Overview

Brief Summary

Biology

Chameleons are generally diurnal, solitary animals that are often aggressive towards members of their own species, which may be marked by rapid colour change and aggressive posturing (4). Opportunistic hunters, these lizards wait for prey to pass within range, and then fire out their long, sticky tongue to claim their victim (4). Little is known about the reproductive biology of this species, other than that it is egg-laying (oviparous) with a relatively short incubation period of seven to ten weeks (2). There are reports that two to three clutches are laid each year, with each clutch containing between 8 and 12 eggs (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This tiny chameleon varies from pale green to dark brown in colour, and is elaborately decorated with numerous small, light-coloured spots and three prominent pale bands running horizontally along the flanks (2). Red spots may also appear on the head, above the eye (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is endemic to Madagascar's central highlands, from Parc National d'Andringitra in the south to Ankaratra in the north (Brygoo 1971,Venceset al.2002,Glaw and Vences 2007, Randrianantoandro et al. 2010). Brygoo (1971) reported this species from Ibity, Ambohimitombo, Antobeba and Ambatolampy, but specimen evidence from these localities is apparently lacking (Vences et al. 2002).Andreone et al. (2007) reported that this species occurs in Antoetra and near Lake Mantasoa. This species is found between 1,850 and 2,643 m above sea-level, but probably occurs at lower elevations(Raxworthy and Nussbaum 1996, Andreone et al. 2007). The chameleon's extent of occurrence is estimated to be 14,513 km.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Indian-Ocean
Distribution: C Madagascar  
Type locality: Massif de l’Ankaratra, Madagascar [Spitze des Tsiafakfo (zwischen 19°-20°S und 47° und 48° E) Madagascar fide HALLERMANN, pers. comm.]
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Restricted to the central highlands of Madagascar, between Andringtrs and Antananarivo (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is mainly found in montane savanna habitats, including secondary heathland and savanna grasslands Although it occurs in sympatry with the widespread white-lined chameleon (Furcifer lateralis) throughout its range, it is clearly tolerant of a narrower range of abiotic conditions (Raxworthy and Nussbaum 1996, Vences et al. 2002).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species has been recorded between 1,850 and 2,300 m above sea level in residual high altitude forests and degraded areas, although reports also exist from grassy/shrubby savannah and high altitude prairies (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Furcifer campani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CATTGGCACTATATATTTTTTATTTGGGCTGGGCGCCGGCCTGATTGGAGCCACCTCAAGTCTTATTATACGGACCAAGCTAGGCCAGCCTGGATTCTCCCTTGGAGATGATCACGCGTACAATGTATTAATTACCTTGCACGGCCTTACCATAATCTTTTTTATGGTTATACCAATCATAATTGGTGGATTTGGTAACTGACTTGTACCACTAATGCTTGGTGCGCCAGATATAGCATTTCCACGGATAAATAACATAAGCTTCTGATTATTACCCCCCTCATTTTTATTATTGTTAGCCTCATCCAAAACAGGAGCGGGGGTTGGAACAGGATGAACTATTTATCCCCCCCTTTCAGGAAACATAGCCCATGCTGGCCCATCAATAGACCTAGCAATTTTTTCCCTGCACCTTGCCGGAATTTCATCTATTCTTGCCTCAATTAATTTTATTACAACAAGCATCAATATAAAACCACACCACATAGTACTGTACAATATCCCACTATTTGTCTGATCTGTTCTGCTAACTGCAATCCTTTTACTTCTAGCATTACCAGTACTAGCTGCAGCCATCACTATACTTCTCACAGATCGAAACCTTAACACAGCATTTTTTGACCCTGTAGGGGGAGGAGACCCAATCCTATTCCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Furcifer campani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(iii)

Version
3.1

Year Assessed
2011

Assessor/s
Jenkins, R.K.B., Andreone, F., Andriamazava, A., Andriantsimanarilafy, R.A., Anjeriniaina, M., Brady, L., Glaw, F., Griffiths, R.A., Rabibisoa, N., Rakotomalala, D., Randrianantoandro, J.C., Randrianiriana, J., Randrianizahana , H., Ratsoavina, F., Robsomanitrandrasana, E. & Carpenter, A.

Reviewer/s
Bowles, P. & Tolley, K.

Contributor/s

Justification
Listed as Vulnerable on the basis that this species has an extent of occurrence of 14,513 km, it occurs as a severely fragmented population, and there is a continuing decline in the extent and quality of montane heathland within its range as a result of slash-and-burn agriculture.

History
  • 1996
    Vulnerable (VU)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2006 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species has been recorded at densities of 12.2 ha-1 at Ankaratra (Randrianantoandro et al. 2010). Due to human pressures on and the patchy distribution of remaining forest throughout its range, the population is presumed to be both declining and severely fragmented.


