Articles on this page are available in 1 other language: Spanish (17) (learn more)

Overview

Brief Summary

Biology

Reaching sexual maturity at 2.5 m, females prepare nests during the dry season either in holes or on mounds of mud or sand (3). After two months of surprisingly gentle courtship, during which the female must reduce the male's territorial aggression by making audible signals and by lifting her head to expose her throat, and nuzzling his head and neck (6), the female lays between 30 and 60 eggs. These are covered with sand and left to incubate under the heat of the sun for 90 days (3). The female guards the nest and assists during the hatching process, which coincides with the start of the annual rains. Both parents may guard the hatchlings (6) although they can fend for themselves immediately (2). Only a few survive due to predation particularly by raccoons (7). Adults make dens, dug 3 – 9 m into the river bank, near their nest site, but move inland during the winter, as they are unable to tolerate water temperatures of much below 18 ºC (6). The American crocodile's diet consists mainly of fish, but birds, small mammals, crabs and turtles are also taken and eaten underwater (3). Crocodiles hunt by waiting motionless in the water until their prey is close enough, then attacking the prey and drowning it. They will even regurgitate small amounts of food to attract fish. During winter, the digestion rate is very slow, so they can go for months without food (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A fairly large crocodile species, the American crocodile has a stocky body with a long, powerful tail. The short but muscular legs end in sharp claws (2) and the long triangular snout contains 14 to 15 sharp, conical teeth on each side. The large fourth tooth of the lower jaw fits into a pit in the upper jaw, but remains visible (5). The American crocodile is neatly adapted to life in the water. The ears, eyes and nostrils are located on the top of the head so that nearly the whole body can be submerged (5). A fold of skin can close the windpipe to enable the crocodile to open its mouth underwater and breathe through the nostrils (5). The eyes can be covered with a third eyelid to protect them underwater and the ears are covered with a flap of skin (2). The pupils are vertical slits to help with night vision (2) and there is a distinct swelling in front of each eye (3). Very young American crocodiles are green with dark banding on the back and tail (2) (6). Juveniles are olive green and are no longer banded (6). Adults are dull grey, with a white to yellow belly (2). Compared with other crocodile species, the armour is less prominent. Rows of raised scales contain knobs of bone (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

American crocodiles live along both the Atlantic and Pacific coasts, from Central America through South America and the Caribbean Islands. They can also be found along the southeastern coast of Florida. Lake Worth and Cape Sable are the most northern limits of the species. They are more commonly found in the lowlands of Florida, and salt-water marshes throughout Central and South America.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Ditmars, R. 1936. The Reptiles of North America. New York: Doubleday, Doran & Company, Inc.
  • Britton, A. 2009. "University of Florida" (On-line). Crocodylus acutus. Accessed April 08, 2009 at http://www.flmnh.ufl.edu/cnhc/csp_cacu.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range extends from southern Florida, Sinaloa (Mexico), and Yucatan (Mexico) south through Middle America (Pacific and Atlantic) and the West Indies to northern South America (to northern Peru and Venezuela) (Ernst et al. 1999).

Florida: Historical range centered on the southern tip of mainland Florida but extended at least as far north as Sanibel Island and Sarasota County on the west coast and Indian River County on the Atlantic coast, and southward into the Florida Keys (USFWS 2007). The primary historical nesting area in Florida was on the mainland shore of Florida and Biscayne bays, including many of the small islands near shore, in what is today Everglades National Park, and it also included the upper Florida Keys from Key Largo south to Lower Matecumbe Key (see USFWS 2007). Today most nesting occurs on the mainland shore of Florida Bay between Cape
Sable and Key Largo, but the nesting range also includes Biscayne Bay and the upper Florida Keys, with unsuccessful nesting north to Marco Island (USFWS 2007).

Middle America: both coasts from Mexico south to Panama. See Kaiser et al. (2001) for information on a breeding population on Roatan, Honduras.

Antilles: Cuba (Isla de la Juventud, and nearby islands), Hispaniola, Jamaica (along south coast and is especially abundant in marshes of Black River in west), Martinique, and Maragarita. The population in Cuba is of uncertain taxonomic status (see Milián-García et al. 2011 and taxonomy comments).

Northern South America: Venezuela, Colombia, Ecuador, and northern Peru.

