Overview

Brief Summary

Calotes versicolor is an oviparous, arboreal, insectivorous lizard found in India and across Asia. The lizard is very successful due to its ability to thrive in urban and other highly human-influenced environments, and thus occupies a very widespread geographic range. Males are highly recognizable due to the vibrant crimson coloring they adopt during the breeding season (Enge and Krysko 2004). Female coloration also changes during breeding, but the change is less dramatic than in males. The species is unique in that it lacks identifiable sex chromosomes; male sex reversal during development is influenced by testosterone levels as opposed to estradiol, as in other reptiles that lack temperature-dependent sex determination. Thus, female is the default sex in this agamid lizard (Ganesh and Raman 1995).

Enge, K. M. and K. L. Krysko. 2004. A new exotic species in Florida, the Bloodsucker Lizard, Calotes versicolor (Daudin 1802) (Sauria: Agamidae). Florida Scientist 67: 226-230.

Ganesh, S. and R. Raman. 1995. Sex reversal by testosterone and not by estradiol or temperature in Calotes versicolor, the lizard lacking sex chromosomes. Journal of Experimental Zoology 271: 139-144.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Brief

2 separated spines above tympanum
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Calotes versicolor occupies a wide geographic range and is considered the most widespread species of its genus. Its range extends from southeastern Iran and Afghanistan east to Indo-China and south to Sri Lanka, Sumatra, and northern peninsular Malaysia. Calotes versicolor is also found in southern Florida, having been introduced there in the 1970s. The lizard is incredible adaptable, thrives in human-altered environments, and is even able to survive in urban areas (Enge and Krysko 2004).

Enge, K. M. and K. L. Krysko. 2004. A new exotic species in Florida, the Bloodsucker Lizard, Calotes versicolor (Daudin 1802) (Sauria: Agamidae). Florida Scientist 67: 226-230.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Widespread in India
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Near-East Asia Indian-Ocean
Distribution: SE Iran, Afghanistan, Pakistan, Nepal, Bhutan, India (Andaman Island and mainland India), Sri Lanka (Ceylon), Bangladesh, Burma (= Myanmar), Thailand, W Malaysia, Vietnam, e.g. Pulo Condore Island, Cambodia, S China (Yunnan, Guangdong, Guangxi, Honkong, Hainan Island), Maldives  Indonesia (Sumatra), Singapore,   Introduced to Celebes, Maldives, Seychelles, USA (Florida) Mauritius (Reunion, Rodrigues; fide Glaw, pers. comm. and ROGNER 2006) Introduced to Oman (fide VAN DER KOOIJ 2001) and Borneo (DAS et al. 2009).  
Type locality: not given; designated by SMITH 1935 as “Pondicherry”.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Calotes versicolor has lateral body scales pointing backwards and upwards, two disconnected spines above the tympanum, and from 35 to 52 scales around the body. Calotes versicolor exhibits great variation across its wide geographic range. Despite the variation, only two subspecies have been described. Adults have crests that extend from the neck almost to the tail, laterally flattened bodies, colossal shoulders, and large heads. Their coloring is typically dull brown, olive, or gray with some irregular dark brown patterning, such as large spots. Breeding males differ in that they have light yellow bodies with a black patch on each side of the throat, and also develop bright red or orange patches around the head and shoulders. However, the vibrant coloration found in breeding males (and in breeding females, though less vibrant) is subject to change depending on mood or environmental conditions. The bright red coloration is also responsible for one of the lizard’s more imaginative common names: the Bloodsucker Lizard (Enge and Krysko 2004).

According to a study done in 2002 using a population from Hainan, southern China, males and females do not exhibit sexual dimorphism in snout-vent length, but males develop longer tails than do females (Ji et al. 2002b). Both males and females have crests and incredibly long tails relative to body size, which is most likely due to the fact that the species is arboreal, and long tails help with balance.

Enge, K. M. and K. L. Krysko. 2004. A new exotic species in Florida, the Bloodsucker Lizard, Calotes versicolor (Daudin 1802) (Sauria: Agamidae). Florida Scientist 67: 226-230.