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Although montane heathland in central Madagascar is declining less rapidly than forested areas, human activities (e.g., agricultural expansion) result in annual burning and degradation of the habitat where the species occurs, and this represents the major threat to this species. Illegal collection continues and although it may constitute a threat, there is little information on the quantities of animals removed from the wild (Randrianantoandro et al. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The jeweled chameleon is known to be collected from the wild for sale in the western pet markets, but insufficient data exists to fully understand the impact of this trade. However, probably the greatest threat to the species, and most important factor affecting the future survival of Madagascar's chameleons, is habitat loss as primary vegetation is cleared for conversion to subsistence agriculture (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This chameleon occurs within Parc National d'Andringitra; Ankaratra massif is not yet formally protected. Vences et al. (2002) report a sparse voucher collection and some of the reported localities therefore need to be resurveyed as a matter of priority, including those for which no specimens are available.This species is listed on CITES Appendix II and Category I, Class II of national wildlife legislation, but a trade suspension has been in place since 1994 (Carpenter et al. 2004, 2005). Heathland within this species' range should be managed to limit the impact of fires.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The jeweled chameleon is listed on Appendix II of CITES, which regulates the volume of international trade in the species (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Jewelled chameleon

Furcifer campani, commonly known as the jeweled chameleon or the Madagascar forest chameleon, is a species of lizard in the family Chamaeleonidae. Furcifer campani is endemic to the central highlands of Madagascar, where it is threatened by bush fires and habitat loss.

Etymology[edit]

The specific name, campani, is in honor of Dominique Campan, a French resident of Madagascar.[3]

Description[edit]

Furcifer campani grows to a length of about 14 centimetres (5.5 in). The background colour varies from pale green through dark green to brown. There are three pale brown, lateral stripes running along each side of the body and numerous small bright-coloured spots between them. The head is often decorated with small red spots.[4] This chameleon has a crest running along its back composed of small projecting granules.[5]

Distribution and habitat[edit]

Furcifer campani is endemic to the central mountainous region of Madagascar where it lives at altitudes of 1,850 to 2,300 metres (6,070 to 7,550 ft). Its range extends from Ankaratra, an extinct volcano, to the Andringitra National Park, an area of 14,500 square kilometres (5,600 sq mi), but only part of this is suitable habitat and its population is fragmented. It is a terrestrial species and its habitat is mountain grass and heathland with shrubs and isolated trees.[1]

Biology[edit]

Chameleons are ambush predators, standing still and waiting for suitable prey to come within reach. The diet consists largely of insects which they catch by shooting out their long tongues which have sticky tips.[6]

Reproduction in Furcifer campani takes place two or three times a year. Clutches of eight to twelve eggs are laid in concealed locations. When reared in the laboratory, incubation takes about nine months at a temperature of 20 °C (68 °F) and the emerging juveniles are about 23 mm (0.9 in) long. The young grow fast and are sexually mature at three months. Some reports say that this chameleon hibernates, burying itself in leaf litter during the winter months.[5]

Status[edit]

In some areas of shrubby savannah grassland Furcifer campani is reported to be common but no real assessment of its abundance has been made.[5] The IUCN Red List of Threatened Species lists it as being "Vulnerable". This is because its habitat is being cleared for agricultural production and there is an annual cycle of burning.[1] It shares its range with the white-lined chameleon (Furcifer lateralis) and that species seems better able to cope with the disturbance and degradation to the habitat caused by humans. It should be safe from human disturbance in the national park but this is not the case on the Ankaratra mountains. Exports of Furcifer campani peaked in 1994 when over five thousand were removed from the island. Although the export of all chameleons from Madagascar has been banned since then, some may still be being collected. The IUCN consider that steps should be taken to limit the damage done by fires to the grassland where Furcifer campani is found.[1]

References[edit]

  1. ^ a b c d Jenkins RKB, Andreone F, Andriamazava A, Andriantsimanarilafy RA, Anjeriniaina M, Brady L, Glaw F, Griffiths RA, Rabibisoa N, Rakotomalala D, Randrianantoandro JC, Randrianiriana J, Randrianizahana H, Ratsoavina F, Robsomanitrandrasana E, Carpenter A. (2011). "Furcifer campani". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 2012-12-26. 
  2. ^ The Reptile Database. www.reptile-database.org.
  3. ^ Beolens B, Watkins M, Grayson M. (2011). The Eponym Dictionary of Reptiles. Baltimore: Johns Hopkins University Press. xiii + 296 pp. ISBN 978-1-4214-0135-5. (Furcifer campani, p. 46).
  4. ^ "Jeweled chameleon (Furcifer campani)". ARKive. Retrieved 2012-12-19. 
  5. ^ a b c Brady LD, Griffiths RA. (1999). "Status Assessment of Chameleons in Madagascar". IUCN Species Survival Commission: 21, 31, 41. 
  6. ^ "Chameleons of Madagascar". WildMadagascar. Retrieved 2012-12-20. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!