Occasional vagrant to Cayman Islands (Schwartz and Henderson 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Middle-America Caribbean South-America North-America
Distribution: USA (S Florida), Mexico (Chiapas) Belize, Costa Rica, Ecuador, El Salvador, Guatemala, Honduras, Nicaragua, Mexico, Panama,  Cayman Islands, Cuba, Dominican Republic, Haiti, Hispaniola, Jamaica,  Margarita, Martinique, Trinidad, Colombia, Peru, Venezuela  
Type locality: "La grande ile de Saint-Domingue, Antilles, Amerique" (=Hispaniola; most probably the French portion which today is Haiti); restricted to "Santo Domingo, Puerto Plata," by Smith and Taylor (1950: 364); and further restricted to "L'Etang, Saumatre, Haiti," by Schmidt (1953: 111).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:

U.S.A. (FL), Mexico, Caribbean, Central and South America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

American crocodiles are found along the eastern coast of the Pacific Ocean from western Mexico south to Ecuador, and along the western coast of the Atlantic Ocean from Guatemala north to the southern tip of Florida (6). They are present in southern United States, Central America and northern South America (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

American crocodiles are moderate sized crocodiles, although some individuals can grow longer than 4 long. There are unconfirmed reports of individuals 7 m long. Males tend to be larger than females. Adults have an olive-brown coloration, whereas younger crocodiles are lighter tan color.  They have a narrow head and a long snout (which distinguishes them from alligators). Their sharp, jagged teeth interlock with each other. They have 28 to 32 teeth in their lower jaw and 30 to 40 in the upper jaw. They also have a protective eyelid that allows them to see underwater and the design of their iris gives them good night vision. American crocodiles are distinctive from other crocodile species in their reduced amount of scaly armor. Their tail is extremely long and powerful, and is used for swimming.

Range mass: 907.2 (high) kg.

Average mass: 220-450 kg.

Range length: 7 (high) m.

Average length: 3.5 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 460 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Crocodylus acutus
Catalog Number: USNM 211273
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female; Adult
Preparation: Dry
Year Collected: 1875
Locality: Arch Creek, head of Biscayne Bay, Dade, Florida, United States, North America
  • Syntype: Hornaday, W. T. 1875. American Naturalist. 9: 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found in both freshwater and brakish/saline lakes, coastal lagoons and mangrove swamps. Terrestial nest sites and basking areas.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The habitat of American crocodiles includes a broad range of aquatic environments. They inhabit freshwater, including rivers, lakes and reservoirs, and can also be found in brackish environments, such as example estuaries and swamps. There is also a population in a unique hyper-saline lake in the Dominican Republic. Another unlikely environment where American crocodiles are found is along brackish canals bordering a Florida power plant.  American crocodiles create complex burrow systems to provide them an alternative shelter when they are vulnerable to low water levels. These burrows are used as shelter from cold weather, as hiding places, and as a spot to rest. Crocodiles may make the burrow large enough for movement or they may be as shallow as only two feet below the ground. The entrance to the burrow is built at least partially submerged, if not fully submerged underwater. American crocodiles choose an area based on the reliability of a food source. As long as there is a sustainable amount of food, they do not leave the area, with the exception of mating season.

Habitat Regions: tropical ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Wetlands: marsh

Other Habitat Features: estuarine

  • Guggisberg, C. 1972. Crocodiles. Harrisburg, PA: Stackpole Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1.5 - 1.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Habitat includes coastal mangrove swamps, brackish and salt water bays, lagoons, marshes, tidal rivers, brackish creeks; also abandoned coastal canals and borrow pits. Individuals may wander widely in coastal waters and may range inland into lakes and lower reaches of large rivers. American crocodiles occupy mostly nonsaline waters in the nonbreeding season, move to saline waters when breeding. In Florida, primary habitat is inland mangrove swamps protected from wave action; females use open waters of Florida Bay only for access to nesting sites (Kushlan and Mazzotti 1989).

Eggs are laid in a mounded nest of soil, sand, or peat, or in a hole in the ground (Kushlan and Mazzoti 1989). Florida Bay nest sites usually are at edge of hardwood thickets on small sand beaches, or on high marl banks of coastal creeks, or in mangrove swamps along old canal banks; also on berms of power plant cooling canal systems (Gaby et al. 1985). In the West Indies, nests most often are in the ecotone between Conocarpus-dominated riparian strip and xeric uplands (Schwartz and Henderson 1991). In Belize, most nesting areas were on elevated beach ridges of coarse sand; adjacent shallow brackish lagoons provided critical nursery habitat (Platt and Thorbjarnarson 2000). See also Lutz and Dunbar-Cooper (1984).

In Florida, shortly after hatching, hatchlings disperse from nest sites to nursery habitats that are generally more sheltered, have lower salinity (1-20 parts per thousand), shallower water (generally), and more vegetation cover (USFWS 2007). Lazell (1989) reported that young generally occupy brackish water but seem to do well in full salt water on North Key Largo (Florida), perhaps due to the effect of abundant rainfall.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

American crocodiles can be found in both freshwater and saltwater habitats, but are most commonly found in tropical wetlands such as mangrove-lined saltwater estuaries and lagoons (6). They construct long burrows to avoid adverse conditions (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Crocodiles may make seasonal movements between freshwater and saline habitats (Gaby et al. 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

American crocodiles are carnivorous, feeding mostly on fish, frogs, turtles and the occasional bird or small mammal. Juvenile individuals eat more aquatic invertebrates and small fish, while recent hatchlings hunt insects on land. A full digestive cycle from swallowing to excretion takes approximately 72 hours. During hunting, prey is grabbed with their powerful jaws, swallowing it whole. American crocodiles also ingest small stones to aid in grinding up their food.