Ji, X., Q-B. Qiu, and C-H. Diong. 2002b. Sexual dimorphism and female reproductive characteristics in the Oriental garden lizard, Calotes versicolor, from a population in Hainan, southern China. Journal of Herpetology 36: 1–8.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Snout-vent length ranges from 70 to 140 mm. The slender tail ranges from around 220 to 320 mm in length. It is difficult to determine the exact mean values because of the great variation seen across populations (Enge and Krysko 2004; Ji et al. 2002b).

Enge, K. M. and K. L. Krysko. 2004. A new exotic species in Florida, the Bloodsucker Lizard, Calotes versicolor (Daudin 1802) (Sauria: Agamidae). Florida Scientist 67: 226-230.

Ji, X., Q-B. Qiu, and C-H. Diong. 2002b. Sexual dimorphism and female reproductive characteristics in the oriental garden lizard,Calotes versicolor, from a population in Hainan, southern China. Journal of Herpetology 36: 1–8.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Calotes versicolor is an arboreal species (Enge and Krysko 2004).

Enge, K. M. and K. L. Krysko. 2004. A new exotic species in Florida, the Bloodsucker Lizard, Calotes versicolor (Daudin 1802) (Sauria: Agamidae). Florida Scientist 67: 226-230.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

Plains and midland forests
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Calotes versicolor prey mainly on insects but also feed on smaller invertebrates, such as rodents and lizards (Enge and Krysko 2004).

Enge, K. M. and K. L. Krysko. 2004. A new exotic species in Florida, the Bloodsucker Lizard, Calotes versicolor (Daudin 1802) (Sauria: Agamidae). Florida Scientist 67: 226-230.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Hunting/foraging behavior:

Adults dwell in trees and use a head-down method to search for any prey—insects or small vertebrates—located below. This is different from the method utilized by juveniles, which prefer to forage at ground-level (Enge and Krysko 2004).

Mating behavior:

The breeding period in their natural range extends from May to early October, beginning with the onset of the southwest monsoon. In other parts of the world, the breeding period aligns with increased rainfall (Pandav et al. 2012).

The development of black patches on the neck region signifies the attainment of sexual maturity. Courtship behavior is extensive, including chases, circling, head bobs, extension of the dewlap, push-ups, neck biting. Change in body color is the first step towards the initiation of courtship. Males choose display sites from which to impress the females; females show their acceptance of the offer using a single head bob and a four-leg push-up display. When the male mounts the female, he uses a neck-bite hold and front-leg hold on the female’s trunk and brings his cloaca in contact with hers in order to insert his hemipenis and complete copulation. After copulation, body color of both male and female returns to normal (after only around 5 seconds) and the female displays submissive behavior. The entire courtship/mating process takes anywhere from 3 to 18 minutes (Pandav et al. 2007).

Enge, K. M. and K. L. Krysko. 2004. A new exotic species in Florida, the Bloodsucker Lizard, Calotes versicolor (Daudin 1802) (Sauria: Agamidae). Florida Scientist 67: 226-230.

Pandav, B. N., S. K. Saidapur, and B. A. Shanbhang. 2007. Ethogram of courtship and mating behavior of garden lizard, Calotes versicolor. Current Science 93: 1164-1167.

Pandav, B. N., S. K. Saidapur, B. A. Shanbhag. 2012. Expression of phenotypic plasticity in hatchlings of the lizard Calotes versicolor (Squamata: Agamidae): influence of nest moisture. Phyllomedusa 11: 13-20.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Life expectancy in captivity is about 5 years. The lizards are relatively short-lived and mature early, at around 9-12 months of age (Pandav et al. 2007; Tinkle 1969).

Pandav, B. N., S. K. Saidapur, B. A. Shanbhang. 2007. Ethogram of courtship and mating behavior of garden lizard, Calotes versicolor. Current Science 93: 1164-1167.

Tinkle, D. W. 1969. The concept of reproductive effort and Its relation to the evolution of life histories of lizards. American Naturalist 103: 501-516.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5 years (captivity) Observations: Some results suggest gradual senescence in these animals (Patnaik 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Development:

Calotes versicolor is an oviparous lizard with an egg-laying period that extends from July through December. Females tend to lay all of their mature eggs in one sequence, typically after a thorough rain (Muthukkaruppan et al. 1970).

The embryos of Calotes versicolor grow continuously and gradually throughout the incubation period, which lasts from 40 to 80 days depending on moisture levels of the nest (dry nests tend to extend the incubation period) and also on geographic location (Muthukkaruppan et al. 1970; Pandav et al. 2012).

