Articles on this page are available in 2 other languages: Spanish (1), Dutch (1) (learn more)

Overview

Brief Summary

Description

Scots pine is one of only three native conifers found in the UK and our only true cone-bearing tree. Although Scots pine can trace its earliest British ancestry back to the end of the Ice Age, it is something of an anomaly in that relatively few of the trees living today are directly descended from those early colonisers. Originally forming extensive forests over most of Britain, a change in the climate to warmer temperatures some 5000 years ago favoured deciduous trees and pushed the range of the Scots pine northwards, out of most of England and Wales. In the seventeenth century, a combination of tree-felling for industrial use and the notorious Highland clearances all but eradicated the tree in northern Scotland. There was estimated to be little more than 10,000 hectares of native Scots pine forest left in Scotland by the 1970s. This tree can grow as high as 40 metres and often has a trunk that is extensively forked. The bark is reddish-brown and forms flaky plates. In common with other pines, the tree bears stiff waxy needles instead of flattened leaves. These grow in pairs from the twigs and are between five and seven centimetres long. The tree also bears its seeds in cones, small egg-shaped woody structures which appear green and resinous in their first year, later drying to produce the familiar mini-pineapple shaped pinecones from which the seeds are dispersed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Scots pines shed their pollen in May in copious amounts. The male pollen-producing flowers are located at the base of new shoots. The female cones grow at the tips of stronger new shoots and, once fertilised, ripen after two years. The needles are not shed each year but remain on the tree for two or even three years. Their waxy coating protects against excessive water-loss and the needles have fewer pores than the leaves of deciduous trees. Pines seal damage to their trunks and branches by producing resin; a sticky, viscose secretion that protects the tree against entry by insects and fungal spores. This resin sometimes traps unwary creatures and preserves them. When this resin becomes hard it forms amber, sometimes surviving for millions of years, and can provide a unique record of the insect life that lived in the ancient pine forests. Artists and craftsmen have also found pine a useful source of raw materials. The resin can be refined and the volatile component, turpentine, is used as a solvent. The remaining constituent, rosin, has been used to coat zinc or copper plates used in printing engraved images, and for dressing violin bows. The timber, though classified as 'softwood', is strong and used for a huge range of products, from house and boat-building to furniture, toys and railway sleepers. Once treated with preservative, it weathers well and lasts for years. Many square hectares of pine forest are planted each year to supply industry with timber. The sweet fragrance of pine has even found its way into our homes in the form of scented cleaning products!
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

The Scots pine is the only pine species native to Northern Europe. These pines can live for centuries. In 2006, one of the oldest known Scots pines (estimated age between 355 and 405 years) fell to the ground in the town of Wolfheze (Province of Gelderland). However in the wadden region, these trees are usually cut down after 80 to 120 years. There is too much salty wind for them to reach a ripe old age. Scots pine is the only native pine to northern Europe. It requires so little food that it even grows on humus-poor wind-blown sand. You find them mostly on the sheltered side of dune woods.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Comments

This introduced pine is often cultivated because of its evergreen foliage and decorative seed cones. Large specimens of this species, in particular, have orange-red bark along the upper trunk and larger branches that is especially striking. The length of the needle-like leaves is rather variable across different specimens; young fast-growing trees tend to have longer leaves than older slow-growing trees. Different varieties of Scots Pine have been described in Eurasia; the description here applies to the typical variety (var. sylvestris). In North America, this is the variety of Scots Pine that is commonly encountered among the various cultivars. Scots Pine can be distinguished from other Pinus spp. (Pines) from a combination of the following characteristics
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Description

This tree is 50-100' tall at maturity, consisting of a single trunk and a rather broad irregular crown. The trunk is often crooked, but sometimes it is straight. The crown can be conical-ovoid to ovoid in shape with widely spreading to ascending lateral branches. The density of these branches varies with the growth of the tree. Trunk bark at the base is reddish gray and shallowly furrowed or fissured, while the thin bark of the upper trunk and major branches is orange-red and flaky. Young twigs are light brown and covered with needle-like leaves, but they become more gray and scaly in appearance with age. The needle-like leaves occur in clusters of 2 along the twigs; they are 1¼–3½' long, gray-green or blue-green, and twisted. The leaves are evergreen, remaining on the tree for 2-7 years (a shorter period of time for warm climates as opposed to cold climates). The upper surface of each leaf is slightly concave, while the lower surface is convex; there are 4-6 white lines that run along the length of the lower surface.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Distribution

Range

Scots pine ranges across Europe and Asia, from the Iberian peninsular and Turkey in the south to the edge of the Siberian tundra. It has also been introduced to other countries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Scots pine is the most widely distributed pine in the world. It's
native range includes Scotland, Scandinavia (excluding Denmark),
northern Europe, and northern Asia. It is introduced in many areas in
the United States and Canada, and is naturalized in the Northeast and in
the Great Lakes states [29,32,42].
  • 32. Little, Elbert L., Jr. 1979. Checklist of United States trees (native and naturalized). Agric. Handb. 541. Washington, DC: U.S. Department of Agriculture, Forest Service. 375 p. [2952]
  • 29. Kudish, Michael. 1992. Adirondack upland flora: an ecological perspective. Saranac, NY: The Chauncy Press. 320 p. [19376]
  • 42. Skilling, Darroll D. 1990. Pinus sylvestris L. Scots pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 489-496. [13409]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

Scots Pine has naturalized in only a few counties in Illinois, where it is uncommon (see Distribution Map). These naturalized populations tend to persist only in sandy areas. Typical habitats include sandy upland forests, sandy savannas, upland rocky woodlands, and open disturbed areas near cities and suburbs. Sometimes Scots Pine can be found in tree plantations and it is often used as a landscape plant. This tree was introduced into the United States from Eurasia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

CT DE HI IL IN IA ME MA MI MN
NH NJ NY OH PA RI VT WI NB NF
NS ON PE PQ

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Pinus sylvestris L.:
United States (North America)
China (Asia)
Russian Federation (Asia)
Kazakhstan (Asia)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Heilongjiang, Jilin, N Nei Mongol; cultivated in Beijing Shi, Liaoning (Gai Xian) [Kazakhstan, N Mongolia, Russia; SW Asia, Europe]
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Description

Trees to 40 m tall; bark red-brown, flaking; branchlets dark gray-brown; winter buds red-brown or pale to yellowish brown, ovoid to oblong-ovoid, resinous. Needles 2 per bundle, blue-green, semiorbicular in cross section, (0.5-)3-14 cm × 1-2 mm, stiff, stomatal lines present on all surfaces, vascular bundles 2, resin canals 6-8, marginal, base usually twisted, with persistent sheath. Seed cones dull yellow-brown at maturity, conical-ovoid, 3-6 cm. Apophyses broadly rhombic, flat or shortly pyramidal; umbo small, blunt or mucronate.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

More info for the term: tree

Scots pine is an exotic, medium-sized, two-needle pine. Height at
maturity usually ranges from 50 to 100 feet (15-30 m) [18,42]. The
crown is open and spreading. Needles range from 1.8 to 3.6 inches
(4.5-9.0 cm) in length [57]. The bark is relatively thin [18,57]. A
taproot is frequently developed on sandy soils, but is not a universal
trait for Scots pine. The depth of the taproot ranges from 4.9 to 9.8
feet (1.5-3.0 m), but most of the roots are horizontal and within 7.8
inches (20 cm) of the soil surface [42]. A population of middle-aged
Scots pine in Finland had numerous root grafts between neighboring
trees in networks of up to ten trees. Water and nutrients are
transferred from one tree to another through the grafts (Yli-Vakkuri in
[9]).

Scots pine is long-lived; individuals of nearly 1,000 years of age
occur in northern Sweden [59]. Ages of 200 and 400 years are common in
Scandinavia [22].
  • 9. Cooper, Charles F. 1960. Changes in vegetation, structure, and growth of Southwestern pine forests since white settlement. Ecological Monographs. 30(2): 129-164. [3927]
  • 18. Moran, G. F.; Marshall, D. R.; Muller, W. J. 1981. Phenotypic variation and plasticity in the colonizing species Xanthium strumarium L. (Noogoora Burr). Australian Journal of Biological Science. 34: 639-648. [20392]
  • 22. Jones, E. W. 1945. The structure and reproduction of the virgin forest of the north temperate zone. New Phytologist. 44: 130-148. [10229]
  • 42. Skilling, Darroll D. 1990. Pinus sylvestris L. Scots pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 489-496. [13409]
  • 57. Welsh, Stanley L.; Atwood, N. Duane; Goodrich, Sherel; Higgins, Larry C., eds. 1987. A Utah flora. Great Basin Naturalist Memoir No. 9. Provo, UT: Brigham Young University. 894 p. [2944]
  • 59. Zackrisson, Olle. 1980. Forest fire history: ecological significance and dating problems in the north Swedish boreal forest. In: Stokes, Marvin A.; Dieterich, John H., technical coordinators. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 120-125. [16052]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Tree, Evergreen, Monoecious, Habit erect, Trees without or rarely having knees, Tree with bark rough or scaly, Young shoots 3-dimensional, Buds resinous, Leaves needle-like, Leaves alternate, Needle-like leaf margins entire (use magnification), Needle-like leaf margins finely serrulate (use magnification or slide your finger along the leaf), Leaf apex acute, Leaves < 5 cm long, Leaves > 5 cm long, Leaves < 10 cm long, Leaves grey-green, Leaves blue-green, Leaves not blue-green, Leaves white-striped, Needle-like leaves somewhat rounded, Needle-like leaves not twisted, Needle-like leaf habit erect, Needle-like leaves per fascicle mostly 2, Needle-like leaf sheath early deciduous, Needle-like leaf sheath persistent, Twigs glabrous, Twigs viscid, Twigs not viscid, Twigs without peg-like projections or large fascicles after needles fall, Berry-like cones orange, Woody seed cones < 5 cm long, Woody seed cones > 5 cm long, Seed cones bearing a scarlike umbo, Umbo with missing or very weak prickle, Umbo with obvious prickle, Bracts of seed cone included, Seeds black, Seeds gray, Seeds winged, Seeds unequally winged, Seed wings prominent, Seed wings equal to or broader than body.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Stephen C. Meyers

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Ecology

Habitat

Mountains, river basins, dry rocky slopes; 400-1600 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Habitat characteristics

More info for the term: peat

Scots pine is found from sea level to 8,000 feet (2,440 m) elevation,
and grows on a wide variety of soils including peat, though growth on
peat usually results in stunted trees [42]. Growth is best on
well-drained soils [29]. Soil pH ranges from 4.0 to 7.0, but growth is
best between 4.5 and 6.0 [42,56].