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; insects; terrestrial non-insect arthropods; mollusks; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Insectivore , Eats non-insect arthropods, Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Adults are believed to eat primarily fishes (USFWS 1980) but probably also eat large invertebrates and various vertebrates (mammals, birds, turtles). Young feed mainly on aquatic invertebrates (USFWS 1980, Platt et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

American crocodiles are top predators in aquatic ecosystems they inhabit. Their waste products and uneaten prey also contribute to other animals in the ecosystem.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

American crocodiles are only vulnerable as prey to other predators when they are young. Until they mature to a larger size, the young are vulnerable to raccoons, certain larger fish and wild cats. In order to protect themselves, they attempt to hide and conceal themselves with their surroundings. Later in life their crypsis is useful to prevent detection by prey.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: This species is represented by at least several dozen occurrences (subpopulations). Occurrences are discontinuous. Most are small, isolated, and in remote areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 100,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 2,500 and may exceed 10,000.

The American crocodile population in Florida has grown to an estimated 1,400 to 2,000 individuals, not including hatchlings, with 91-94 documented nests in 2005 (see USFWS 2007).

As of the 1990s, perhaps 200 adults and subadults existed in the Dominican Republic (Schubert 1994). Others are scattered throughout the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In Florida, most nest failures are due to raccoon predation and failure of eggs to hatch (USFWS 1980). Crocodiles in Florida have large (86-262 hectares) overlapping activity areas (Kushlan and Mazzotti 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

American crocodiles communicate through vocalizations. Roaring acts to defend territory and attract mates. Territorial communication is also displayed through slapping the water with the head and tail. Infrasonic sound is also used which creates ripples on the water's surface. This infrasonic rumbling is used during the mating season to court potential mates. Young American crocodiles communicate to the mother when hatching time approaches. Newly hatched young emit distress calls eliciting protective measures from the mother. The position of the body is also used to indicate dominance or submission. Dominant males swim along the surface of the water, exposing their entire body, while females and submissive males only expose their head or snout while swimming. Tail-thrashing is also used in aggressive behaviors and interactions as a visual cue. Finally, chemosensory cues are used in communication, but have been poorly documented.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Female American crocodiles incubate their eggs to keep them warm. The sex of the offspring is determined by the temperature at which the eggs are incubated. High temperatures of 88 to 91 degrees Fahrenheit produce male offspring, while anything lower than 88 degrees results in females. However, the temperature must remain above 82 degrees in order for the eggs to hatch. After the young hatch, they rely on the yolk of the egg for nourishment for as long as two weeks. As they age the number of potential predators decreases, but newly hatched and young American crocodiles are particularly vulnerable and therefore must hide. The food supply of the yolk keeps them nourished until they are more competent and secure. As they mature and grow, young American crocodiles start to hunt insects on land, much like the foraging style of other lizards.

Development - Life Cycle: temperature sex determination

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

American crocodiles have the potential to live as long as 100 years, however their average life expectancy ranges from 60 to 70 years.  There is a high mortality rate of offspring. Only 1 in 4 reach the age of 4. This is due to their vulnerability at their hatching size. Young American crocodiles have not yet developed the size and strength necessary to protect themselves from predators. Their vulnerable status along with the lack of parental care puts the young at risk. Also, if nests are built below the water line, flooding can result in mass death of the eggs. In addition, the eggs themselves are at risk to thieves such as raccoons.

Range lifespan

Status: wild:
100 (high) years.

Average lifespan

Status: wild:
60-70 years.

Average lifespan

Status: captivity:
45 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 32.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Courtship takes place in January and February, when males attract females to mate. Courting can last as long as two months. During mating season American crocodiles display territoriality by males engaging each other in competition for access to females. Males roar loudly, raising their heads and opening their mouths, displaying their impressive teeth as part of the mechanism to attract mates. Females respond to male roars with roars of their own.

Mating System: polygynous

American crocodiles breed seasonally between April and May. Female American crocodiles lay 30 to 60 eggs in a hole or a mount that take approximately 9 to 10 weeks to hatch. Eggs are kept warm through the generation of heat from rotting vegetation placed on the eggs. Females guard nests throughout that period. Sexual maturity in American crocodiles occurs at a length of 1.8 to 2.4 meters, or between 8 and 10 years old.

Breeding interval: American crocodiles breed once yearly.

Breeding season: Egg-laying occurs during April or May.

Range number of offspring: 30 to 60.

Range gestation period: 2 to 3 months.