Calotes versicolor lacks identifiable sex chromosomes, but sex determination is not temperature dependent. Testosterone causes reversal into the male sex. When this discovery was made in 1995, it was the first report of testosterone causing sex reversal in a reptile. Sex reversal is usually triggered by the presence of estradiol (Ganesh and Raman 1995).

Though temperature is not involved in sex determination, incubation temperature does increase hatching success and affect body size (Ji et al. 2002a). Hatchlings incubated at higher temperatures (33 degrees C) tended to be smaller, with shorter limbs as compared to those incubated at lower temperatures. Incubation at high temperatures adversely affects the hatchlings and may produce the highest level of asymmetry. Incubation at prolonged high temperatures appears to be lethal.

Maternal snout-vent length determines clutch mass, while breeding timing influences clutch and egg size. Clutch size is larger in early and midbreeders than in late breeders, perhaps because of the wetter conditions present earlier in the breeding season. However, egg size in late clutches is greater than that in the clutches of early breeders. In general, clutch size and clutch mass are positively correlated with body size, and egg mass and volume are negatively correlated with clutch size (Shanbhag et al. 2000).

Juvenile lizards have much shorter tails relative to body length as compared with adults. This may be because the juvenile lizards spend most of their time foraging at ground level as opposed to thermoregulating and foraging in trees as adults do (Ji et al. 2002b).

Ganesh, S. and R. Raman. 1995. Sex reversal by testosterone and not by estradiol or temperature in Calotes versicolor, the lizard lacking sex chromosomes. Journal of Experimental Zoology 271: 139-144.

Ji, X., Q-B Qiu, and C-H Diong. 2002a. Influence of incubation temperature on hatching success, energy expenditure for embryonic development, and size and morphology of hatchlings in the Oriental garden lizard, Calotes versicolor (Agamidae). Journal of Experimental Zoology 292: 649-659.

Ji, X., Q-B. Qiu, and C-H. Diong. 2002b. Sexual dimorphism and female reproductive characteristics in the Oriental garden lizard, Calotes versicolor, from a population in Hainan, southern China. Journal of Herpetology 36: 1–8.

Muthukkaruppan, Vr., Kanakambika, P., Manickavel, V. and Veeraraghavan, K. 1970. Analysis of the development of the lizard, Calotes versicolor. I. A series of normal stages in the embryonic development. J. Morphol. 130: 479–489.

Pandav, B. N., S. K. Saidapur, B. A. Shanbhag. 2012. Expression of phenotypic plasticity in hatchlings of the lizard Calotes versicolor (Squamata: Agamidae): influence of nest moisture. Phyllomedusa 11: 13-20.

Shanbhag, B. A., R. S. Radder, S. K. Saidapur, and R. E. Gatten, Jr. 2000. Maternal size determines clutch mass, whereas breeding timing influences clutch and egg sizes in the tropical lizard, Calotes versicolor (Agamidae). Copeia 2000: 1062-1067.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calotes versicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCGATGACTACTCTCAACCAATCACAAAGATATCGGAACTTTATACTTCTTATTTGGTGCTGCGGCAGGCCTTACAGGCTCACTTGTAAGCCTTCTTGTACGAGCACAGTTAATACAACCAGGACAAGCCCTGGGCGGG---GACTCACTCTACAATGTTTTCATTACATTTCATGCACTGGTAATGATTTTCTTTATGGTTATGCCGATTATAATCGGCGGCTTCGGAAACTGATTAGTACCTTTGATGCTGGGGGCACCAGACATAGCATTTCCTCGAATAAACAACATAAGCTTCTGATTACTCCCCCCCTCATTTCTTCTTCTACTATTCTCATCGGGCTTTGAAACGGGAGTCGGAACAGGGTGAACTATTTATCCCCCACTTTCCAACAACATCGCTCACTCCGGACCCTCAATAGACCTTGCTATCTTCTCTTTACACCTAGCTGGGGCATCATCAATTCTTGGCGCCATTAATTTCATCACTACGTGCATCAACATAAGTCCCAGCCGCACCTCCCCATATAATTGACCCCTATTTGTTTGATCCGTTTTCTTTACTGCAACCCTACTTCTGCTTTCCCTCCCAGTATTAGCCGCTGCAATCACAATACTAATTACAGACCGCAACCTAAACACATCATTTTTTGAGCCATCTGGAGGGGGAGACCCGATCTTGTTCCAACACTTATTCTGATTTTTTGGACATCCAGAAGTTTATATTCTAATTTTACCTGGGTTCGGAATTATTTCACACATTGTAACACACTATTCAGGAAAAAAAGAACCTTTCGGGTACCATAGCATGGTATGAGCAATACTAGCTATTACAGTACTTGGGTTCGTCGTATGGGCTCACCACATATTTACAGTTGGCCTAGACATTGACACACGCGCCTACTTCTCCGCAGCAACAATAACAATTGCCATCCCCACTGGGATCAAGGTATTTAGCTGAACTGCAACCATTTTTGGAGGA---AAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calotes versicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Calotes versicolor has yet to be assessed for the IUCN Red List. It is currently abundant in the wild and is not facing any threat of endangerment or extinction.

