Overview

Brief Summary

Biology

The Antsingy leaf chameleon lives amongst the leaf litter and on low branches on or close to the forest floor where it feeds on small insects such as small flies and termites (4). It stalks prey slowly and, when within range, flicks out its muscular tongue at great speed, catching the prey on the tongue tip and pulling it back into the mouth (6). In the tropical climate of Madagascar, reproduction occurs mainly during the rainy season (2). The Antsingy leaf chameleon, like most other chameleons, is oviparous (5). Females lay their eggs in soft soil or piles of dead foliage on the forest floor, where natural decomposition of the leaves provides a constant level of heat and humidity (7). Hatching occurs after four to six weeks, and there may be two to five eggs per clutch, with females laying two clutches per year (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The Antsingy leaf chameleon is much smaller than most chameleons, but is the largest of the Brookesia (dwarf) chameleon species. It has a limited ability to change colour and looks like a tiny armoured dragon, with thorny spines running down its back and sides (2). It is dull in colouration, with a dark brown body and a lighter brown head. This suits its lifestyle though, as it hides amongst the dead leaf litter, and is therefore well camouflaged (4). As a forest floor dwelling chameleon this species does not have a prehensile tail to assist tree climbing. Instead, its tail is short and stumped, and also has spines running down it (5). Its eyes have two rounded crests behind them, and are almost completely covered by brown eyelids, leaving only a narrow opening (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Antsingy leaf chameleon (Brookesia perarmata)

The Antsingy leaf chameleon is found in the northern part of the Tsingy de Bemaraha National Park in the Melaky Region of western Madagascar (1,2,13). It seems to prefer relatively intact primary forest or relatively untouched tropical deciduous forests where there is a dense cover of leaf litter, to provide food, and a relatively well developed understorey (11). Historic collection pressure and altitude may influence current patterns of abundance. tat requirements. It exists in primary The chameleon has a limited ability to change colour and looks like a tiny armoured dragon, with thorny spines running down its back and sides (2). It has a dark brown body and lighter brown head. This provides camouflage, helping it hide amongst dead leaf litter (4). As it lives on the forest floor, it does not have a prehensile tail to aid tree climbing. Its short, stumpy tail has spines running down it (5). Its eyes have two rounded crests behind them and are almost completely covered by brown eyelids, leaving only a narrow opening (5).

The chameleon lives amongst leaf litter and on low branches on or near to the forest floor. It roosts on low lying twigs, shrubs, leaves, green stems and other vegetation at night (2,12); females make more use of leaves than do males (12). It slowly stalks small flies, termites and other small insects (4). When they are within range, it quickly flicks out its muscular tongue, catching the prey on the tongue tip and pulling it back into the mouth (6). Reproduction occurs mainly in the rainy season (2). The chameleon is oviparous (5). Females lay 2-5 eggs in soft soil or piles of dead foliage on the forest floor, where natural decomposition of the leaves provides a constant level of heat and humidity (7). Hatching occurs after 4-6 weeks. Females lay two clutches a year (8).

The IUCN Red List Assessment in 2011 was "Endangered" (1,3) as the species is known only from the Bemaraha Massif, where it is thought to have an extent of occurrence of @ 400 km². The highest densities are in the eastern forest of Bendrao (11). Its habitat is undergoing a continuing decline due to timber extraction (charcoal and construction), overgrazing and fire (1,2,5,10,11). Most of the range is within a protected area complex and is afforded nominal protection. The Antsingy leaf chameleon is listed on Appendix I of the Convention on International Trade of Endangered Species (CITES), so international trade is illegal (3,9). Some adults may be illegally collected from the reserve, so there may be a continuing decline in the number of mature individuals (11). The survival of this species is not immediately threatened in the wild, but it is a conservation priority (1,2,10) and the population trend is decreasing.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Olingo

Supplier: Olingo

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Continent: Indian-Ocean
Distribution: W Madagascar  
Type locality: Antsingy, 300 m elevation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This species is endemic to Madagascar (1), a large island off East Africa's coast. There it is found in the northern part of the Tsingy de Bemaraha National Park in the Melaky Region (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