Range time to independence: 2 to 14 days.

Range age at sexual or reproductive maturity (female): 8 to 10 years.

Range age at sexual or reproductive maturity (male): 8 to 10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Females build a nest prior to mating. The nest is constructed in an open area, usually above the high water mark. Females dig nests up to 1.5 m deep and up to 1.8 m in diameter. Once the eggs are laid, usually between 30 and 60, the nest is covered with dirt to incubate and they are not uncovered until they hatch. Although the eggs are placed close together, they are separated from each other to prevent them from breaking. When hatching approaches, the female increases the frequency of her visits to the nest site. While the eggs are hatching, the mother displays her protective nature through aggression. The female will rest her head above the nest, listening for noise from the young that cue her to uncover the nest in preparation for their hatching. Once uncovered, the mother aids the hatchlings in climbing out of the eggs, and later escorts the young to the water when they are ready. Once the young are taken from the hatching site they disperse quickly and are subsequently on their own.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eggs are laid in April-May in Florida, Mexico, Venezuela, and Honduras; December-February in Ecuador and Panama (Kushlan and Mazzotti 1989); mid-February to early April in Dominican Republic (Fitch 1985); late March-early May in Belize (Platt and Thorbjarnarson 2000). Clutch size is 20-80 (average 38 in Florida, 24 in Hispaniola, 22 in Belize). Incubation averages about 85 days in Florida; female guards nest; eggs hatch in July and August. Hatching occurs April-June in West Indies (Schwartz and Henderson 1991), late June to mid-July in Belize (Platt and Thorbjarnarson 2000). Adult opens nest and may carry hatchlings to water. Parent apparently protects young for unknown duration. Females become sexually mature at an age of around 10-13 years. Clutches are laid singly or communally in southern Florida (Kushlan and Mazzotti 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crocodylus acutus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CACCTTGTATTTTATTTTCGGCGCCTGAGCCGGAATAGTAGGCACAGCCATAAGCCTATTAATCCGAACAGAGCTCAGCCAGCCAGGTCCCTTCATAGGAGATGACCAAATTTACAACGTTATTGTTACAGCACATGCCTTTATCATAATTTTCTTTATAGTTATACCAATTATGATCGGAGGATTTGGAAACTGACTACTCCCATTAATAATTGGGGCACCCGACATAGCATTCCCTCGCATAAACAACATAAGCTTCTGATTGCTGCCCCCATCATTTACCCTACTTCTCTTTTCAGCCTTTATTGAAACTGGGGCTGGCACCGGATGAACAGTCTACCCYCCACTAGCTGGAAACCTAGCCCACGCCGGACCATCAGTAGACCTCACTATCTTCTCCCTTCACCTTGCTGGAGTGTCATCCATCCTTGGAGCAATTAACTTTATTACCACGGCTATCAACATAAAACCCCCAGCAATGTCACAACAACAAACACCCCTTTTTGTATGATCTGTTCTAGTTACAGCTGTCCTCCTATTGCTCTCACTGCCAGTCCTAGCTGCGGGAATCACTATACTACTTACTGACCGAAACTTGAACACCACTTTCTTTGACCCAGCAGGAGGAGGTGACCCAATCCTATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Crocodylus acutus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1ac

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Crocodile Specialist Group

Reviewer/s

Contributor/s

History
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

American crocodiles are listed as endangered under the United States Endangered Species Act. In addition, American crocodiles are protected under the Convention on International Trade in Endangered Species internationally, which prohibits commercial trade of these animals. In the past, American crocodiles were subject to poaching for their hides, but now the main threat to their existence is loss of habitat due to the invasion of human development and illegal killing.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Range extends from Mexico and southern Florida to northern South America; populations are small and declining throughout most of range; some populations have been extirpated, and poaching for hides outside the United States continues to pose a major threat.

Other Considerations: USFWS and State of Florida list as Endangered. Also in CITES Appendix.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 03/20/2007
Lead Region: Foreign (Region 10) 
Where Listed: Entire, except U.S.A. (FL)

Status: Threatened
Date Listed: 10/28/1975
Lead Region:   Southeast Region (Region 4)   
Where Listed: FL pop.


Population detail:

Population location: Entire, except U.S.A. (FL)
Listing status: E

Population location: FL pop.
Listing status: T

For most current information and documents related to the conservation status and management of Crocodylus acutus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The American crocodile is classified as Vulnerable (VU A1ac) on the IUCN Red List 2004 (1), and is listed on Appendix I of CITES, except for in Cuba, where it is listed on Appendix II (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-70%

Comments: Range-wide trends are poorly documented, but in most of the range this species undoubtedly has declined in population size over the past three generations (three generations is at least 45 years and may be as high as 60-75 years).