Where it is naturalized in northern New York, Scots pine is associated
with black cherry (Prunus serotina), red maple (Acer rubrum), sugar
maple (A. saccharum), American beech (Fagus grandifolia), quaking aspen
(Populus tremuloides), and eastern white pine [42].
  • 29. Kudish, Michael. 1992. Adirondack upland flora: an ecological perspective. Saranac, NY: The Chauncy Press. 320 p. [19376]
  • 42. Skilling, Darroll D. 1990. Pinus sylvestris L. Scots pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 489-496. [13409]
  • 56. Vogel, Willis G. 1981. A guide for revegetating coal minespoils in the eastern United States. Gen. Tech. Rep. NE-68. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 190 p. [15577]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White - red - jack pine
FRES11 Spruce - fir
FRES15 Oak - hickory
FRES18 Maple - beech - birch
FRES19 Aspen - birch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

Scots Pine has naturalized in only a few counties in Illinois, where it is uncommon (see Distribution Map). These naturalized populations tend to persist only in sandy areas. Typical habitats include sandy upland forests, sandy savannas, upland rocky woodlands, and open disturbed areas near cities and suburbs. Sometimes Scots Pine can be found in tree plantations and it is often used as a landscape plant. This tree was introduced into the United States from Eurasia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Key Plant Community Associations

In Europe and Asia, Scots pine forms a boreal forest type with Norway
spruce (Picea abies). Scots pine is listed as a dominant species in
the following classification: Forest types and their significance [7].
  • 7. Cajander, A. K. 1949. Forest types and their significance. Acta Forestalia Fennica. 56: 1-105. [22657]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The tree prefers light sandy soils and lower altitudes. It has been planted as a windbreak in some regions, notably the East Anglian Breckland. It does not like areas with high rainfall or sea winds.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Foodplant / internal feeder
larva of Acanthocinus aedilis feeds within dead wood of Pinus sylvestris (native Scottish form)
Other: major host/prey

In Great Britain and/or Ireland:
Foodplant / web feeder
communal larva of Acantholyda erythrocephala feeds from web on needles of Pinus sylvestris (native Scottish form)
Other: major host/prey

Foodplant / internal feeder
larva of Anastrangalia sanguinolenta feeds within dead wood of Pinus sylvestris (native Scottish form)
Other: major host/prey

Plant / associate
fruitbody of Calocybe onychina is associated with Pinus sylvestris (native Scottish form)
Other: sole host/prey

Foodplant / saprobe
fruitbody of Chrysomphalina chrysophylla is saprobic on decayed wood of Pinus sylvestris (native Scottish form)

Foodplant / saprobe
fruitbody of Collybia acervata is saprobic on decaying litter of Pinus sylvestris (native Scottish form)

Foodplant / saprobe
fruitbody of Collybia putilla is saprobic on decayed litter of Pinus sylvestris (native Scottish form)

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius caledoniensis is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius crassus is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius fervidus is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius gentilis is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius microspermus is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius venustus is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Plant / associate
fruitbody of Galerina septentrionalis is associated with Pinus sylvestris (native Scottish form)

Foodplant / open feeder
larva of Gilpinia frutetorum grazes on needle of Pinus sylvestris (native Scottish form)
Other: sole host/prey

Foodplant / open feeder
larva of Gilpinia pallida grazes on needle of Pinus sylvestris (native Scottish form)
Other: sole host/prey

Plant / associate
fruitbody of Hebeloma cylindrosporum is associated with Pinus sylvestris (native Scottish form)

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Hydnellum aurantiacum is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Hydnellum caeruleum is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Hydnellum peckii is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / web feeder
communal larva of Itycorsia posticalis feeds from web on needles of Pinus sylvestris (native Scottish form)
Other: major host/prey

Foodplant / saprobe
fruitbody of Kuehneromyces lignicola is saprobic on decayed, dead sawdust of Pinus sylvestris (native Scottish form)
Remarks: season: usu Spring

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Lactarius musteus is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain
Other: sole host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Lactarius sphagneti is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain
Other: sole host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Leccinum vulpinum is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain
Other: sole host/prey

Foodplant / internal feeder
larva of Magdalis duplicata feeds within dead branch of Pinus sylvestris (native Scottish form)

Foodplant / feeds on
Magdalis phlegmatica feeds on dead branch of Pinus sylvestris (native Scottish form)

Foodplant / open feeder
larva of Microdiprion pallipes grazes on needle of Pinus sylvestris (native Scottish form)
Other: sole host/prey

Foodplant / saprobe
toadstool of Mycena urania is saprobic on dead, fallen, decaying leaf of litter of Pinus sylvestris (native Scottish form)
Other: sole host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Phellodon atratus is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain
Other: sole host/prey

Foodplant / saprobe
fruitbody of Phlebia segregata is saprobic on dead, decayed wood of Pinus sylvestris (native Scottish form)

Foodplant / saprobe
fruitbody of Pholiota pinicola is saprobic on dead, decayed wood of Pinus sylvestris (native Scottish form)
Other: sole host/prey

Foodplant / saprobe
fruitbody of Pholiota subochracea is saprobic on dead, decayed wood of Pinus sylvestris (native Scottish form)

Foodplant / saprobe
fruitbody of Repetobasidium mirificum is saprobic on dead, decayed wood of Pinus sylvestris (native Scottish form)

Plant / associate
imago of Rhagium inquisitor is associated with dead log of Pinus sylvestris (native Scottish form)
Remarks: season: 6-8

Foodplant / feeds on
Rhyncolus ater feeds on dead wood of Pinus sylvestris (native Scottish form)
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Rozites caperatus is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Russula decolorans is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Russula integra is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
large fruitbody of Russula postiana is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Sarcodon glaucopus is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / saprobe
fruitbody of Skeletocutis subincarnata is saprobic on dead, decayed wood of Pinus sylvestris (native Scottish form)
Other: sole host/prey

Foodplant / saprobe
fruitbody of Stagnicola perplexa is saprobic on buried (often deeply) woodchip of Pinus sylvestris (native Scottish form)

Foodplant / saprobe
fruitbody of Stereopsis vitellina is saprobic on dead, decayed wood of Pinus sylvestris (native Scottish form)

Foodplant / saprobe
fruitbody of Stropharia hornemannii is saprobic on dead, decayed wood of Pinus sylvestris (native Scottish form)

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma arvernense is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma colossus is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma focale is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma nauseosum is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma pessundatum is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma robustum is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma vinaceogriseum is ectomycorrhizal with live root of Pinus sylvestris (native Scottish form)
Remarks: Other: uncertain

Foodplant / saprobe
Tubulicrinis angustus is saprobic on dead, decayed wood of Pinus sylvestris (native Scottish form)

Foodplant / saprobe
fruitbody of Xeromphalina cauticinalis is saprobic on dead, fallen, decayed needle of litter of Pinus sylvestris (native Scottish form)
Other: major host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Foodplant / web feeder
communal larva of Acantholyda erythrocephala feeds from web on needle of Pinus sylvestris

Foodplant / sap sucker
nymph of Acompocoris pygmaeus sucks sap of Pinus sylvestris
Other: major host/prey

Plant / associate
Alloeotomus gothicus is associated with Pinus sylvestris

In Great Britain and/or Ireland:
Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Amanita gemmata is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Amanita porphyria is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Amanita rubescens var. annulosulphurea is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: minor host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Amanita rubescens var. rubescens is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: minor host/prey

Plant / associate
Anthonomus varians is associated with Pinus sylvestris

Foodplant / saprobe
clypeate perithecium of Anthostomella conorum is saprobic on dead needle of Pinus sylvestris
Remarks: season: 3-8

Foodplant / saprobe
immersed perithecium of Anthostomella formosa is saprobic on fallen, dead needle of Pinus sylvestris
Remarks: season: 2-9

Foodplant / saprobe
immersed perithecium of Anthostomella pedemontana is saprobic on fallen, dead needle of Pinus sylvestris

Plant / epiphyte
fruitbody of Antrodia ramentacea grows on large, partially fallen and decorticated branch (large) of Pinus sylvestris
Other: sole host/prey

Foodplant / saprobe
effuse colony of Anungitea dematiaceous anamorph of Anungitea continua is saprobic on dead, fallen needle of Pinus sylvestris

Foodplant / saprobe
erumpent, then superficial, solitary or caespitose pycnidium of Aposphaeria coelomycetous anamorph of Aposphaeria mediella is saprobic on dead bark of Pinus sylvestris
Remarks: season: 5

Foodplant / sap sucker
nymph of Aradus cinnamomeus sucks sap of upto 25 year old of Pinus sylvestris

Foodplant / pathogen
Armillaria mellea s.l. infects and damages Pinus sylvestris

Foodplant / saprobe
effuse, thin colony of Ascocorticium anomalum is saprobic on fallen log of Pinus sylvestris
Remarks: season: 9-1

Foodplant / saprobe
fruitbody of Athelopsis baculifera is saprobic on fallen branch of Pinus sylvestris

Foodplant / saprobe
fruitbody of Auriscalpium vulgare is saprobic on decayed, buried or partly buried cone of Pinus sylvestris
Other: major host/prey

Plant / associate
fruitbody of Bankera fuligineoalba is associated with needle litter of Pinus sylvestris

Foodplant / saprobe
effuse colony of Belemnospora dematiaceous anamorph of Belemnospora pinicola is saprobic on dead needle of Pinus sylvestris
Remarks: season: 5-7

Foodplant / saprobe
sporodochium of Bloxamia anamorph of Bloxamia bohemica is saprobic on rotting needle of Pinus sylvestris
Remarks: season: 10-11

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Boletus badius is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: sole host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Boletus luridiformis var. luridiformis is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Boletus pinophilus is ectomycorrhizal with live root of Pinus sylvestris
Other: sole host/prey

Foodplant / saprobe
fruitbody of Botryobasidium ellipsosporum is saprobic on decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Botryobasidium intertextum is saprobic on decayed bark of Pinus sylvestris

Foodplant / saprobe
fruitbody of Botryobasidium laeve is saprobic on decayed wood of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
fruitbody of Botryobasidium obtusisporum is saprobic on decayed wood of Pinus sylvestris
Remarks: Other: uncertain

Fungus / saprobe
fruitbody of Botryohypochnus isabellinus is saprobic on decayed wood of Pinus sylvestris
Other: minor host/prey

Plant / associate
Brachonyx pineti is associated with Pinus sylvestris

Foodplant / saprobe
immersed perithecium of Camarops tubulina is saprobic on decorticate wood of Pinus sylvestris

Fungus / saprobe
erumpent pycnidium of Camarosporium coelomycetous anamorph of Camarosporium pini is saprobic on fallen cone of Pinus sylvestris
Remarks: season: 1-5

Plant / associate
fruitbody of Cantharellus aurora is associated with root of Pinus sylvestris
Other: major host/prey

Plant / associate
Cardiastethus fasciiventris is associated with Pinus sylvestris

Foodplant / saprobe
basidiome of Ceraceomyces sublaevis is saprobic on dead, decayed wood of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
basidiome of Ceraceomyces tessulatus is saprobic on dead, decayed cone of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
basidiome of Ceratellopsis acuminata is saprobic on dead, decayed needle of Pinus sylvestris

Foodplant / saprobe
basidiome of Ceriporia viridans is saprobic on decayed wood of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
basidiome of Ceriporiopsis gilvescens is saprobic on decayed wood of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
effuse colony of Chalara dematiaceous anamorph of Chalara affinis is saprobic on fallen, rotting needle of Pinus sylvestris
Remarks: season: 10-7

Foodplant / saprobe
colony of Chalara dematiaceous anamorph of Chalara cylindrosperma is saprobic on rotting needle of Pinus sylvestris
Remarks: season: 10-2

Foodplant / saprobe
effuse colony of Chalara dematiaceous anamorph of Chalara fusidioides is saprobic on dead needle of Pinus sylvestris

Foodplant / saprobe
sporodochium of Cheiromycella dematiaceous anamorph of Cheiromycella microscopica is saprobic on dead wood of Pinus sylvestris
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Chroogomphus rutilus is ectomycorrhizal with live root of Pinus sylvestris

Foodplant / saprobe
fruitbody of Chrysomphalina grossula is saprobic on decayed, large log of Pinus sylvestris
Other: major host/prey

Foodplant / feeds on
larva of Cimberis attelaboides feeds on male catkin (feeds on pollen) of Pinus sylvestris
Other: sole host/prey

Foodplant / sap sucker
Cinara pinea sucks sap of Pinus sylvestris

Foodplant / saprobe
erumpent, solitary apothecium of Cistella acuum is saprobic on dead, especially still attached to cut off branches needle of Pinus sylvestris
Remarks: season: 9-3

Foodplant / saprobe
effuse colony of Cladasporium dematiaceous anamorph of Cladosporium staurophorum is saprobic on decaying, fallen needle of Pinus sylvestris

Foodplant / saprobe
effuse colony of Clonostachys anamorph of Clonostachys compactiuscula is saprobic on dead needle of Pinus sylvestris

Foodplant / parasite
aecium of Coleosporium asterum parasitises live Pinus sylvestris

Foodplant / parasite
pycnium of Coleosporium tussilaginis parasitises live needle of Pinus sylvestris

Foodplant / pathogen
fruitbody of Collybia fusipes infects and damages live root of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
superficial perithecium of Coniochaeta malacotricha is saprobic on dead branch of Pinus sylvestris
Remarks: season: 3-6

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius armillatus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius callisteus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius collinitus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius corrosus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius cyanites is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius diosmus is ectomycorrhizal with live root of Pinus sylvestris

