', S. ? (B)
  4. * B04: B. 'Harvey', S. 14 (B)
  5. * B05: B. ibericus, S. 10 (B)
  6. * B06: B. Almenara (or MEG-2012), S. 9 (B)
  7. * B07: B. 'Towerinniensis, S. 7 (B)
  8. * B08: B. 'Coyrecupiensis', S. 8 (B)
  9. * B09: B. 'Cayman' (or B. koreanus), S. 5 (B)
  10. * B10: B. 'Cayman' (or B. koreanus), S. 5 (B)
  11. * B11: B. 'Austria', S. 4 (A)
  12. * B12: B. Nevada, S. 3 (A)
  13. * B13: B. Nevada, S. 3 (A)
  14. * B14: B. Nevada, S. 3 (A)
  15. * B15: B. plicatilis s.s., S. 1 (A)
  16. * B16: B. manjavacas, S. 2 (A)
  17. * B17: unnamed, S. 12 (C)
  18. * B18: unnamed, S. 12 (C)
  19. * B19: unnamed, S. 12 (C)
  20. * B20: B. rotundiformis, S. 11 (C)
  21. * B21: unnamed, S. ? (C)
  22. * B22: B. 'Lost', S. 13 (C)


References[edit]

  1. ^ Induction of sexual reproduction in Brachionus plicatilis (Monogononta, Rotifera) by a density-dependent chemical cue CP Stelzer, TW Snell - Limnology and Oceanography, 2003
  2. ^ Stelzer CP, Riss S and Stadler P. (2011): Genome size evolution at the speciation level: the cryptic species complex Brachionus plicatilis (Rotifera). BMC Evol Biol. 2011 Apr 7;11:90. [1]
  3. ^ Koushirou Suga, David B. Mark Welch, Yukari Tanaka, Yoshitaka Sakakura, and Atsushi Hagiwara (2008). Two Circular Chromosomes of Unequal Copy Number Make Up the Mitochondrial Genome of the Rotifer Brachionus plicatilis Mol Biol Evol (2008) 25(6): 1129-1137
  4. ^ Gómez, Africa; Manuel Serra; Gary R Carvalho; David H Lunt (2002). "Speciation in ancient cryptic species complexes: evidence from the molecular phylogeny of Brachionus plicatilis (Rotifera)". Evolution; International Journal of Organic Evolution 56 (7): 1431–44. doi:10.1111/j.0014-3820.2002.tb01455.x. ISSN 0014-3820. PMID 12206243. 
  5. ^ Extreme levels of hidden diversity in microscopic animals (Rotifera) revealed by DNA taxonomy D Fontaneto, M Kaya, EA Herniou… - Molecular Phylogenetics …, 2009 - Elsevier
  6. ^ Diversity of the rotifer Brachionus plicatilis species complex (Rotifera: Monogononta) in Iran through integrative taxonomy Reza Malekzadeh-Viayeh1,*, Razieh Pak-Tarmani1, Nasim Rostamkhani2 and Diego Fontaneto3 Article first published online: 7 JAN 2014 DOI: 10.1111/zoj.12106
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!