In Florida, extent of occurrence, area of occupancy, population size, nesting range, and number of known nests have been increasing in recent decades (Mazzoti et al. 2007, USFWS 2007). The maximum number of nesting females in Florida increased from 20 in 1975 to 85 in 2004 (Mazzoti et al. 2007).

See Schwartz and Henderson (1991) and Thorbjarnarson (1988) for information on status in Haiti.

Global Long Term Trend: Decline of 30-50%

Comments: Area of occupancy, number of subpopulations, and especially population size have undergone a major long-term decline, but the degree of decline is uncertain.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Major threat in most parts of the range is poaching for skins. In some areas, populations have declined as a result of killing for meat or fat, killing for "fun," collection of eggs, and entanglement in fishing gear (Schubert 1994). Habitat loss is also a threat, especially in Florida. Nesting sites and non-nesting habitat have been lost to development at Miami Beach and in the upper Florida Keys, but this loss has been partially offset by creation of artificial nesting sites on spoil banks along southern Biscayne Bay and a westward addition to nesting range in Florida Bay (Kushlan and Mazzotti 1989). Future threats in Florida include stochastic natural disasters such as hurricanes and cold weather, road mortality, continued habitat degradation, and poaching (USFWS 1998). Crocodiles are sensitive to human presence (especially at nest sites). In Florida, disturbance at nest sites caused females to abandon the site (Kushlan and Mazzotti 1989).

In Florida, crocodiles remain threatened by modification of habitat because of development adjacent to crocodile habitat; they will benefit from restored freshwater flow into estuaries (Mazzoti et al. 2007). As crocodiles increase in abundance and expand into new areas, interactions with humans will occur more frequently; integration of a recovering crocodile population with ever-increasing human use of coastal areas is a major challenge (Mazzoti et al. 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Between the 1930s and the 1960s, American crocodiles were hunted for their skin, which was a popular material for bags and belts (3). American crocodiles were declared endangered in 1979 and are now legally farmed for their skins. Now, the major threat to wild populations is habitat loss as a result of increasing urban development. Illegal hunting and accidental encounters with fishing nets, cars and boats are still a threat (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix I (except the population of Cuba, which is included in Appendix II).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: The public should be educated about crocodiles. In Florida, efforts should be made to decrease accidental mortality and restore the natural hydrology of the Everglades. See USFWS (1998) for specific information on recovery and management in Florida.

Management Research Needs: Determine habitat requirements. Research methods of captive breeding and restocking.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Some occurrence are in areas that provide a degree of protection, such as Santa Rosa National Park, Costa Rica; Morrocoy National Park, Venezuela; Everglades National Park, Crocodile Lake National Wildlife Refuge, J.N. "Ding" Darling National Wildlife Refuge, and Ten Thousand Islands National Wildlife Refuge, Florida, USA. See USFWS (1998) for a description of designated critical habitat in Florida.

Needs: Crocodile habitat in Florida continues to need maintainance and enhancement to provide protection for all life stages of the existing crocodile population and to ensure that available habitat can support population growth and expansion (USFWS 2007). Further acquisition of nesting and nursery sites and additional crocodile habitat by federal, state, and local governments and implementation of management on these publicly owned
properties are necessary to ensure protection to crocodiles and their nests and enable expansion of populations size and distribution (USFWS 2007).

Protection from poaching is critical in many parts of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Surveys and research into population statistics and behavioural ecology have proved extremely useful for recovery efforts in the United States, and are hoped to continue for more southerly populations. The American crocodile is fully protected in the majority of its range, but enforcement of this protection is inadequate, and legal hunters of caiman are known to illegally hunt American crocodiles as well. Management programmes have been set up in eight countries within the range, but they are commonly ignored. As well as reducing illegal hunting, crocodile farms can provide individuals for restocking the wild. For example, Venezuela contains much suitable crocodile habitat, but would benefit from restocking (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

American crocodiles have been known on the rare occasion to attack and kill or injure humans and domestic animals.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

American crocodiles have no direct economic importance for humans, however, similar species such as Alligator mississippiensis attract tourists to areas such as the Florida Everglades. In some areas they may be hunted for food or leather.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: See Thorbjarnarson (1999) for a discussion of the limits to sustainable use of crocodilians.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American crocodile

The American crocodile (Crocodylus acutus) is a species of crocodilian found in the Neotropics. It is the most widespread of the four extant species of crocodiles from the Americas. Populations occur from the Atlantic and Pacific coasts of southern Mexico to South America as far as Peru and Venezuela. It also lives within many river systems on Cuba, Jamaica, and Hispaniola. Within the United States the American crocodile is only found within the southern half of Florida. In Florida, there is an estimated population of about 2000. Despite its proximity to Hispaniola, the American crocodile is not found in Puerto Rico. The habitat of the American crocodile consists largely of coastal areas. The American crocodile is larger than some other crocodile species, with some males reaching lengths of 6.1 metres (20 ft) in Central and South America.