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius evernius is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius fulvescens is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius ionophyllus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius limonius is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius malachius is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius malicorius is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius pearsonii is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius poppyzon is ectomycorrhizal with live root of Pinus sylvestris

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius rubellus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius scaurus var. scaurus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius tabacinus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Cortinarius violilamellatus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / pathogen
perennial mycelium of Cronartium flaccidum infects and damages live branch (cortex) of Pinus sylvestris

Foodplant / saprobe
fruitbody of Crustomyces subabruptus is saprobic on fallen, decayed trunk (large) of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
short-stalked apothecium of Cudoniella rubicunda is saprobic on fallen, dead cone of Pinus sylvestris

Fungus / saprobe
subepidermal, then exposed apothecium of Cyclaneusma minus is saprobic on fallen needle of Pinus sylvestris
Remarks: season: 11-5

Plant / associate
fruitbody of Cystoderma granulosum is associated with Pinus sylvestris

Fungus / saprobe
superficial, shortly-stalked apothecium of Cystopezizella venceslai is saprobic on decorticate, dead log of Pinus sylvestris
Remarks: season: 10

Foodplant / saprobe
scattered, immersed, up to 2mm diam. stroma of Cytospora coelomycetous anamorph of Cytospora pini is saprobic on dead bark of Pinus sylvestris
Remarks: season: 11

Foodplant / saprobe
erumpent, rather crowded, in irregular lines, oblong, 1-6 chambered, black, pycnidial stroma of Amphorula coelomycetous anamorph of Cytotriplospora pini is saprobic on dead branch of Pinus sylvestris
Remarks: season: 1-5

Foodplant / saprobe
fruitbody of Dacrymyces chrysocomus is saprobic on decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Dacrymyces chrysospermus is saprobic on decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Dacrymyces estonicus is saprobic on decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Dacrymyces macnabbii is saprobic on decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Dacrymyces ovisporus is saprobic on fallen, decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Dacrymyces variisporus is saprobic on decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Dacryobolus sudans is saprobic on decayed wood of Pinus sylvestris

Foodplant / saprobe
colony of Dendrodochium anamorph of Dendrodochium citrinum is saprobic on dead needle of Pinus sylvestris
Remarks: season: 8-4
Other: minor host/prey

Foodplant / saprobe
Verticladium dematiaceous anamorph of Desmazierella acicola is saprobic on dead, fallen, blackened, decaying needle of Pinus sylvestris
Remarks: season: 1-12

Foodplant / saprobe
erumpent pycnidium of Phomopsis coelomycetous anamorph of Diaporthe eres is saprobic on dead needle of Pinus sylvestris

Foodplant / feeds on
gregarious, subepidermal then erumpent through cleft epidermis, dull black pycnidium of Diplodina coelomycetous anamorph of Diplodina strobi feeds on needle of Pinus sylvestris
Remarks: season: 1-5
Other: uncertain

Foodplant / saprobe
fruitbody of Diplomitoporus flavescens is saprobic on fence post of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Diplomitoporus lindbladii is saprobic on fallen, dead log (large) of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Ditiola peziziformis is saprobic on decayed wood of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
crowded apothecium of Durella suecica is saprobic on cone scale of Pinus sylvestris
Remarks: season: 5

Foodplant / sap sucker
nymph of Elatophilus nigricornis sucks sap of needle (young, base) of Pinus sylvestris

Foodplant / gall
aecium of Endocronartium pini causes gall of live, cankered, resin coated branch of Pinus sylvestris
Remarks: season: spring-early summer

Foodplant / saprobe
effuse colony of Endophragmiella dematiaceous anamorph of Endophragmiella pinicola is saprobic on dead needle of Pinus sylvestris
Remarks: season: 3-9

Foodplant / saprobe
fruitbody of Erastia salmonicolor is saprobic on dead, fallen, decayed trunk of Pinus sylvestris

Foodplant / saprobe
fruitbody of Exidia saccharina is saprobic on dead, attached branch of Pinus sylvestris

Foodplant / saprobe
fruitbody of Fomitopsis pinicola is saprobic on dead log (large) of Pinus sylvestris

Fungus / saprobe
superficial conidioma of Fujimyces coelomycetous anamorph of Fujimyces o is saprobic on dead, fallen cone scale of Pinus sylvestris

Foodplant / saprobe
gregarious, +- oblong, conical, immersed, then erumpent, spuriously multilocular stroma of Fusicoccum coelomycetous anamorph of Fusicoccum bacillare is saprobic on dead bark of Pinus sylvestris
Remarks: season: 1-4

Foodplant / sap sucker
nymph of Gastrodes grossipes sucks sap of Pinus sylvestris

Plant / associate
fruitbody of Geastrum quadrifidum is associated with Pinus sylvestris
Other: minor host/prey

Foodplant / open feeder
larva of Gilpinia virens grazes on needle of Pinus sylvestris
Other: sole host/prey

Foodplant / saprobe
fruitbody of Gloeoporus taxicola is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Gomphidius glutinosus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Gomphidius roseus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / pathogen
Brunchorstia anamorph of Gremmeniella abietina infects and damages live twig of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Guepiniopsis alpina is saprobic on dead, decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Gymnopilus stabilis is saprobic on decayed wood of Pinus sylvestris

Foodplant / saprobe
apothecium of Hamatocanthoscypha laricionis is saprobic on dead, fallen needle of Pinus sylvestris
Remarks: season: 9-6

Plant / associate
fruitbody of Hebeloma birrum is associated with Pinus sylvestris

Plant / associate
fruitbody of Hebelomina neerlandica is associated with Pinus sylvestris

Foodplant / saprobe
Infundibura conidial anamorph of Helicogloea angustispora is saprobic on dead, fallen, decayed needle of litter of Pinus sylvestris

Foodplant / saprobe
Helicogloea farinacea is saprobic on dead, decayed wood of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
Helicogloea lagerheimii is saprobic on dead, fallen, decayed wood of Pinus sylvestris
Other: unusual host/prey

Fungus / saprobe
pycnidium of Hendersonia coelomycetous anamorph of Hendersonia acicola is saprobic on dead needle of Pinus sylvestris

Foodplant / saprobe
stalked apothecium of Heyderia pusilla is saprobic on dead, fallen needle of Pinus sylvestris
Remarks: season: 9-11

Foodplant / saprobe
fruitbody of Hohenbuehelia atrocaerulea is saprobic on dead, decayed wood of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
discrete or effuse colony of Hormiactella dematiaceous anamorph of Hormiactella asetosa is saprobic on bark of Pinus sylvestris
Remarks: season: 3-9
Other: minor host/prey

Foodplant / saprobe
effuse colony of Hormiactella dematiaceous anamorph of Hormiactella fusca is saprobic on dead bark of Pinus sylvestris
Remarks: season: 5

Foodplant / saprobe
apothecium of Hyaloscypha aureliella is saprobic on wood of Pinus sylvestris
Remarks: season: 7-11

Foodplant / saprobe
apothecium of Hyaloscypha leuconica is saprobic on old, fallen cone of Pinus sylvestris
Remarks: season: 11-3

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Hydnellum concrescens is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Hydnellum ferrugineum is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Hydnellum scrobiculatum is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / internal feeder
larva of Hylobius abietis feeds within dead stump of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
short stalked apothecium of Hymenoscyphus lutescens is saprobic on fallen cone (scale) of Pinus sylvestris
Remarks: season: 7-9

Fungus / saprobe
superficial, stalked apothecium of Hymenoscyphus perplexus is saprobic on rotten trunk of Pinus sylvestris
Remarks: season: 10

Foodplant / saprobe
fruitbody of Hyphodontia spathulata is saprobic on dead, burnt wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Hypochnicium bombycinum is saprobic on dead, fallen, decayed wood of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
fruitbody of Hypochnicium erikssonii is saprobic on dead, fallen, decayed wood of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
fruitbody of Hypochnicium geogenium is saprobic on dead, fallen, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Inocybe melanopoda is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Inocybe subcarpta is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Inocybe xanthomelas is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: minor host/prey

Foodplant / saprobe
fruitbody of Irpicodon pendulus is saprobic on dead, standing trunk of Pinus sylvestris

Foodplant / saprobe
fruitbody of Ischnoderma resinosum is saprobic on dead wood of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
fruitbody of Jaapia ochroleuca is saprobic on decayed, dead wood of Pinus sylvestris

Foodplant / saprobe
effuse colony of Junctospora anamorph of Junctospora pulchra is saprobic on rotting needle of Pinus sylvestris
Remarks: season: 6-11

Foodplant / saprobe
erumpent, becoming superficial pseudothecium of Keissleriella pinicola is saprobic on decorticate wood of Pinus sylvestris
Remarks: season: 12-3

Foodplant / saprobe
superficial pseudothecium of Kriegeriella mirabilis is saprobic on dead, fallen needle of Pinus sylvestris
Remarks: season: 11-4

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Laccaria laccata is ectomycorrhizal with live root of young tree of Pinus sylvestris

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Laccaria proxima is ectomycorrhizal with live root of young tree of Pinus sylvestris

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Laccaria pumila is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / saprobe
erumpent, often clustered apothecium of Lachnellula subtilissima is saprobic on fallen twig of Pinus sylvestris
Remarks: season: 1-7

Foodplant / saprobe
apothecium of Lachnum pulverulentum is saprobic on dead, fallen needle of Pinus sylvestris
Remarks: season: 3-9

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Lactarius quieticolor is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Lactarius repraesentaneus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Leccinum vulpinum is ectomycorrhizal with live root of Pinus sylvestris

Foodplant / saprobe
Lemalis coelomycetous anamorph of Lemalis aurea is saprobic on dead debris of Pinus sylvestris

Foodplant / sap sucker
nymph of Leptoglossus occidentalis sucks sap of unripe seed (in 1-year old cone) of Pinus sylvestris
Remarks: season: 5-8
Other: major host/prey

Foodplant / saprobe
effuse colony of Leptographium dematiaceous anamorph of Leptographium lundbergii is saprobic on dead, strongly blued wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Leptosporomyces septentrionalis is saprobic on dead, decayed bark of Pinus sylvestris

Plant / associate
fruitbody of Leucogaster liosporus is associated with Pinus sylvestris

Foodplant / saprobe
erumpent through stellately fissured periderm stroma of Cytospora coelomyceteous anamorph of Leucostoma curreyi is saprobic on dead cone of Pinus sylvestris
Remarks: season: 1-3

Foodplant / saprobe
hysterothecium of Lophium mytilinum is saprobic on twig of Pinus sylvestris
Remarks: season: 7-8

Foodplant / spot causer
apothecium of Lophodermella conjuncta causes spots on live needle of Pinus sylvestris

Fungus / saprobe
immersed conidioma of Leptostroma coelomycetous anamorph of Lophodermium conigenum is saprobic on fallen cone of Pinus sylvestris
Remarks: season: 10-11
Other: major host/prey

Fungus / saprobe
immersed conidioma of Leptostroma coelomycetous anamorph of Lophodermium pini-excelsae is saprobic on needle of Pinus sylvestris
Other: minor host/prey

Fungus / saprobe
immersed conidioma of Leptostroma coelomycetous anamorph of Lophodermium seditiosum is saprobic on attached needle of Pinus sylvestris

Plant / resting place / on
erumpent apothecium of Loxospora elatina may be found on bark of Pinus sylvestris

Foodplant / saprobe
fruitbody of Luellia cystidiata is saprobic on dead, decayed wood of Pinus sylvestris

Foodplant / feeds on
scattered to subgregarious, immersed pycnidium of Macrophoma coelomycetous anamorph of Macrophoma strobi feeds on leaf of Pinus sylvestris
Remarks: season: 1-6

Foodplant / feeds on
Magdalis memnonia feeds on dead branch of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Marasmius rotula is saprobic on dead, buried twig of Pinus sylvestris
Other: unusual host/prey

Foodplant / parasite
subcuticular or partially subepidermal pycnium of Melampsora populnea parasitises live needle of Pinus sylvestris
Remarks: season: 5-6
Other: minor host/prey

Foodplant / saprobe
superficial, clustered perithecium of Melanospora chionea is saprobic on fallen, dead needle of Pinus sylvestris
Remarks: season: 4-10

