Abronia graminea — Details

Terrestrial Arboreal Alligator Lizard learn more about names for this taxon

Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Distribution

Range Description

Learn more about this article

This species is endemic to the highlands of the States of Veracruz and adjacent Puebla, Mexico. It has an elevational range of 1,350 to 2,743 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Continent: Middle-America
Distribution: Mexico (C Veracruz, E Puebla, Oaxaca)  
Type locality: Orizaba, Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Physical Description

Type Information

Learn more about this article

Lectotype; Syntype for Abronia graminea
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Orizaba, Veracruz, Mexico
  • Lectotype: Good, D. A. 1988. Univ. California Publ. Zool. 121: 99.; Cope, E. D. 1864. Proc. Acad. Nat. Sci. Philadelphia. 16: 179.; Syntype: Good, D. A. 1988. Univ. California Publ. Zool. 121: 99.; Cope, E. D. 1864. Proc. Acad. Nat. Sci. Philadelphia. 16: 179.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Paralectotype for Abronia graminea
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Orizaba, Veracruz, Mexico
  • Paralectotype: Good, D. A. 1988. Univ. California Publ. Zool. 121: 99.; Cope, E. D. 1864. Proc. Acad. Nat. Sci. Philadelphia. 16: 179.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Paralectotype for Abronia graminea
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Orizaba, Veracruz, Mexico
  • Paralectotype: Good, D. A. 1988. Univ. California Publ. Zool. 121: 99.; Cope, E. D. 1864. Proc. Acad. Nat. Sci. Philadelphia. 16: 179.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Paralectotype for Abronia graminea
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Orizaba, Veracruz, Mexico
  • Paralectotype: Good, D. A. 1988. Univ. California Publ. Zool. 121: 99.; Cope, E. D. 1864. Proc. Acad. Nat. Sci. Philadelphia. 16: 179.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Habitat and Ecology

Learn more about this article

Habitat and Ecology
Animals inhabit bromeliads in the canopy of montane pine-oak and cloud forest. It seems unlikely that this species can be found in degraded habitat. This is a viviparous species.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Abronia graminea

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC0042-06|AB080273|Abronia graminea| ACTCGCTGACTATTCTCAACTAACCATAAAGACATCGGTACTCTCTACTTAATATTCGGAGCCTGAGCAGGCATAGTAGGAACCGCCCTT---AGCCTACTAATTCGAGCAGAATTAAGCCAACCAGGCGCCCTTCTGGGCGAT---GACCAAATTTACAACGTTATTGTTACCGCCCATGCCTTTGTAATAATCTTCTTCATAGTTATACCTATCATAATCGGAGGCTTCGGAAATTGACTAGTCCCATTAATA---ATTGGAGCCCCAGATATGGCTTTCCCACGAATAAATAATATAAGTTTTTGACTCCTTCCACCATCTCTACTCCTTCTTCTAGCATCTTCAGGCATTGAAGCAGGCGCTGGAACAGGATGAACTGTGTACCCACCACTTGCCGGAAACCTTGCTCATGCAGGTGCCTCAGTAGATCTA---ACTATCTTCTCCTTACATCTCGCAGGTATCTCCTCAATTCTGGGTGCAATCAACTTCATCACCACCTGCATCAACATAAAACACCCTTCAATATCGCAGTACCAAACCCCGTTATTTGTATGATCAGTTATAATCACAGCAGTTTTGTTACTATTATCACTTCCTGTTCTTGCTGCA---GGAATTACTATACTATTAACAGACCGCAACTTAAATACATCCTTTTTCGACCCTGCAGGAGGAGGAGACCCAATTCTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATACATCCTCATTTTACCCGGATTTGGAATAATCTCACACATTGTGACATACTATGCAGGTAAAAAA---GAGCCATTTGGCTACATAGGTATAGTCTGGGCTATAGTATCTATTGGCCTCCTTGGATTTATTGTCTGAGCACATCATATATTTACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Abronia graminea

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article


Red List Category
EN
Endangered

Red List Criteria
B1ab(iii)

Version
3.1

Year Assessed
2007

Assessor/s
Flores-Villela, O. & Santos-Barrera, G.

Reviewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)

Justification
Listed as Endangered, as the extent of occurrence is less than 3,000 km², populations are severely fragmented and there is a continuing decline in the area and quality of forest habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Population

Learn more about this article

Population
It is considered to be moderately common and is regularly recorded.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Threats

Threats

Learn more about this article

Major Threats
The species is threatened by deforestation and degradation of habitat, largely through the conversion of land to agricultural use. The pet trade is a potential threat to this species; current levels of exploitation are unclear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions
It occurs in two protected areas, in el Cañon Rio Blanco and Pico de Orizaba National Park. This species is protected by Mexican law under the category Pr (Special Protection). Further studies are needed for this little know species, including research into current levels of exploitation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Wikipedia

Abronia graminea

Learn more about this article

Abronia graminea is an endangered arboreal alligator lizard described in 1864 by Cope.

This species is endemic to the highlands of the States of Veracruz and adjacent Puebla, Mexico. It is considered to be moderately common and is regularly recorded, but it's decreasing. Animals inhabit bromeliads in the canopy of montane pine-oak and cloud forest. It seems unlikely that this species can be found in degraded habitat. This is a viviparous species. The species is threatened by deforestation and degradation of habitat, largely through the conversion of land to agricultural use. The pet trade is a potential aid to the preservation of this species through captive breeding programs.

References

  1. ^ Flores-Villela, O. & Santos-Barrera, G. (2007). Abronia graminea. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 18 February 2009.
Stub iconThis lizard article is a stub. You can help Wikipedia by expanding it.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!