Contents

Description

An American crocodile hatchling in Colombia

Like all crocodilians, the American crocodile is a quadruped, with four short, splayed legs; a long, powerful tail; a scaly hide with rows of ossified scutes running down its back and tail.[2] The snout is elongated and includes a strong pair of jaws. The eyes have nictitating membranes for protection along with lachrymal glands, which produce tears.

The nostrils, eyes, and ears are situated on the top of its head, so the rest of the body can be concealed underwater for surprise attacks.[2] Camouflage also helps them prey on food. The snout is relatively longer and narrower than the American alligator although broader on average than the Orinoco crocodile.[3] American crocodiles are also paler and more grayish than the relatively dark-hued alligator. This crocodile species normally crawl on their belly, but they can also "high walk".[4] Larger specimens can charge up to 10 miles per hour (16 km/h).[5] They can swim at as much as 20 miles per hour (32 km/h) by moving their body and tail in a sinuous fashion, but they cannot sustain this speed.[6]

American crocodiles are more susceptible to cold than American alligators.[7] Unlike the American alligator which can subsist in water of 7.2 °C (45.0 °F) for some time, an American crocodile would become helpless and drown.[2] American crocodiles, however, have a faster growth rate than alligators, and are much more tolerant of salt water.[2]

Unlike the Old World crocodiles which are sometimes cleared of parasites by birds, the American crocodile relies more on fish for parasite removal.[2]

Size

Newborn hatchlings are about 22 centimetres (8.7 in) in size and about 60 grams (2 oz) in mass.[8][9] The average adult is 4 metres (13 ft) long and weighs 382 kilograms (840 lb) in males, and 3 metres (9.8 ft) and 173 kilograms (380 lb) in females.[10][11]

In the Tárcoles River in Costa Rica there are dozens of 4-meter and a few 5-meter individuals that frequent bridge crossings (where they are fed daily, which may have helped them reach such consistently large sizes) and are a popular tourist attraction. In their United States range, adult length has been recorded as high as 4.9 metres (16 ft) but adult males on average measure only 3.5 metres (11 ft) long.[8][12][13] This species is said to grow largest in the South American river basins, but even old males rarely reach 6 metres (20 ft).[12][14] A skull of this species was found to measure 72.6 centimetres (28.6 in) and is estimated to have belonged to a crocodile of 6.6 metres (22 ft) in length.[13] Large, mature males regularly weigh about 400–500 kg (880-1100 lb), with the 6 meter+ individuals surpassing 1000 kg (2,200 lb).[15] The longest American crocodile ever actually measured from snout to tail is a 17 feet (5.2 m) male living within the Tarcoles River of Costa Rica.[citation needed]

Diet

American crocodile's primary prey throughout life is fish and virtually any freshwater fish is potential prey. Prey species can range in size from the insects taken by young crocodiles to cattle taken by large adults and includes birds, mammals, turtles, crabs, snails, frogs, and occasionally carrion.[11][16] Adult American crocodile don't have any natural predators and are capable of eating anything at the water's edge.

Range and distribution

C. acutus is the most widespread of the four extant species of crocodiles from the Americas.[1] It inhabits waters such as mangrove swamps, river mouths, fresh waters, and salt lakes and can even be found at sea (hence its wide distribution on the Caribbean islands).[2] Southern Florida, the Greater Antilles and southern Mexico to Colombia and Ecuador.[8][16] The American crocodile is especially plentiful in Costa Rica.[17] One of the largest documented populations of American crocodiles is in Lago Enriquillo, a landlocked, hypersaline lake in the Dominican Republic.[11] The species has also been recorded from Jamaica.[18]

American crocodiles are saline tolerant, hence their wide distribution throughout the Caribbean. American crocodiles have recently been sighted in Grand Cayman, leading experts to believe that the species may be swimming from Cuba (which is home to a massive American crocodile population) and slowly repopulating Grand Cayman. In addition, an American crocodile/Cuban crocodile hybrid was recently discovered in the Cancun area. The crocodile likely originated in the Zapata Swamp of Cuba (the only place where these wild hybrids exist) and swam to the Yucatan Peninsula. This saline tolerance also allowed the American crocodile to colonize limited portions of the United States (only extreme southern Florida.) Contrary to popular misinformation, the presence of the American alligator is not the reason the American crocodile was unable to populate brackish waters north of Florida, but rather the climate. American crocodiles, unlike American alligators, are extremely susceptible to cold temperatures and live exclusively within tropical waters. During 2009 unusually cold weather within southern Florida resulted in the deaths of approximately 150 wild American crocodiles, including a well known crocodile which inhabited Sanibel Island far north of the crocodile's natural range.[19][20]

American crocodiles in the United States cohabit with the American alligator, and are primarily found in Everglades National Park, Florida Bay, Biscayne Bay and the Florida Keys from Miami southward.[7][9] A sizable population occurs near Homestead, Florida, at the Turkey Point Nuclear Generating Station.[9][21][22] Some individuals wander northward to warm summer waters and have been sighted in Sarasota County and Palm Beach County.[8] In the summer of 2008, a crocodile was captured in the surf on Isle of Palms, South Carolina.