Fungus / saprobe
subepidermal, then exposed apothecium of Meloderma desmazieri is saprobic on needle of Pinus sylvestris

Fungus / saprobe
conidioma of Sporonema coelomycetous anamorph of Micraspis strobilina is saprobic on fallen cone (apophysis) of Pinus sylvestris
Remarks: season: 2-3

Foodplant / saprobe
fruitbody of Micromphale perforans is saprobic on dead, fallen, decayed needle of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
thyriothecium of Microthyrium pinophyllum is saprobic on decaying needle of Pinus sylvestris
Remarks: season: 2-4

Foodplant / saprobe
sessile apothecium of Mollisia fallax is saprobic on old cone of Pinus sylvestris
Remarks: season: 5-11

Foodplant / internal feeder
larva of Monochamus sartor feeds within dead, fallen branch of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
fruitbody of Mucronella calva is saprobic on dead, fallen, decayed log of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Mycena cinerella is saprobic on dead, decayed needle of litter of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Mycena clavicularis is saprobic on dead, fallen, decaying litter of Pinus sylvestris

Foodplant / saprobe
fruitbody of Mycena epipterygioides is saprobic on dead, decayed, fallen branch (large) of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Mycena septentrionalis is saprobic on dead, decaying wood of Pinus sylvestris

Foodplant / saprobe
toadstool of Mycena viridimarginata is saprobic on dead, fallen, decaying litter of Pinus sylvestris

Foodplant / pathogen
Dothistroma coelomycetous anamorph of Mycosphaerella pini infects and damages live needle of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
hysterothecium of Mytilinidion scolecosporum is saprobic on wood or bark of Pinus sylvestris

Foodplant / feeds on
Myzia oblongoguttata feeds on Pinus sylvestris

Foodplant / saprobe
immersed apothecium of Naemacyclus fimbriatus is saprobic on fallen cone (scale) of Pinus sylvestris

Foodplant / saprobe
Naemospora coelomycetous anamorph of Naemospora strobi is saprobic on dead Pinus sylvestris

Foodplant / saprobe
stromatic, in large groups perithecium of Nectria fuckeliana is saprobic on dead twig of Pinus sylvestris
Remarks: season: 3-5, 9-12

Foodplant / saprobe
in small groups, erumpent on thin stroma perithecium of Nectria pinea is saprobic on dead branch of Pinus sylvestris
Remarks: season: 9-5
Other: major host/prey

Foodplant / open feeder
larva of Neodiprion sertifer grazes on live needle (previous year's) of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Neolentinus adhaerens is saprobic on dead, decayed wood of Pinus sylvestris

Plant / associate
Nephus quadrimaculatus is associated with Pinus sylvestris

Foodplant / saprobe
fruitbody of Odonticium romellii is saprobic on dead, decayed wood of Pinus sylvestris

Foodplant / saprobe
erumpent conidioma of Oncospora coelomycetous anamorph of Oncospora pinastri is saprobic on bark of Pinus sylvestris

Foodplant / saprobe
perithecium of Ophiostoma piceae is saprobic on blue-stained wood of Pinus sylvestris

Foodplant / saprobe
erumpent sporodochium of Oramasia dematiaceous anamorph of Oramasia hirsuta is saprobic on dead cone of Pinus sylvestris
Remarks: season: 12-1

Plant / associate
Orthotylus fuscescens is associated with Pinus sylvestris

Plant / associate
Ostoma ferrugineum is associated with Pinus sylvestris

Foodplant / feeds on
adult of Otiorhynchus singularis feeds on pollen of Pinus sylvestris

Foodplant / internal feeder
larva of Paraphotistus impressus feeds within wood of Pinus sylvestris

Fungus / saprobe
conidioma of Patellina coelomycetous anamorph of Patellina caesia is saprobic on fallen cone of Pinus sylvestris

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Paxillus involutus is ectomycorrhizal with live root of young tree of Pinus sylvestris

Foodplant / saprobe
resupinate fruitbody of Peniophora cinerea is saprobic on dead wood of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
fruitbody of Peniophora incarnata is saprobic on dead, decayed cone of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
fruitbody of Peniophora lycii is saprobic on dead, fallen stick of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
fruitbody of Peniophora pini is saprobic on dead, attached twig of Pinus sylvestris

Foodplant / saprobe
Cryptosporiopsis anamorph of Pezicula livida is saprobic on dead, fallen branch of Pinus sylvestris

Foodplant / saprobe
apothecium of Pezizella chionea is saprobic on fallen needle of Pinus sylvestris
Remarks: season: 4-8
Other: minor host/prey

Foodplant / parasite
immersed, then exposed apothecium of Phacidium infestans parasitises live needle of Pinus sylvestris
Remarks: season: 5-8

Fungus / saprobe
Ceuthospora coelomycetous anamorph of Phacidium lacerum is saprobic on decaying needle of Pinus sylvestris

Foodplant / saprobe
erumpent apothecium of Phaeohelotium purpureum is saprobic on fallen branch of Pinus sylvestris
Remarks: season: 1

Foodplant / pathogen
fruitbody of Phaeolus schweinitzii infects and damages live root of mature tree of Pinus sylvestris
Other: major host/prey

Fungus / saprobe
effuse colony of Phaeostalagmus dematiaceous anamorph of Phaeostalagmus peregrinus is saprobic on fallen cone of Pinus sylvestris

Foodplant / parasite
fruitbody of Phellinus igniarius parasitises live trunk of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / parasite
fruitbody of Phellinus pini parasitises live trunk of Pinus sylvestris
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Phellodon confluens is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: unusual host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Phellodon melaleucus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Phellodon tomentosus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / saprobe
fruitbody of Phlebia lilascens is saprobic on dead, decayed wood of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
fruitbody of Phlebia subserialis is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Phlebia tremellosa is saprobic on dead, fallen, decayed trunk (large) of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
fruitbody of Phlebiella albida is saprobic on dead, fallen needle of litter of Pinus sylvestris

Foodplant / saprobe
fruitbody of Phlebiella pseudotsugae is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Phlebiella sulphurea is saprobic on dead, decayed wood of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
fruitbody of Phlebiella tulasnelloidea is saprobic on dead, decayed wood of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
fruitbody of Phlebiopsis gigantea is saprobic on dead, decayed trunk (cut end) of Pinus sylvestris
Other: major host/prey

Foodplant / sap sucker
nymph of Phoenicocoris obscurellus sucks sap of Pinus sylvestris

Foodplant / saprobe
densely scattered, erumpent pycnidium of Phomopsis coelomycetous anamorph of Phomopsis pithya is saprobic on dead bark of Pinus sylvestris

Foodplant / saprobe
fruitbody of Piloderma bicolor is saprobic on dead, fallen, decayed litter of Pinus sylvestris
Other: major host/prey

Foodplant / feeds on
Pilophorus cinnamopterus feeds on wound induced resinous sap flow of Pinus sylvestris

Foodplant / sap sucker
Pineus pini sucks sap of live bark of Pinus sylvestris
Remarks: season: 1-12

Foodplant / feeds on
larva of Pissodes castaneus feeds on dead or dying twig of Pinus sylvestris

Foodplant / internal feeder
larva of Pissodes pini feeds within dead branch of Pinus sylvestris
Other: major host/prey

Foodplant / internal feeder
larva of Pissodes validirostris feeds within cone of Pinus sylvestris
Other: major host/prey

Plant / associate
Plegaderus vulneratus is associated with under bark of Pinus sylvestris

Foodplant / saprobe
fruitbody of Pleurocybella porrigens is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
effuse colony of Polyscytalum dematiaceous anamorph of Polyscytalum pini is saprobic on decaying, dead needle of Pinus sylvestris
Remarks: season: 9-3

Foodplant / saprobe
fruitbody of Postia ceriflua is saprobic on dead wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Postia floriformis is saprobic on dead wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Postia fragilis is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Postia leucomallella is saprobic on dead, decayed (very) log (large) of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Postia placenta is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Postia rennyi is saprobic on dead, fallen, decayed (very) trunk (large) of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Postia sericeomollis is saprobic on dead, decayed trunk (large) of Pinus sylvestris
Other: major host/prey

Fungus / saprobe
conidioma of Pseudocenangium coelomycetous anamorph of Pseudocenangium succineum is saprobic on fallen, dead needle of Pinus sylvestris

Foodplant / saprobe
colony of Pseudocercospora dematiaceous anamorph of Pseudocercospora deightonii is saprobic on needle of Pinus sylvestris
Remarks: season: 9-2

Foodplant / spot causer
Linodochium anamorph of Pseudohelotium pineti causes spots on whitened needle of Pinus sylvestris
Remarks: season: 7-8

Foodplant / saprobe
fruitbody of Pseudomerulius aureus is saprobic on dead, decayed (very) wood of Pinus sylvestris

Foodplant / saprobe
colony of Pseudomicrodochium anamorph of Pseudomicrodochium candidum is saprobic on dead twig (small) of Pinus sylvestris
Remarks: season: 6-12

Fungus / saprobe
erumpent conidioma of Pseudopatellina coelomycetous anamorph of Pseudopatellina conigena is saprobic on fallen cone of Pinus sylvestris

Plant / associate
Pytho depressus is associated with Pinus sylvestris

Plant / associate
fruitbody of Ramaria suecica is associated with Pinus sylvestris

Foodplant / saprobe
fruitbody of Resinicium furfuraceum is saprobic on dead, decayed wood of Pinus sylvestris

Plant / associate
imago of Rhagium bifasciatum is associated with dead post of Pinus sylvestris
Remarks: season: 4-7
Other: major host/prey

Foodplant / saprobe
clustered perithecium of Rosellinia obliquata is saprobic on cone of Pinus sylvestris
Remarks: season: 1-8

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Russula caerulea is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Russula cessans is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Russula emetica is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Russula foetens is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Russula nauseosa is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Russula sanguinaria is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Russula sardonia is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Russula scotica is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Russula turci is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Sarcodon squamosus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Fungus / saprobe
pycnidium of Epithyrium coelomycetous anamorph of Sarea difformis is saprobic on resin exudate of Pinus sylvestris

Foodplant / saprobe
fruitbody of Schizopora flavipora is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / feeds on
Sciurus vulgaris feeds on seed of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
scattered or irregularly gregarious, covered by bark, but then semi-erumpent pycnidium of Sclerophoma coelomycetous anamorph of Sclerophoma pithya is saprobic on dead branch (small) of Pinus sylvestris
Remarks: season: 1-4

Foodplant / saprobe
erumpent to superficial perithecium of Scopinella solani is saprobic on cone of Pinus sylvestris
Remarks: season: 12-8

Fungus / saprobe
colony of Septocylindrium anamorph of Septocylindrium leucum is saprobic on fallen cone of Pinus sylvestris

Foodplant / saprobe
effuse colony of Septonema dematiaceous anamorph of Septonema fasciculare is saprobic on rotten bark of Pinus sylvestris

Foodplant / feeds on
amphigenous, punctiform, subepidermal pycnidium of Septoria coelomycetous anamorph of Septoria acuum feeds on needle of Pinus sylvestris
Remarks: season: 9

Foodplant / saprobe
colony of Sesquicillium anamorph of Sesquicillium candelabrum is saprobic on rotting needle of Pinus sylvestris

Foodplant / saprobe
fruitbody of Sistotrema dennisii is saprobic on charred cone of Pinus sylvestris

Foodplant / saprobe
fruitbody of Sistotrema diademiferum is saprobic on dead, decayed litter of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Sistotrema pistilliferum is saprobic on dead, decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Sistotremastrum niveocremeum is saprobic on dead, decayed wood of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
fruitbody of Skeletocutis alutacea is saprobic on dead, decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Skeletocutis amorpha is saprobic on dead, fallen, decayed branch (large) of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Skeletocutis kuehneri is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Skeletocutis vulgaris is saprobic on dead, fallen, decayed branch (large) of Pinus sylvestris
Other: minor host/prey

Foodplant / saprobe
superficial synnema of Sphaeridium anamorph of Sphaeridium candidum sensu Fuckel is saprobic on dead cone of Pinus sylvestris
Remarks: season: 1-12

