Overview

Distribution

European waters (ERMS scope), New Zealand Exclusive Economic Zone, Nieuwpoort, Portuguese Exclusive Economic Zone, Schelde estuary, Spanish Exclusive Economic Zone, Ukrainian Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is common everywhere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

The lorica outline is almost circular or very weakly elliptical: ratio length/width 1.05–1.20. The ventral anterior margin has a broad and shallow median sinus; the dorsal anterior margin is weakly convex to almost straight, or shows three more or less pronounced shallow lobes. In dorsal/ventral view the lorica bears a band of irregular stipples of unequal diameter laterally and caudally, which in cross-sectional view appear to be the junctures of rod-shaped structures connecting the dorsal and ventral parts of the lorica. In crosssectional view the lorica margins are more or less sharp and protruding, the dorsal margin is flat or weakly convex, and the ventral margin is broadly arched and usually higher than the dorsal one. The foot opening is circular, situated ventrally near the middle or somewhat below the middle of the lorica. The distal foot pseudosegment is relatively short and only weakly offset from the wrinkled proximal part of the foot; penultimate pseudosegment absent or indistinct. The dorsal and lateral antennae are located at almost the same height: ratio lorica length/distance antennae from antero-dorsal margin 3.25–3.55. Two red eyespots.

The trophi have 12–16/12–16 (left/right) unci teeth, with very slender and only weakly offset heads; heads of major teeth fairly small. The manubria consist of three large superimposed chambers; sub-ventral chamber vestigial. The number of arched rami scleropili is ~31–32/30–31 (left/right). The fulcrum lacks a proximal opening frontally.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Lorica length 120-350 μm, lorica width 100-236 μm, distal foot pseudosegment 15–20 μm.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 2 taxa.

Environmental ranges
  Depth range (m): 0.75 - 0.75
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Planktic species and free-swimmers. It may be associated to the crustacean Asellus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Testudinella patina is an euryhaline cosmopolitan species, common in freshwaters rich in submerged vegetation, but also regularly reported from the marine littoral, and brackish and inland saline waters

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leasi, Francesca

Source: Marine Rotifera

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Testudinella patina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGTGTAGAGTTAGGGGTTGTGGGGCCCTATCTAGCAGAT---GAGCACGTTTACAACGTGCTGGTTACAGCCCACGCTTTTATCATGATTTTTTTTATGGTAATACCGGCGGCAATCGGAGGATTTGGTAACTGGCTCATCCCGTTAATG---GTAGGCTGTGTTGATATGGTGTTTCCTCGCATAAATAATCTTTCTTTTTGATTGCTTGTACCTTCTTTTAGGCTTTTAATCTTGTCTTCATTTCTTGATTCAGGGGCTGGAACTGGGTGGACTGTTTACCCGCCGCTTTCGGATAGGGTGTATCATTCTGGTACCTCAGTCGACCTG---GCTATCTTTAGTCTTCATATTGCAGGGGCAAGGTCTATTTTAGGGTCTATTAACTTCCTTAGCACGGTTGTAGCAGCTCGTTCTTCTGCCTTCAAGTTGGACTACCTCCCATTATTTATTTGGGCAGTTAGTATTACTGCTGTTCTTCTGATTACAAGGCTTCCTGTTCTTGCTGGG---GCCATTACCATGCTCCTGACAGATCGTAATGTTAGCACCAGGTTCTTTGACCCATCTGGCGGAGGAAATCCTGTGCTATACCAACATTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Testudinella patina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!