Crocodiles require consistent tropical temperatures, hence their lack of distribution within the southern United States. They are saltwater-tolerant and have thus been capable of colonizing a multitude of islands within the Caribbean and on some coastal pacific islands as well. They co-exist with the smaller and less territorial American alligator within the Everglades National Park of southern Florida and with the very small Spectacled caiman within Central America. The only other crocodiles present within the American crocodile's range are the smaller and critically endangered Cuban Crocodile, along with the small Morelet's Crocodile in southern Mexico/Guatemala.

Systematics

Cuvier originally described the species as Crocodylus acutus in 1807.[23] Over time, it commonly became known as the "sharp-snout alligator". In 1822, Constantine Samuel Rafinesque postulated that the species was in fact a crocodile.[24]

The species was re-described as Crocodylus floridanus by William T. Hornaday in 1875,[25][26] when Hornaday and C.E. Jackson were sent from Washington, D.C. to Florida in order to collect alligator hides. Upon hearing of a "big old gator" in Arch Creek at the head of Biscayne Bay, Hornaday and his companions searched for it and reported:

"In a few hours we got sight of him, out on the bank in a saw-grass wallow. He was a monster for size–a perfect whale of a saurian, gray in color—and by all the powers, he was a genuine crocodile!"[27]

Crocodylus floridanus is now considered an invalid junior synonym of C. acutus.[28][29]

Conservation status

Due to hide hunting, pollution, loss of habitat, and removal of adults for commercial farming, the American crocodile is endangered in parts of its range.[9] In 1972, Venezuela banned commercial crocodile skin harvesting for a decade, as a result of 1950s and 1960s overhunting.[30]

One thousand to two thousand American crocodiles live in Mexico and Central and South America, but populations are data deficient.[11] The American crocodile is considered a vulnerable species, but has not been assessed since 1996.[1] It has an estimated wild population of 500 to 1,200 in southern Florida.[31] On March 20, 2007, the United States Fish and Wildlife Service declassified the American crocodile as an endangered species, downgrading its status to "threatened"; the reptile remains protected from illegal harassing, poaching or killing under the federal Endangered Species Act.[32][33] While not endangered, the American Alligator is also protected in the United States so that no crocodiles are killed by mistake.

Interaction with humans

American crocodiles can be dangerous to humans, and attacks in Mexico, Costa Rica, and Panama are not unprecedented. These attacks rarely make international news, and therefore this species is not as well-documented a man-eater as its relatives.[2] The species is reportedly timid, and seemingly lacks the propensity to attack humans as seriously as Old World crocodiles can.[24] In May 2007, there were two instances within one week of children being attacked and killed by this species—one in Mexico just south of Puerto Vallarta and one in Costa Rica.[34][35] No attacks on humans by the American crocodile have been reported in the United States, despite assorted anecdotes.[36]