Foodplant / pathogen
erumpent pycnidium of Sphaeropsis coelomycetous anamorph of Sphaeropsis sapinea infects and damages live cone of Pinus sylvestris
Remarks: season: 10-4

Foodplant / feeds on
scattered, epiphyllous, covered, black pycnidium of Stagonospora coelomycetous anamorph of Stagonospora pini feeds on needle of Pinus sylvestris
Remarks: season: 8

Foodplant / saprobe
fruitbody of Stereum sanguinolentum is saprobic on fallen, dead branch (large) of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
apothecium of Stictis sp. nov. is saprobic on dead, fallen cone of Pinus sylvestris

Foodplant / saprobe
thyriothecium of Stomiopeltis pinastri is saprobic on dead, fallen, rotting needle of Pinus sylvestris
Remarks: season: 9-3

Foodplant / saprobe
immersed, becoming erumpeny conidioma of Strasseria coelomycetous anamorph of Strasseria geniculata is saprobic on dead twig of Pinus sylvestris
Remarks: season: 1-5

Foodplant / saprobe
long-rooted fruitbody of Strobilurus tenacellus is saprobic on buried, partially decayed cone of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Stypella vermiformis is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Subulicium lautum is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Suillus bovinus is ectomycorrhizal with live root of Pinus sylvestris
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Suillus collinitus is ectomycorrhizal with live root of Pinus sylvestris

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Suillus flavidus is ectomycorrhizal with live root of Pinus sylvestris

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Suillus granulatus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Suillus luteus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Suillus variegatus is ectomycorrhizal with live root of Pinus sylvestris
Other: major host/prey

Foodplant / secondary infection
erumpent pycnidium of Sclerophoma coelomycetous anamorph of Sydowia polyspora secondarily infects gall-midge infected needle of Pinus sylvestris

Foodplant / saprobe
effuse colony of Sympodiella dematiaceous anamorph of Sympodiella acicola is saprobic on rotting needle of Pinus sylvestris

Foodplant / saprobe
fruitbody of Tapinella panuoides is saprobic on dead, decaying sawdust of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Tephrocybe fuscipes is saprobic on dead, decaying needle of litter of Pinus sylvestris

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Thelephora terrestris is ectomycorrhizal with live root of Pinus sylvestris
Remarks: captive: in captivity, culture, or experimentally induced

Foodplant / saprobe
apothecium of Therrya fuckelii is saprobic on dead, fallen twig of Pinus sylvestris
Remarks: season: 5

Fungus / saprobe
immersed apothecium of Therrya pini is saprobic on brittle, dead, fallen, lacking needles branch (small) of Pinus sylvestris
Remarks: season: 2-7
Other: major host/prey

Foodplant / saprobe
effuse colony of Thysanophora dematiaceous anamorph of Thysanophora penicillioides is saprobic on dead, rotting, fallen needle of Pinus sylvestris

Plant / resting place / on
fruitbody of Tomentellopsis zygodesmoides may be found on dead, decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Trechispora alnicola is saprobic on dead, decayed wood of Pinus sylvestris
Other: unusual host/prey

Foodplant / saprobe
fruitbody of Trechispora dimitica is saprobic on dead, decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Trechispora hymenocystis is saprobic on decayed (very) wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Trechispora minima is saprobic on dead, decayed wood of Pinus sylvestris

Foodplant / saprobe
fruitbody of Trechispora stevensonii is saprobic on dead, decayed wood of Pinus sylvestris

Plant / associate
basidiome of Tremella translucens is associated with dead, decayed needle of Pinus sylvestris

Foodplant / saprobe
fruitbody of Trichaptum abietinum is saprobic on fallen, dead branch (large) of Pinus sylvestris
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma aestuans is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma apium is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma batschii is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma equestre is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma gausapatum is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma portentosum is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tricholoma stans is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / saprobe
fruitbody of Tricholomopsis decora is saprobic on dead, decayed stump of Pinus sylvestris
Other: major host/prey

Fungus / saprobe
sporodochium of Trimmatostroma dematiaceous anamorph of Trimmatostroma scutellare is saprobic on fallen cone of Pinus sylvestris
Remarks: season: 11-4

Foodplant / feeds on
Trisetacus pini feeds on Pinus sylvestris

Foodplant / saprobe
effuse colony of Troposporella dematiaceous anamorph of Troposporella monospora is saprobic on dead needle of Pinus sylvestris

Foodplant / saprobe
erumpent, shortly stalked apothecium of Tryblidiopsis pinastri is saprobic on dead, attached twig of Pinus sylvestris
Remarks: season: 5-7
Other: uncertain

Foodplant / saprobe
Tubulicrinis accedens is saprobic on dead, decayed wood of Pinus sylvestris

Foodplant / saprobe
Tubulicrinis glebulosus is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Tubulicrinis medius is saprobic on dead, decayed wood of Pinus sylvestris

Foodplant / saprobe
Tubulicrinis propinquus is saprobic on dead, decayed wood of Pinus sylvestris

Foodplant / saprobe
Tubulicrinis subulatus is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / mycorrhiza / ectomycorrhiza
fruitbody of Tylopilus felleus is ectomycorrhizal with live root of Pinus sylvestris
Remarks: Other: uncertain
Other: minor host/prey

Fungus / saprobe
amphigenous stroma of Cytospora coelomycetous anamorph of Valsa abietis is saprobic on dead needle of Pinus sylvestris
Remarks: season: 12-4

Foodplant / saprobe
fruitbody of Vesiculomyces citrinus is saprobic on dead, decayed bark of Pinus sylvestris
Other: major host/prey

Foodplant / saprobe
fruitbody of Xenosperma ludibundum is saprobic on dead, decayed wood of Pinus sylvestris
Other: major host/prey

Foodplant / internal feeder
larva of Xyela julii feeds within unripe male catkin (sporophylls) of Pinus sylvestris
Other: sole host/prey

Foodplant / internal feeder
larva of Xyela longula feeds within shoot of Pinus sylvestris
Remarks: Other: uncertain

Foodplant / internal feeder
larva of Xyela piliserra feeds within male catkin of Pinus sylvestris
Other: sole host/prey

Fungus / saprobe
effuse or pulvinate colony of Xylohypha dematiaceous anamorph of Xylohypha ortmansiae is saprobic on fallen cone of Pinus sylvestris
Remarks: season: 10-3

Foodplant / saprobe
effuse colony of Xylohypha dematiaceous anamorph of Xylohypha pinicola is saprobic on decorticate wood of Pinus sylvestris

Foodplant / saprobe
mostly superficial, but with bases immersed perithecium of Zigno is saprobic on locally bleached, rotten but still firm, dead branch of Pinus sylvestris

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Faunal Associations

Scots Pine, like other pines, is a food source of many insects. This includes the caterpillars of the butterfly Callophrys niphon (Pine Elfin), the caterpillars of several moths, Pineus strobi (Pine Bark Adelgid), Toumeyella pini (Striped Pine Scale), the aphids Cinara pini and Eulachnus rileyi, Aphrophora parallela (Pine Spittlebug), a few plant bugs, Tomicus piniperda (Common Pine Shoot Beetle), the larvae of several long-horned beetles, larvae of the metallic wood-boring beetles Buprestis lineata and Chrysobothris cribraria, and the larvae of several weevils. The Insect Table lists many of these species. Vertebrate animals, particularly birds and mammals, make use of pine trees in various ways. The seeds and/or buds are eaten by some upland gamebirds and songbirds. These species include the Wild Turkey, Bobwhite Quail, Red-Bellied Woodpecker, Mourning Dove, Black-Capped Chickadee, Carolina Chickadee, Brown Creeper, Red-Breasted Nuthatch, White-Breasted Nuthatch, Pine Grosbeak, Red Crossbill, White-Winged Crossbill, Slate-Colored Junco, Pine Siskin, Common Redpoll, Monk Parakeet (in urban areas), and Pine Warbler. The seeds are also eaten by the Red Squirrel, Gray Squirrel, and White-Footed Mouse, while the foliage and twigs are browsed by White-Tailed Deer and Elk. Pines are favored nesting sites for some birds; these species include the Pine Warbler, Yellow-Throated Warbler, and Blue-Headed Vireo. Because the evergreen leaves provide good cover, the Evening Grosbeak, migrating Robins, various owls, and other birds use these trees as roosting sites.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Pinus sylvestris (Pinus silvestris) is prey of:
Cinara pini
Cinara pinea
Eulachnus agilis
Schizolachnus pineti

Based on studies in:
Europe: Central Europe (Plant substrate)

This list may not be complete but is based on published studies.
  • M. Rejmanek and P. Stary, 1979. Connectance in real biotic communities and critical values for stability of model ecosystems. Nature 280:311-313, from p. 312.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Fire Management Considerations

More info for the term: fire exclusion

Fires in Sweden have given rise to uneven-aged stands of Scots pine,
particularly in virgin types that have not been disturbed by humans
[59]. Fire exclusion in Europe has resulted in a conversion of
pine-dominated forests (including Scots pine) to hardwoods [26].

Prescribed burning followed by tilling, followed by natural
reforestation (known as swaling), has been practiced in Europe for many
years. It has been noted that the more frequently a site has been
swaled, the more likely it is that hardwoods will regenerate on the
site. Sites that have been burned and tilled only once often result in
good Scots pine regeneration [55].

Scots pine does not regenerate on dry sites occupied by Norway spruce
due to excessive humus buildup and shading. Such sites can be made more
conducive to Scots pine regeneration by prescribed burning. The humus
layer is directly reduced by fire. In succeeding years, it continues to
decrease in thickness, probably due to decreased root mass. Prescribed
burning improves many external growth factors needed for Scots pine
establishment, including nutrition, moisture availability, and soil
temperature [55].

Prescribed burning has been used in site preparation for the sowing of
Scots pine seeds in Norway and Finland [3,48]. Performance of Scots
pine approximately 10 years after planting was best on burned sites when
compared to performance on sites that were unburned but had slash
removed, or sites that were unburned and retained slash [55]. Rhizina
undulata root rot has been associated with postfire plantations of
Scots pine. As a result, prescribed burning for site preparation has
been discontinued in Finland and Sweden [1,54,55]. It is possible that
the appearance of Rhizina is associated with prescribed fires that are
too low in intensity [55]. However, the rarity of appropriate fire
weather for prescribed burning, and the labor-intensive expense of
prescribed burning have also contributed to the reduction in prescribed
burning in Scandinavia [3].
  • 1. Ahlgren, Isabel F. 1974. The effect of fire on soil organisms. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 47-72. [18306]
  • 3. Braathe, Peder. 1974. Prescribed burning in Norway--effects on soil and regeneration. In: Proceedings, annual Tall Timbers fire ecology conference; 1973 March 22-23; Tallahassee, FL. No. 13. Tallahassee, FL: 211-222. [18976]
  • 26. Komarek, E. V. 1983. Fire as an anthropogenic factor in vegetation ecology. In: Holzner, W.; Werger, M. J. A.; Ikusima, I., eds. Man's impact on vegetation. Boston, MA: Dr W. Junk Publishers: 77-82. [15273]
  • 48. Tolonen, Kimmo. 1983. The post-glacial fire record. In: Wein, Ross W.; MacLean, David A., eds. The role of fire in northern circumpolar ecosystems. Scope 18. New York: John Wiley & Sons: 21-44. [18503]
  • 54. Viro, P. J. 1969. Prescribed burning in forestry. Metsan tutkimuslaitoksen Julkaisuja. 67: 1-49. [22493]
  • 55. Viro, P. J. 1974. Effects of forest fire on soil. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 7-45. [18305]
  • 59. Zackrisson, Olle. 1980. Forest fire history: ecological significance and dating problems in the north Swedish boreal forest. In: Stokes, Marvin A.; Dieterich, John H., technical coordinators. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 120-125. [16052]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plant Response to Fire

More info for the term: wildfire

In Sweden, establishment of Scots pine seedlings at high elevations
increased after fire [15]. Total pine pollen increased after fires in
Swedish core samples dated from 1,430 years BP [4]. A survey of a
burned stand of mature Scots pine in northern China showed numerous
seedlings, but no saplings [50].