IUCN 2013. IUCN Red List of Threatened Species. Version 2013.2. . Downloaded on 08 May 2014.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Since Calotes versicolor is so widespread due to its ability to remain relatively unaffected by human activities and urban development, it has had a significant effect on other species. For example, Calotes versicolor was so successful after being introduced on Singapore Island that it has nearly out-competed the native agamid lizard, the green crested lizard, Bronchocela cristatella (Ji et al. 2002b). Calotes versicolor has also had a significant negative effect on the other native and introduced reptile species in southern Florida (Enge and Krysko 2004).

Enge, K. M. and K. L. Krysko. 2004. A new exotic species in Florida, the Bloodsucker Lizard, Calotes versicolor (Daudin 1802) (Sauria: Agamidae). Florida Scientist 67: 226-230.

Ji, X., Q-B. Qiu, and C-H. Diong. 2002b. Sexual dimorphism and female reproductive characteristics in the Oriental garden lizard, Calotes versicolor, from a population in Hainan, southern China. Journal of Herpetology 36 :1–8.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Oriental garden lizard

The Oriental Garden Lizard, Eastern Garden Lizard or Changeable Lizard (Calotes versicolor) is an agamid lizard found widely distributed in Asia. It has also been introduced in many other parts of the world.

A female Clotes Versicolor. You can clearly see the scales and the spines on its neck
Clicked near Guruvayur, Kerala, India

It is an insectivore and the male gets a bright red throat in the breeding season leading to a common incorrect name of "Bloodsucker".

Description[edit]

Male in Dehradun
Male on Maldives
Mating Display colouration of Calotes versicolour, Ezhimala, Kerala, India, June 2012

It measures over 10 cm (3.9 in) in length snout-to-vent. Total length including the tail is up to 37 cm (14.5 in).[2] Two small groups of spines, perfectly separated from each other, above each tympanum. Dorsal crest moderately elevated on the neck and anterior part of the trunk, extending on to the root of the tail in large individuals, and gradually disappearing on the middle of the trunk in younger ones. No fold in front of the shoulder, but the scales behind the lower jaw are much smaller than the others; gular sac not developed. From thirty-nine to forty-three series of scales round the middle of the trunk. The hind foot (measured from the heel to the extremity of the fourth toe) is not much longer than the head in the adult, whilst it is considerably longer in the young. The coloration is very variable, sometimes uniform brownish or greyish-olive or yellowish. Generally broad brown bands across the back, interrupted by a yellowish lateral band. Black streaks radiate from the eye, and some of them are continued over the throat, running obliquely backwards, belly frequently with greyish longitudinal stripes, one along the median line being the most distinct; young and half-grown specimens have a dark, black-edged band across the inter-orbital region.

The ground-colour is generally a light brownish olive, but the lizard can change it to bright red, to black, and to a mixture of both. This change is sometimes confined to the head, at other times diffused over the whole body and tail. A common state in which it may be seen (as stated by Mr. Jerdon) is, seated on a hedge or bush, with the tail and limbs black, head and neck yellow picked out with red, and the rest of the body red. Jerdon and Blyth agree that these bright, changeable colours are peculiar to the male during the breeding-season, which falls in the months of May and June.