There is some evidence to suggest that the Antsingy leaf chameleon prefers relatively intact forest with high cover of leaf litter and a relatively well developed understorey (Randrianantoandro et al. 2008). However, other factors such as historic collection pressure and altitude may influence current patterns of abundance. Randrianantoandro et al. (2008) found no evidence of this lizard in the highly disturbed Ankazomanga forest to the east of the national park boundary. The Antsingy leaf chameleon is sympatric with B. exarmata and B. brygooi throughout its known range (Randrianantoandro et al. 2008). All three species use low lying vegetation for roosting on at night, and B. brygooi has been found to consistently use higher perch sites than B. perarmata or B. exarmata (Randrianantoandro et al. 2007). Antsingy leaf chameleons usually roosted on green stems, with females making more use of leaves than males (Randrianantoandro et al. 2007).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Like other members of the Brookesia genus, the Antsingy leaf chameleon has specific habitat requirements. It exists in primary or relatively untouched tropical deciduous forests where there is a dense leaf litter. This dense leaf litter is important as it provides food for the Antsingy leaf chameleon. During the night it perches on low twigs, stems and leaves (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brookesia perarmata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TATCGGCACTATATATTTTATATTTGGCTTAATAGCCGGTCTAATCGGAGCTACTTCAAGCCTTTTAATACGAACAAAACTATGTCAACCAGGGTTTTCCCTCGGTGACGATCACGCATATAATGTATTAATTACATTACATGGACTTACAATAATTTTTTTTATAGTAATACCAATTATAATCGGAGGATTTGGAAATTGATTAATTCCACTAATGCTAGGAACACCAGATATAGCCTTTCCACGCATAAACAATATAAGCTTCTGACTTCTACCACCATCATTCCTACTTCTTTTAGCCTCATCAAAAACTGGTGATGGTGTCGGCACAGGATGAACTATTTATCCCCCACTATCAGGAAATACAGCACATTCTGGACCATCAATAGACCTAGCTATTTTCTCATTACATTTAGCCGGAATCTCATCAATTCTGGCCTCAATTAACTTTATTACAACTAGTATTAATATAAAACCTCATCACATAGTTATATATAATCTCCCCCTATTTGTCTGATCAGTACTACTTACAGCAATTTTACTAATTTTAGCCCTTCCTGTTCTTGCTGCAGCAATTACTATACTTCTTACAGACCGAAACCTTAACACAGCATTTTTTGACCCAGTTGGAGGTGGAGACCCAATCTTATTCCAGCACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Brookesia perarmata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
B1ab(iii)

Version
3.1

Year Assessed
2011

Assessor/s
Jenkins, R.K.B., Andreone, F., Andriamazava, A., Anjeriniaina, M., Glaw, F., Rabibisoa, N., Rakotomalala, D., Randrianantoandro, J.C., Randrianiriana, J., Randrianizahana , H., Ratsoavina, F. & Robsomanitrandrasana, E.

Reviewer/s
Bowles, P. & Tolley, K.

Contributor/s

Justification
Listed as Endangered as the species is known only from the Bemaraha Massif, treated here as a single location, where it is thought to have an extent of occurrence of approximately 400 km and its habitat is undergoing a continuing decline due to timber extraction (charcoal and construction), overgrazing and fire. Some adults may also be illegally collected from the reserve, and so there may also be a continuing decline in the number of mature individuals.

History
  • 1996
    Vulnerable (VU)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Listed as Vulnerable (VU) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

Based on nocturnal transects at four sites in the north of Parc National Tsingy de Bemaraha, population density varies between 1.4 ha-1(0.57-3.17 95% confidence interval) and 98.9-1 ha (51.9-188.36 95% confidence interval) with highest densities in the eastern forest of Bendrao (Randrianantoandro et al. 2008). Expressed as abundance per 100 m, estimates ranged from 0.2 0.07 to 3.4 0.79 (Randrianantoandro et al. 2008).


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Threats in Parc National Tsingy de Bemaraha are mainly from habitat alteration as a result of timber extraction (charcoal and construction), overgrazing and fire (Randrianantoandro et al. 2008).Accounts of illegal animal collection continue to come from the park and B. perarmata isstill taken, but on current evidence this is not a major threat to the species (Randrianantoandro et al. 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Chameleons are favoured as pets across the world due to their fascinating appearance and behaviour. Collection and trade has therefore taken its toll on many chameleon species, but international trade in this species is now prohibited (9). However, habitat degradation remains a threat, even though the species is found within a national park. As this species depends on the presence of leaf litter for food, shelter and laying its eggs, and also on low shrubs and seedlings for roosting at night, its survival is dependent on maintaining the existing vegetation structure within the Tsingy forests (5) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The majority of this lizard's range is within a protected area complex, and is thus afforded nominal protection. The status of the deciduous forest in the Rserve Naturelle Intgrale de Bemaraha is poorly documented because, although this is a protected area, the security situation is unfavourable for park agents to perform regular patrols. Research is needed into population trends and the effects of any illegal harvest for the pet trade, and the species' presence and the extent of its distribution in the Rserve Naturelle Intgrale de Bemaraha should be established when this becomes feasible. Efforts should be made to improve the security of the protected areas to allow proper enforcement of conservation measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The Antsingy leaf chameleon is listed on Appendix I of the Convention on International Trade of Endangered Species (CITES), and as such international trade of this species is illegal (3). Its survival is not immediately threatened in the wild, although it is still justifiably a conservation priority because of its limited range and the continued degradation of its favoured habitats within the national park (1) (2) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Antsingy leaf chameleon

The Antsingy leaf chameleon (Brookesia perarmata) is a species of lizard in the Chamaeleonidae family. It is endemic to Madagascar.

References[edit]

  1. ^ Andreone, F., Andriamazava, A., Anjeriniaina, M., Glaw, F., Jenkins, R.K.B., Rabibisoa, N., Rakotomalala, D., Randrianantoandro, J.C., Randrianiriana, J., Randrianizahana , H., Ratsoavina, F. & Robsomanitrandrasana, E. (2011). "Brookesia perarmata". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 22 August 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!