Following the 1974 wildfire in Scotland, Scots pine reproduction was
densest on plots with heather. Very few seedlings occurred on sites
where sapling stands had been killed by fire. Regeneration was 2,500
seedlings per hectare at postfire year 6. By postfire year 12, some
seedlings had overtopped the competing vegetation. Postfire mortality
of burned trees was high. By postfire year 6, 45 percent of trees
greater than 2.5 inches dbh was died. Much of the postfire mortality
was attributed to pine shoot beetle (Myelophilus piniperda) attacks on
fire-damaged trees [46,60].

Scots pine may regenerate from seeds released from cones of burned
trees [60] as well as from seed from off-site parent trees. Twenty-four
years after a wildfire in Sweden, numerous Scots pine seedlings
occurred on burned sites, concentrated around surviving trees and near
the edges of the burned areas [52].
  • 4. Bradshaw, Richard H. W.: Zackrisson, Olle. 1990. A two thousand year history of a northern Swedish boreal forest stand. Journal of Vegetation Science. 1(4): 519-528. [12762]
  • 15. Engelmark, Ola. 1987. Fire history correlations to forest type and topography in northern Sweden. Annales Botanici Fennici. 24(4): 317-324. [6688]
  • 46. Sykes, J. M. 1987. Further observations on the recovery of vegetation in the Caledonian pinewood of Coille Creag-loch after fire. Transactions of the Botanical Society of Edinburgh. 45(2): 161-162. [6687]
  • 50. Uemura, Shigeru; Tsuda, Satoshi; Hasegawa, Sakae. 1990. Effects of fire on the vegetation of Siberian taiga predominated by Larix dahurica. Canadian Journal of Forestry Research. 20: 547-553. [11808]
  • 52. Uggla, Evald. 1959. Ecological effects of fire on north Swedish forests. [Place of publication unknown]
  • 60. Sykes, J. M.; Horrill, A. D. 1981. Recovery of vegetation in a Caledonian pinewood after fire. Transactions of the Botanical Society of Edinburg. 43: 317-325. [22006]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Immediate Effect of Fire

More info for the terms: resistance, wildfire

Young Scots pine trees are easily killed by fire due to their thin bark
and shallow roots. Based on the ability to recover after defoliation,
the fire resistance of 8-year-old Scots pine trees is rated as low
[36]. The heat tolerance of 1-year-old Scots pine seedlings is low
compared to a number of other conifers, including eastern white pine
[24]. Mature trees are better able to withstand fire; old trees in
Muddus National Park, Sweden, have numerous fire scars, showing that
they have survived repeated fires (intensity unreported). However,
severe fire will kill even mature trees [52].

A 1974 surface and crown wildfire in Scotland killed 74 percent of all
Scots pine burned. All Scots pine less than 2 inches (5 cm) dbh were
killed outright. Trees greater then 15.2 inches (38 cm) in diameter did
not have immediate mortality, however [60].

Scots pine seeds are moderately resistant to heat damage, and have a
good chance of surviving fire when buried. Seed germination is
good even at depths of up to 4.6 inches (10 cm) [52].

Scots pine bark is more resistant to heat than that of Norway
spruce, sugar maple, or white ash (Fraxinus americana) [14].
  • 14. Devet, David D. 1940. Heat conductivity of bark in certain selected species. Syracuse, NY: Syracuse University. 83 p. Thesis. [21931]
  • 24. Kayll, A. J. 1968. Heat tolerance of tree seedlings. In: Proceedings, annual Tall Timbers fire ecology conference; 1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers Research Station: 89-105. [17849]
  • 36. Pryor, L. D. 1940. The effect of fire on exotic conifers: Some notes on the effect of fire on exotic conifers in the Australian capital territory. Australian Forestry. 5: 37-38. [11391]
  • 52. Uggla, Evald. 1959. Ecological effects of fire on north Swedish forests. [Place of publication unknown]
  • 60. Sykes, J. M.; Horrill, A. D. 1981. Recovery of vegetation in a Caledonian pinewood after fire. Transactions of the Botanical Society of Edinburg. 43: 317-325. [22006]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Post-fire Regeneration

More info for the term: root crown

Tree without adventitious-bud root crown
Initial-offsite colonizer (off-site, initial community)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fire Ecology

More info for the terms: fire cycle, fire interval, fuel, litter, mean fire interval, taiga

Scots pine forests in Sweden are rated as fire-prone and appear to
require repeated fire for their maintenance [15]. In general, pine
forests in Europe (particularly Scots pine forests) which were always
fire-prone have become even more flammable with the advent of fire
exclusion and the discontinuance of the practice of litter collection
for use as animal bedding material, fuel, etc. [26].

In Sweden, Scots pine dominates forests that have burned with a mean
fire interval of 46 years from approximately 1,100 A.D. to the present.
In some areas, the mean fire interval is as short as 30 years, although
the impact of fire has been greatly reduced in the last 100 years with
fire suppression [59]. A fire return interval ranging from 26 to 146
years was calculated for Scots pine/heather forests in eastern Finland
[48]. In the taiga of northern China, the fire cycle for Scots pine
forests was estimated at 130 years [50].

The number of years between fires decreased in areas where Scots pine
basal area increased in Muddus National Park, Sweden. In this area,
Scots pine often predominates at the lower elevations where fire is
more common and is replaced by Norway spruce at the higher elevations
where fire is less frequent [15].
  • 15. Engelmark, Ola. 1987. Fire history correlations to forest type and topography in northern Sweden. Annales Botanici Fennici. 24(4): 317-324. [6688]
  • 26. Komarek, E. V. 1983. Fire as an anthropogenic factor in vegetation ecology. In: Holzner, W.; Werger, M. J. A.; Ikusima, I., eds. Man's impact on vegetation. Boston, MA: Dr W. Junk Publishers: 77-82. [15273]
  • 48. Tolonen, Kimmo. 1983. The post-glacial fire record. In: Wein, Ross W.; MacLean, David A., eds. The role of fire in northern circumpolar ecosystems. Scope 18. New York: John Wiley & Sons: 21-44. [18503]
  • 50. Uemura, Shigeru; Tsuda, Satoshi; Hasegawa, Sakae. 1990. Effects of fire on the vegetation of Siberian taiga predominated by Larix dahurica. Canadian Journal of Forestry Research. 20: 547-553. [11808]
  • 59. Zackrisson, Olle. 1980. Forest fire history: ecological significance and dating problems in the north Swedish boreal forest. In: Stokes, Marvin A.; Dieterich, John H., technical coordinators. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 120-125. [16052]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Successional Status

More info on this topic.

More info for the term: litter

Facultative Seral Species

Scots pine is intolerant of shade [42]. High mortality rates occur for
Scots pine growing under canopy. Few trees survive more than 50 years
under suppression; most do not survive even 7 years of shade [44,47].
Scots pine is not very responsive to release from suppression; trees
under 20 years old show a modest response [44,47]. Scots pine stands
are usually even-aged, or are uneven-aged with distinct age classes. In
Scandinavia, 50 to 70 percent of the trees in a stand commonly belong to
one age class, with the rest of the trees in the neighboring age classes
[22].

Scots pine usually regenerates in gaps (forming even-aged clumps) or
after stand-replacing disturbances [44,47,50]. In Sweden, most Scots
pine dominated-forests are maintained by fire. In the absence of fire,
Scots pine is usually replaced by Norway spruce (Picea abies). On some
sites, however, uneven-aged Scots pine stands are self maintaining in
the absence of fire. Regeneration peaks on these sites occurred at long
intervals and appear to be more related to favorable climatic conditions
than to any disturbances. The ability of Scots pine to reproduce
without disturbance is attributed to the thin humus and litter layers of
these poor sites [44].

The percentage of pine pollen increased after disturbances in soil core
samples dated from 1,430 years BP to present, in an area where Scots
pine is usually present [4].
  • 4. Bradshaw, Richard H. W.: Zackrisson, Olle. 1990. A two thousand year history of a northern Swedish boreal forest stand. Journal of Vegetation Science. 1(4): 519-528. [12762]
  • 22. Jones, E. W. 1945. The structure and reproduction of the virgin forest of the north temperate zone. New Phytologist. 44: 130-148. [10229]
  • 42. Skilling, Darroll D. 1990. Pinus sylvestris L. Scots pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 489-496. [13409]
  • 44. Steijlen, Ingeborg; Zackrisson, Olle. 1987. Long-term regeneration dynamics and successional trends in a northern Swedish coniferous forest. Canadian Journal of Botany. 65: 839-848. [16463]
  • 47. Tarasiuk, S.; Zwieniecki, M. 1990. Social-structure dynamics in uneven-aged Scots pine (Pinus sylvestris) regen. under canopy at the Kaliszki Preserve, Kampinoski Natl. Park. Forest Ecology and Management. 35: 277-289. [21874]
  • 50. Uemura, Shigeru; Tsuda, Satoshi; Hasegawa, Sakae. 1990. Effects of fire on the vegetation of Siberian taiga predominated by Larix dahurica. Canadian Journal of Forestry Research. 20: 547-553. [11808]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regeneration Processes

More info for the terms: density, fern

Scots pine reproduces by seed. Sexual maturity can be reached as early
as 5 to 8 years of age; the usual range is from 10 to 15 years of age.
Scots pine continues to produce viable seed for up to 200 years. Good
seed crops are produced every 3 to 6 years, with light crops in
intervening years. Seed cones require alternating wet and dry weather
to open; seeds can be retained until early spring. Seed dispersal
distances range from 164 to 328 feet (50-100 m) from the parent, though
the maximum distance is greater than 0.6 mile (1 km) [42]. Seed quality,
germination, and establishment decrease with distance from the parent
plant [52].

Scots pine seedling establishment occurs on bare mineral soil. In
England, however, where Scots pine is invading heather (Calluna
vulgaris)-bracken fern (Pteridium aquilinum) heaths, Scots pine
seedlings were found even in dense stands of bracken fern; the limiting
factor on these sites appears to be proximity to seed source, rather
than density of ground vegetation [33].

Moisture stress, in the form of repeated cycles of wetting and drying,
has a pronounced negative effect on Scots pine seed germination [40].
Seedlings establish best with adequate moisture and some shade [42].
Survival is best when seedlings are planted on microsites close to the
tops of hills, and lowest in overly moist depressions [19].

There is no naturally occurring vegetative reproduction [42].
  • 19. Hagner, Matt. 1989. The influence of microenvironment upon survival and growth in Pinus sylvestris. In: Martinsson, Owe; Packee, Edmond C.; Gasbarro, Anthony; Lawson, Teri, coords. Forest regeneration at northern latitudes close to timber line: Proceedings, 7th annual workshop on silviculture and management of northern forests; 1985 June 16-20; Lulea-Gallivare-Ostersund, Sweden. Gen. Tech. Rep. PNW-GTN-247. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 33-38. [17296]
  • 33. Marrs, R. H.; Hicks, M. J. 1986. Study of vegetation change at Lakenheath Warren: a re-examination of A. S. Watt's theories of bracken dynamics in relation to succession and vegetation management. Journal of Applied Ecology. 23: 1029-1046. [9969]
  • 40. Russo, Vincent M. 1978. Development of Pinus seedlings grown from seed subjected to drying and wetting cycles. Forest Science. 24(4): 537-541. [21868]
  • 42. Skilling, Darroll D. 1990. Pinus sylvestris L. Scots pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 489-496. [13409]
  • 52. Uggla, Evald. 1959. Ecological effects of fire on north Swedish forests. [Place of publication unknown]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth Form (according to Raunkiær Life-form classification)

More info on this topic.

More info for the term: phanerophyte

Phanerophyte

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Form

More info for the term: tree

Tree

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Broad-scale Impacts of Plant Response to Fire

The climatic conditions that are conducive to fire in Scandinavia are
also conducive to the production of large seed crops [52].
  • 52. Uggla, Evald. 1959. Ecological effects of fire on north Swedish forests. [Place of publication unknown]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology

More info on this topic.