Mouhot has collected in Siam one of those fine variations of colours, which, however, appear to be infinite. It has the usual cross streaks between the eyes and the radiating lines continent of India to China; it is very common in Ceylon, not extending into the temperate zone of the Himalayas. Ceylonese specimens are generally somewhat larger; one of them measured 16 inches, the tail taking 11 inches. It is found in hedges and trees; it is known in Ceylon under the name of "Bloodsucker", a designation the origin of which cannot be satisfactorily traced; in the opinion of Kelaart, the name was given to it from the occasional reddish hue of the throat and neck. The female lays from five to sixteen soft oval eggs, about 5/8 of an inch long, in hollows of trees, or in holes in the soil which they have burrowed, afterward covering them up. The young appear in about eight or nine weeks. In a hot sunny day a solitary Bloodsucker may be seen on a twig or on a wall, basking in the sun, with mouth wide open. After a shower of rain numbers of them arc seen to come down on the ground and pick up the larva and small insects which fall from the trees during the showers.[3]

During the breeding season, the male's head and shoulders turns bright orange to crimson and his throat black. Males also turn red-headed after a successful battle with rivals. Thus their other gruesome name of "Bloodsucker Lizard" although they don't actually suck anybody's blood. Both males and females have a crest from the head to nearly the tail, hence their other common name "Crested Tree Lizard".

Changeable Lizards are related to iguanas (which are found only in the New World). Unlike other lizards, they do not drop their tails (autotomy), and their tails can be very long, stiff and pointy. Like other reptiles, they shed their skins. Like chameleons, Changeable Lizards can move each of their eyes in different directions.

Distribution[edit]

The native range of the species includes SE Iran, Afghanistan, Pakistan, Nepal, Bhutan, India (including the Andaman Islands and particularly common in mainland India), Sri Lanka (Ceylon), Myanmar, Thailand, Western Malaysia, Maldives, Vietnam, Cambodia, Pulo Condore Island, South China (Yunnan, Guangdong, Guangxi, Hongkong, Hainan Island), Indonesia (Sumatra), Mauritius (Reunion, Rodrigues). It has been introduced to Oman, Singapore, and United States. The lizards were introduced to Singapore from Malaysia and Thailand in the 1980s. In Singapore, they are a threat to the native Green-Crested Lizard.[4] The Changeable Lizard is relatively common and found in a wide range of habitats. They appear to adapt well to humans and are thus not endangered.

Diet[edit]

Changeable Lizards eat mainly insects and small vertebrates, including rodents and other lizards. Although they have teeth, these are designed for gripping prey and not tearing it up. So prey is swallowed whole, after it is stunned by shaking it about. Sometimes, young inexperienced Changeable Lizards may choke on prey which are too large. Occasionally changeable lizards also consume vegetable matter. They are commonly found among the undergrowth in open habitats including highly urban areas.

At Kandalama, Sri Lanka

Reproduction[edit]

Males become highly territorial during breeding season. They discourage intruding males by brightening their red heads and doing "push-ups". Each tries to attract a female by inflating his throat and drawing attention to his handsomely coloured head. About 10—20 eggs are laid, buried in moist soil. The eggs are long, spindle-shaped and covered with a leathery skin. They hatch in about 6–7 weeks. They are able to breed at about 1 year old.

Gallery[edit]

References[edit]

  1. ^ Calotes versicolor, Reptiles Database
  2. ^ [1] Ecology Asia
  3. ^ C. A. L. Guenther (1864) The Reptiles of British India.
  4. ^ http://www.wildsingapore.per.sg/discovery/factsheet/lizardchangeable.htm
  • Asana, J. 1931 The natural history of Calotes versicolor, the common blood sucker. J. Bombay Nat. Hist. Soc. 34: 1041-1047.
  • Devasahayam, S., and Anita Devasahayam. 1989. A peculiar food habit of the garden lizard Calotes versicolor(Daudin). J. Bombay Nat. Hist. Soc. 86:253.
  • Wildlife at Sungei Buloh Wetlands Reserve, by Ria Tan
  • Tiwaru, Manjula;Schiavina, Aurofilio 1990 Biology of the Indian garden lizard, Calotes versicolor (Daudin). Part I: Morphometrics Hamadryad 15: 30-33
  • Waltner, R.C. 1975 Geographical and altitudinal distribution of amphibians and reptiles in the Himalayas Cheetal (Dehra Dun, India) 16(1): 17-25; 16(2): 28-36; 16(3): 14-19; 16(4): 12-17.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!