Scots pine pollen cones open from late May to early June. Pollination
occurs in early summer and is followed by fertilization 12 months later.
Seeds mature and cones ripen from September to October. Seed dispersal
occurs from December to March [27,42].
  • 27. Krugman, Stanley L.; Jenkinson, James L. 1974. Pinaceae--pine family. In: Schopmeyer, C. S., technical coordinator. Seeds of woody plants in the United States. Agric. Handb. 450. Washington, DC: U.S. Department of Agriculture, Forest Service: 598-637. [1380]
  • 42. Skilling, Darroll D. 1990. Pinus sylvestris L. Scots pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 489-496. [13409]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pinus sylvestris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATATAGGGACTCCACATTCAATCTTCGGTGCCATTGCTGGAGTAATGGGCACATGCTTCTCAGTACCAATTCGTATGGAATTAGCACAACCCGGCGATCAAATTCTTGGTGGGAATCATCAACCTCATAATGTGTCAATAACGGCTCACGCTTCTCCAATGATCCCTTTTATGGTTATGCCGGCGGTGATAGGTGGATCTGGTAATTGGTCCGTTCCGATTCCTATAGGTGCACCTGACATGGCATTTCCACGATTGAATAATATTCCATCCCGGTTGTTGCCACCTTCGCTGTTGCTCCCATTAAGCCCAGCCTCGGTAGAAGTGGGTAGCGGCACTGGGTGGACGGTCTATCCGCCCCTAAGTGGTATTACCAGTCATTCCGGAGGAGCTGCTGATCCAGCGATTTCTAGTCCTCATCTATCAGGTGTTTCATCCATTTCAGGTTCTATCAATCTCATAACTACTATCCCCAACATGCGCGGGCCTGGAATGACTATGCATAGATCACCCCTATTTGTGCGGTCCGTTCCAGTGACAGCATTCCTACTCTTATCATCACTTCCGGTACCGGCAGGGGCAATTACCATGTTATCAACTGATCGAAGCTTTAATACAACCTTTTTCGATCCTGCTGGAGGGGGAGACCCGATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pinus sylvestris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/lc
Lower Risk/least concern

Red List Criteria

Version
2.3

Year Assessed
1998
  • Needs updating

Assessor/s
Conifer Specialist Group

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Reasons: Native of Europe. Brought to U.S. as timber species. Later abandoned for timber, but still widely found as an ornamental.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common in the UK
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Scots pine is not a threatened species but for centuries it has been cleared from much of its British range. Today, trees are being allowed to self-set and grow over much of the area where they occurred before the great clearances of the 17th century.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pests and potential problems

There are several wood boring, root feeding, foliage feeding, and twig boring insects that attack this tree. The most common pest are cyclaneusma needle cast, western gall rust, Lophodermium needle cast, tip moth, sawflies, pine needle scales and giant conifer aphid.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management considerations

More info for the term: root collar

Scots pine is usually managed with a shelterwood or uniform compartment
system. In the Northeast and the Great Lakes states, reproduction is
abundant on sandy sites [32].

Scots pine requires high light intensities for good growth, but has
modest nutritional demands [55]. Certain ground vegetation types are
used as site quality indicators for Scots pine in Europe [7,35].
Scots pine performance varies greatly with site and seed source
[12,39,42]. Yields for most species in Scots pine stands in Germany
were improved when shade-tolerant species (Norway spruce and European
beech [Fagus sylvatica]) were grown in the understory. Scots pine
yields, however, were slightly decreased under those conditions [2].
Scots pine growth rates decreased with decreasing acidity in greenhouse
tests; optimum seedling growth is on acidic soils [8].

Scots pine has more branches per whorl than red pine (Pinus resinosa)
or eastern white pine (P. strobus), and is thus weaker at the nodes and
subject to wind damage [42].

Scots pine is intermediate in tolerance to foliar sprays of sodium
chloride [49].

Insects and Disease: Damaging insect species on Scots pine include
pine root collar weevil, pine root tip weevil, European pine sawfly, and
others. Scleroderris canker has become a serious problem in Scots pine
plantations in many areas. Other diseases include Lophodermum
needlecast, brown spot needle disease, and western gall rust [42,43].
  • 32. Little, Elbert L., Jr. 1979. Checklist of United States trees (native and naturalized). Agric. Handb. 541. Washington, DC: U.S. Department of Agriculture, Forest Service. 375 p. [2952]
  • 2. Assmann, Ernst. 1970. The principles of forest yield study. Oxford: Pergamon Press. 506 p. [22496]
  • 7. Cajander, A. K. 1949. Forest types and their significance. Acta Forestalia Fennica. 56: 1-105. [22657]
  • 8. Carter, M. R. 1987. Seedling growth and mineral nutrition of Scots pine under acidic to calcareous soil conditions. Soil Science. 144(3): 175-180. [21875]
  • 12. Cunningham, Richard A.; Van Haverbeke, David F. 1991. Twenty-two year results of a Scots pine (Pinus sylvestris L.) provenance test in North Dakota. Res. Pap. RM-298. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 9 p. [17114]
  • 35. Nieppola, Jari. 1992. Long-term vegetation changes in stands of Pinus sylvestris in southern Finland. Journal of Vegetation Science. 3: 475-484. [21845]
  • 39. Ruby, J. L.; Wright, J. W. 1976. A revised classification of geographic varieties in Scots pine. Silvae Genetica. 25: 5-6. [21872]
  • 42. Skilling, Darroll D. 1990. Pinus sylvestris L. Scots pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 489-496. [13409]
  • 43. Skilling, Darroll D.; Nicholls, Thomas H. 1974. Brown spot needle disease-biology and control in Scots pine plantations. Research Paper NC-109. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 19 p. [10512]
  • 49. Townsend, A. M. 1989. The search for salt tolerant trees. Arboricultural Journal. 13(1): 67-73. [13061]
  • 55. Viro, P. J. 1974. Effects of forest fire on soil. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 7-45. [18305]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

There are currently no conservation projects for Scots pine.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivars, improved and selected materials (and area of origin)

Scots pine has several intergrading cultivars, differing chiefly in leaf color and growth form. Most have ready use as Christmas trees, although leaves of some cultivars turn yellow-green in winter. Seedlings are available at most commercial conifer nurseries. Seed origin is extremely important in obtaining quality trees for a given sub-region. Consult the state extension forester for information from provenance testing to determine the best seed source for your planting.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Weed control is recommended in areas where the tree is grown for shade or Christmas tree plantings. It is also good to shape the tree for the form that you would like to have at time of harvest.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Other uses and values

More info for the term: tree

Scots pine is a highly preferred Christmas tree, accounting for 30
percent of all trees planted for that purpose [42]. As a Christmas tree
crop, it can be highly profitable in agroforestry systems which combine
the production of row crops with tree plantations [30]. Scots pine is
widely planted as an ornamental, and for windbreaks in the central Great
Plains [12,38].

Scots pine is used to monitor the effect of air pollution on plants [13].
  • 12. Cunningham, Richard A.; Van Haverbeke, David F. 1991. Twenty-two year results of a Scots pine (Pinus sylvestris L.) provenance test in North Dakota. Res. Pap. RM-298. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 9 p. [17114]
  • 13. Czuchajowska, Zuzanna. 1987. Influence of zinc smelter emissions on leaves of Pinus sylvestris and Vaccinium spp. as revealed by some morphological & ecophys. indices. Environmental and Experimental Biology. 27(1): 67-83. [9255]
  • 30. Kurtz, W. B.; Thurman, S. E.; Monson, M. J.; Garrett, H. E. 1991. The use of agroforestry to control erosion--financial aspects. Forestry Chronicle. 67(3): 254-257. [21865]
  • 38. Read, Ralph A. 1964. Tree windbreaks for the Central Great Plains. Agric. Handb. 250. Washington, DC: U.S. Department of Agriculture, Forest Service. 68 p. [2897]
  • 42. Skilling, Darroll D. 1990. Pinus sylvestris L. Scots pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 489-496. [13409]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Value for rehabilitation of disturbed sites

More info for the term: cover

Scots pine is planted for erosion control [42]. It is used to reforest
coal mine spoils. Such plantations are valued chiefly for Christmas
tree production, providing screening and wildlife food and cover, and
asthetics [5,21,56]. In Europe, it is planted to reforest burned sites
[54].
  • 5. Brothers, Timothy S. 1988. Indiana surface-mine forests: historical development and composition of a human-created vegetation complex. Southeastern Geographer. 28(1): 19-33. [8787]
  • 21. Hughes, H. Glenn. 1990. Ecological restoration: fact or fantasy on strip-mined lands in western Pennsylvania?. In: Hughes, H. Glenn; Bonnicksen, Thomas M., eds. Restoration '89: the new management challenge: Proceedings, 1st annual meeting of the Society for Ecological Restoration; 1989 January 16-20; Oakland, CA. Madison, WI: The University of Wisconsin Arboretum, Society for Ecological Restoration: 237-243. [14699]
  • 42. Skilling, Darroll D. 1990. Pinus sylvestris L. Scots pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 489-496. [13409]
  • 54. Viro, P. J. 1969. Prescribed burning in forestry. Metsan tutkimuslaitoksen Julkaisuja. 67: 1-49. [22493]
  • 56. Vogel, Willis G. 1981. A guide for revegetating coal minespoils in the eastern United States. Gen. Tech. Rep. NE-68. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 190 p. [15577]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance to Livestock and Wildlife

The pine grosbeak feeds on the terminal and lateral buds of Scots pine.
Porcupines consume the bark, and girdle small trees. White-tailed deer
will browse Scots pine [10]. Moose browse it in Scandinavia and Russia
[25,34].
  • 10. Conover, M. R.; Kania, G. S. 1988. Browsing preference of white-tailed deer for different ornamental species. Wildlife Society Bulletin. 16: 175-179. [8933]
  • 25. Danell, Kjell; Niemela, Pekka; Varvikko, Tuomo; Vuorisalo, Timo. 1991. Moose browsing on Scots pine along a gradient of plant productivity. Ecology. 72(5): 1624-1633. [26103]
  • 34. Niemela, P.; Danell, K. 1988. Comparison of moose browsing on Scots pine (Pinus sylvestris) and lodgepole pine (P. contorta). Journal of Applied Ecology. 25: 761-775. [7915]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivation

Scots Pine prefers full sun, moist to dry conditions that are well-drained, and an acidic sandy soil, although it also adapts to other kinds of soil. Young trees usually grow fairly rapidly, while the growth of older trees is slower. Because of disease, insect pests, and climatic factors, Scots Pine can be short-lived, but at favorable sites longevity is typically 150-300 years.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Palatability

When compared to other ornamental species, Scots pine is low in
preference for white-tailed deer [10].
  • 10. Conover, M. R.; Kania, G. S. 1988. Browsing preference of white-tailed deer for different ornamental species. Wildlife Society Bulletin. 16: 175-179. [8933]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wood Products Value

Scots pine is used for pulpwood and sawlogs [42].
  • 42. Skilling, Darroll D. 1990. Pinus sylvestris L. Scots pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 489-496. [13409]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Scots Pine

Scots Pine (Pinus sylvestris) is a species of pine native to Europe and Asia, ranging from Scotland, Ireland and Portugal in the west, east to eastern Siberia, south to the Caucasus Mountains, and as far north as well inside the Arctic Circle in Scandinavia (including Sápmi). In the north of its range, it occurs from sea level to 1,000 m, while in the south of its range it is a high altitude mountain tree, growing at 1,200–2,600 m altitude. It is readily identified by its combination of fairly short, blue-green leaves and orange-red bark.[2][3][4][5]

Contents

Botany [edit]

Leaves and cones, Poland
Seedling with flatter, unpaired juvenile leaves
Ripe pollen cones, Poland

Pinus sylvestris is an evergreen coniferous tree growing up to 35 m in height[6] and 1 m trunk diameter when mature, exceptionally to 45 m tall and 1.7 m trunk diameter[citation needed] and on very productive sites (in Estonia, there are some 220 year old trees that are 46 metres tall in the forests of Järvselja[7]). The bark is thick, scaly dark grey-brown on the lower trunk, and thin, flaky and orange on the upper trunk and branches. The habit of the mature tree is distinctive due to its long, bare and straight trunk topped by a rounded or flat-topped mass of foliage. The lifespan is normally 150–300 years, with the oldest recorded specimens (in Sweden and Norway) just over 700 years.[2][3][4][8]

The shoots are light brown, with a spirally arranged scale-like pattern. On mature trees the leaves ('needles') are a glaucous blue-green, often darker green to dark yellow-green in winter, 2.5–5 cm long and 1–2 mm broad, produced in fascicles of two with a persistent grey 5–10 mm basal sheath; on vigorous young trees the leaves can be twice as long, and occasionally occur in fascicles of three or four on the tips of strong shoots. Leaf persistence varies from two to four years in warmer climates, and up to nine years in subarctic regions. Seedlings up to one year old bear juvenile leaves; these are single (not in pairs), 2–3 cm long, flattened, with a serrated margin.[2][4][8]

Mature open cones and seeds

The seed cones are red at pollination, then pale brown, globose and 4–8 mm diameter in their first year, expanding to full size in their second year, pointed ovoid-conic, green, then grey-green to yellow-brown at maturity, 3-7.5 cm in length. The cone scales have a flat to pyramidal apophysis, with a small prickle on the umbo. The seeds are blackish, 3–5 mm long with a pale brown 12–20 mm wing; they are released when the cones open in spring 22–24 months after pollination. The pollen cones are yellow, occasionally pink, 8–12 mm long; pollen release is in mid to late spring.[2][4][8]

Taxonomy [edit]

Pinus sylvestris var. hamata, Crimea

Over 100 Pinus sylvestris varieties have been described in the botanical literature, but only three or four are now accepted; they differ only minimally in morphology, but with more pronounced differences in genetic analysis and resin composition. Populations in westernmost Scotland are genetically distinct from those in the rest of Scotland and northern Europe, but not sufficiently to have been distinguished as a separate botanical variety. Trees in the far north of the range were formerly sometimes treated as var. lapponica, but the differences are clinal and it is not genetically distinct.[2][3][5][9][10][11][12][13][14][15]

  • Pinus sylvestris var. sylvestris. The bulk of the range, from Scotland and Spain to central Siberia. Described above.
  • Pinus sylvestris var. hamata Steven. The Balkans, northern Turkey, Crimea, and the Caucasus. Foliage more consistently glaucous all year, not becoming duller in winter; cones more frequently with a pyramidal apophysis.
  • Pinus sylvestris var. mongolica Litv. Mongolia and adjoining parts of southern Siberia and northwestern China. Foliage duller green, shoots grey-green; leaves occasionally up to 12 cm long.
  • Pinus sylvestris var. nevadensis D.H.Christ. The Sierra Nevada in southern Spain and possibly other Spanish populations (not considered distinct from var. sylvestris by all authors) Kalenicz. Ex Kom. Cones often with thicker scales, but doubtfully distinguishable on morphology.
  • Pinus sylvestris var. cretacea Kalenicz. ex Kom. From border regions between Russia and Ukraine.[16]

Distribution [edit]

Scots Pine is the only pine native to northern Europe, forming either pure forests or alongside Norway Spruce, Common Juniper, Silver Birch, European Rowan, Eurasian Aspen and other hardwood species. In central and southern Europe, it occurs with numerous additional species, including European Black Pine, Mountain Pine, Macedonian Pine, and Swiss Pine. In the eastern part of its range, it also occurs with Siberian Pine among other trees.[3][4]

British Isles [edit]

Scattered survivors (two recently dead) of extensive deforestation at Glen Quoich, Scotland

The tree spread across the British Isles after the Last Glacial Maximum. Pollen records show that pine was present locally in southern England by 9,000 years ago having entered from northeast France and that it had spread as far north as the Lake District and North Pennines 500 years latter.

It was present in Ireland over 8,800 years ago but absent from Wales at that time which suggests that Scots Pine in Ireland had a separate Iberian origin. Pine expanded into Scotland between 8,000 and 8,500 years ago either from an independent refuge, from Scandinavia (via ‘Doggerland’) or from Ireland. As the climate warmed it became extinct from most of the British Isles around 5,500 years ago except in Scotland and at Kielder, Northumberland.

The Irish and Western Scottish populations went through a massive decline around 4000 years ago which ultimately led to the extinction of the Irish population between 2,000 and 1,000 years ago. It was replaced by large areas of blanket bog in Western Scotland and Ireland though the reasons for its decline nor its extinction in England are clear, but it may have been influenced by human activities.[17]

In Britain it now occurs naturally only in Scotland, but historical and archaeological records indicate that it also occurred in Wales and England until about 300–400 years ago, becoming extinct there due to over-exploitation and grazing; it has been re-introduced in these countries. Similar historical extinction and re-introduction applies to Ireland, Denmark and the Netherlands.[4][5][8][18] Whether it truly became extinct in England is unknown; it has been speculated that it may have survived wild long enough for trees used in cultivation in England to derive from native (rather than imported) sources.[19] Shakespeare (in Richard II) was familiar with the species in the 1590s, as was Evelyn in the early 1660s (Sylva), both around the time when Scots Pine was thought to become extinct in England, but when landowners were also beginning ornamental and forestry planting.[19]

It is the national tree of Scotland, and it formed much of the Caledonian Forest which once covered much of the Scottish Highlands. Overcutting for timber demand, fire, overgrazing by sheep and deer, and even deliberate clearance to deter wolves have all been factors in the decline of this once great pine and birch forest. Only comparatively small areas (17,000 ha, only just over 1% of the estimated original 1,500,000 ha) of this ancient forest remain, the main surviving remnants being at Abernethy Forest, Glen Affric, Rothiemurchus Forest, and the Black Wood of Rannoch. Plans are currently in progress to restore at least some areas and work has started at key sites.[4][8]

Cultivation and uses [edit]

Pinus sylvestris – Botanical plate
Pinus sylvestris – Scots Pine wood
Bark on a mature Pinus sylvestris tree
Looking up into the branch structure of a Pinus sylvestris tree

Scots Pine is an important tree in forestry. The wood is used for pulp and sawn timber products. A seedling stand can be created by planting, sowing or natural regeneration. Commercial plantation rotations vary between 50–120 years, with longer rotations in northeastern areas where growth is slower.

In Scandinavian countries, Scots Pine was used for making tar in the pre-industrial age. There are still some active tar producers, but mostly the industry has ceased to exist.[8][9] The pine has also been used as a source of rosin and turpentine.

The wood is pale brown to red-brown, and used for general construction work. It has a dry density of around 470 kg/m3 (varying with growth conditions), an open porosity of 60%, a fibre saturation point of 0.25 kg/kg and a saturation moisture content of 1.60 kg/kg.[9]

Scots Pine has also been widely planted in New Zealand and much of the colder regions of North America; it was one of the first trees introduced to North America, in about 1600.[20] It is listed as an invasive species in some areas there, including Ontario,[21] Michigan[22] and Wisconsin.[23] It has been widely used in the United States for the Christmas tree trade, and was one of the most popular Christmas trees from the 1950s through the 1980s. It remains popular for that usage, though it has been eclipsed in popularity, by such species as Fraser Fir, Douglas-fir, and others. Despite its invasiveness in parts of eastern North America, Scots Pine does not often grow well there, partly due to climate and soil differences between its native habitat and that of North America, and partly due to damage by pests and diseases; the tree often grows in a twisted, haphazard manner if not tended to (as they are in the Christmas tree trade).[3][24] Scots Pines may be killed by the pine wood nematode, which causes pine wilt disease. The nematode most often attacks trees that are at least ten years old and often kills invaded trees within a few weeks.[25]

Several cultivars are grown for ornamental purposes in parks and large gardens, and the following have gained the Royal Horticultural Society's Award of Garden Merit:

Names [edit]

In the past (pre-18th century) this species was more often known as "Scots Fir" or "Scotch Fir".

Other names sometimes used include Riga Pine and Norway Pine, and Mongolian Pine for var. mongolica. "Scotch Pine" is another variant of the common name, used mostly in North America.[29]

The timber from it is also called red deal or yellow deal.

Another name, although less common, is European Redwood [30]

References [edit]

  1. ^ Conifer Specialist Group (1998). Pinus sylvestris. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 12 May 2006.
  2. ^ a b c d e Farjon, A. (2005). Pines Drawings and Descriptions of the Genus Pinus 2nd ed. Brill ISBN 90-04-13916-8.
  3. ^ a b c d e Gymnosperm Database: Pinus sylvestris
  4. ^ a b c d e f g Trees for Life: Species profile: Scots pine
  5. ^ a b c Mirov, N. T. (1967). The Genus Pinus. Ronald Press.
  6. ^ Rushforth, Keith (1986) [1980]. Bäume [Pocket Guide to Trees] (in German) (2nd ed.). Bern: Hallwag AG. ISBN 3-444-70130-6. 
  7. ^ (Estonian) Laas, Eino (2004). Okaspuud. Tartu: Atlex. p. 208. ISBN 9985-9489-7-1. 
  8. ^ a b c d e f Steven, H. M., & Carlisle, A. (1959, facsimile reprint 1996). The Native Pinewoods of Scotland. Castlepoint Press.
  9. ^ a b c Pravdin, L. F. (1969). Scots Pine. Variation, intraspecific Taxonomy and Selection. Israel Program for Scientific Translations (originally published 1964 in Russian).
  10. ^ Langlet, O. (1959). A Cline or not a Cline – a Question of Scots Pine. Silvae Genetica 8: 13–22.
  11. ^ Kinloch, B. B., Westfall, R. D., & Forrest, G. I. (1986). Caledonian Scots Pine: Origins and Genetic Structure. New Phytologist 104: 703–729.
  12. ^ Szmidt, A. E., & Wang, X-R. (1993). Molecular systematics and genetic differentiation of Pinus sylvestris (L.) and P. densiflora (Sieb. et Zucc.). Theoret. Appl. Genet. 86: 159–165.
  13. ^ Prus-Glowacki, W., & Stephan, B. R. (1994). Genetic variation of Pinus sylvestris from Spain in Relation to Other European Populations. Silvae Genetica 43: 7–14.
  14. ^ Goncharenko, G. G., Silin, A. E., & Padutov, V. E. (1995). Intra- and interspecific genetic differentiation in closely related pines from Pinus subsection Sylvestres (Pinaceae) in the former Soviet Union. Pl. Syst. Evol. 194: 39–54.
  15. ^ Sinclair, W. T., Morman, J. D., & Ennos, R. A. (1999). The postglacial history of Scots pine (Pinus sylvestris L.) in western Europe: evidence from mitochondrial DNA variation. Molec. Ecol. 8: 83–88.
  16. ^ Red Book of Russia. Pinus Sylvestris L. Var. Cretacea Kalenicz. Ex Kom
  17. ^ Milner, Edward (2011). "Trees of Britain andIreland". Flora: pages 15 and 120. 
  18. ^ Carlisle, A., & Brown, A. H. F. (1968). Biological Flora of the British Isles: Pinus sylvestris L. J. Ecol. 56: 269–307.
  19. ^ a b Edlin, H. L. (1970). Trees, Woods and Man, 3rd ed. Collins: New Naturalist.
  20. ^ Moore, G., Kershner, B., Tufts, C., Mathews, D, Nelson, G., Spellenberg, R., Thieret, J. W., Purinton, T., & Block, A. (2008). National Wildlife Federation Field Guide to Trees of North America. New York: Sterling. p. 67. ISBN 1-4027-3875-7. 
  21. ^ "Invasive Ontario Plants". Protect Our Water and Environmental Resources. Retrieved 17 December 2011. 
  22. ^ "Species found in Michigan". Early Detection and Distribution Mapping System. Center for Invasive Species and Ecosystem Health at the University of Georgia. Retrieved 17 December 2011. 
  23. ^ "Terrestrial Invasives". Invasive Species. Wisconsin Department of Natural Resources. Retrieved 17 December 2011. 
  24. ^ Fire Effects Information System: Pinus sylvestris
  25. ^ http://extension.missouri.edu/explorepdf/miscpubs/mx0858.pdf
  26. ^ http://apps.rhs.org.uk/plantselector/plant?plantid=1483
  27. ^ http://apps.rhs.org.uk/plantselector/plant?plantid=1484
  28. ^ http://apps.rhs.org.uk/plantselector/plant?plantid=5573
  29. ^ Germplasm Resources Information Network: Pinus sylvestris.
  30. ^ Timber Trade Federation
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!