References

  1. ^ a b c Crocodile Specialist Group (1996). Crocodylus acutus. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 7 December 2008. Listed as Vulnerable (VU A1ac v2.3)
  2. ^ a b c d e f g Guggisberg, C.A.W. (1972). Crocodiles: Their Natural History, Folklore, and Conservation. Newton Abbot: David & Charles. p. 195. ISBN 0-7153-5272-5. 
  3. ^ [1] (2011).
  4. ^ Gregg, Gordon; Gans,Carl (PDF). Morphology & Physiology of the Crocodylia. http://eprint.uq.edu.au/archive/00002011/02/croc.pdf. 
  5. ^ "American Crocodile". Rainforest Exploration. Earth's Birthday Project. http://www.earthsbirthday.org/explore/teachers/infocrocodile.htm. Retrieved 2008-12-12. [dead link]
  6. ^ "American Crocodile". Everglades. Miami Science Museum. http://www.miamisci.org/ecolinks/everglades/crocinfo.html. Retrieved 2008-12-12. 
  7. ^ a b Kushlan, JA; Mazotti, F (1989). "Historic and present distribution of the American crocodile in Florida.". Journal of Herpetology 23 (1): 1–7. doi:10.2307/1564309. JSTOR 1564309. 
  8. ^ a b c d Conant, Roger; Collins, Joseph T (1998). Reptiles and Amphibians Eastern-Central North America (3rd ed.). Boston: Houghton Mifflin. pp. 142–3. ISBN 0-395-90452-8. 
  9. ^ a b c d Moller, Michelle P.; Cherkiss, Michael S. Mazzotti, Frank J.. "The American Crocodile: A Story of Recovery". The Croc Docs. Fort Lauderdale Research and Education Center. http://crocdoc.ifas.ufl.edu/publications/posters/crocodilerecovery/. Retrieved 2008-12-12. 
  10. ^ Savage, Jay M.; Fogden, Michael; Fogden, Patricia (2005). The Amphibians and Reptiles of Costa Rica: A Herpetofauna between Two Continents, between Two Seas. University Of Chicago Press. ISBN 978-0-226-73538-2. 
  11. ^ a b c d "American Crocodile". Animals. National Geographic Society. http://animals.nationalgeographic.com/animals/reptiles/american-crocodile.html?nav=A-Z. Retrieved 2008-11-29. 
  12. ^ a b Behler JL, King FW. 1979. The Audubon Society Field Guide to North American Reptiles and Amphibians. New York: Alfred A. Knopf. 743 pp. LCCCN 79-2217. ISBN 0-394-50824-6.
  13. ^ a b Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. p. 256. ISBN 978-0-85112-235-9. 
  14. ^ http://animals.nationalgeographic.com/animals/reptiles/american-crocodile.html
  15. ^ http://www.seaworld.org/Animal-info/animal-bytes/animalia/eumetazoa/coelomates/deuterostomes/chordata/craniata/reptilia/crocodylia/american-crocodile.htm
  16. ^ a b "American Crocodile (Crocodylus acutus)". Crocodilians: Natural History & Conservation. Florida Museum of Natural History. http://www.flmnh.ufl.edu/cnhc/csp_cacu.htm. Retrieved 2008-11-29. 
  17. ^ "8 Crocodiles kill man in Mexico". Sindh Today. 12 August 2008. Archived from the original on 2008-08-22. http://web.archive.org/web/20080822053412/http://www.sindhtoday.net/world/11409.htm. Retrieved 2008-11-29. 
  18. ^ Ahrenfeldt, Robert H. (1954-05-05). "Identification of the Amphibia and Reptilia Recorded in Jamaica growing rapidly by Hans Sloane (1688-89)". Copeia (American Society of Ichthyologists and Herpetologists) 1954 (2): 105–111. doi:10.2307/1440328. JSTOR 1440328. 
  19. ^ www.crocodilian.com
  20. ^ Dr. Adam Britton
  21. ^ "Providing a home for the American crocodile" (PDF). Florida Power & Light. http://www.fpl.com/environment/plant/pdf/turkey_point_crocodile_fact_sheet.pdf. 
  22. ^ Allen, Greg (21 April 2007). "American Crocodiles Make a Comeback". National Public Radio. http://www.npr.org/templates/story/story.php?storyId=9718547. Retrieved 2008-12-12. 
  23. ^ * "Crocodylus acutus". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=174361. Retrieved 24 December 2008. 
  24. ^ a b Levin, Ted (2004). Liquid Land: A Journey Through the Florida Everglades. University of Georgia Press. ISBN 0-8203-2672-0. 
  25. ^ Hornaday, William T.. "The crocodile in Florida". The American Naturalist 9. 
  26. ^ "A New Day Dawns in the Everglades". Audubon Magazine. July–August 2001. http://audubonmagazine.org/features0107/everglades_intro.html. Retrieved 2009-01-08. 
  27. ^ Hornaday, William T. (1925). A Wild-animal Round-up. C. Scribner's Sons. p. 147. http://books.google.com/?id=_00lAAAAMAAJ&q=%22whale+of+a+saurian%22. Retrieved 2008-12-28. 
  28. ^ * "Crocodylus floridanus". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=209643. Retrieved 24 December 2008. 
  29. ^ Stejneger, Leonhard (1933-10-15). "Crocodilian Nomenclature". Copeia (American Society of Ichthyologists and Herpetologists) 1933 (3): 117–120. doi:10.2307/1436233. JSTOR 1436233. 
  30. ^ Pough, F. Harvey; Robin M. Andrews; John E. Cadle; Martha L. Crump; Alan H. Savitsky, Kentwood D. Wells (2004). Herpetology (3rd ed.). Upper Saddle River, New Jersey: Pearson/Prentice Hall. pp. 628–9. ISBN 0-13-100849-8. 
  31. ^ "American Crocodile (Crocodylus acutus)". National Parks Conservation Association. http://www.npca.org/marine_and_coastal/marine_wildlife/crocodile.html. Retrieved 2008-12-07. 
  32. ^ "U.S. Crocodiles Shed "Endangered" Status". National Geographic Society. 21 March 2007. http://news.nationalgeographic.com/news/pf/98669458.html. Retrieved 2008-12-07. 
  33. ^ American Crocodile No Longer Near Extinction. March 21, 2007.
  34. ^ "Boy killed in crocodile attack in Mexico". msnbc.com. Associated Press. 3 May 2007. http://www.msnbc.msn.com/id/18474361. Retrieved 2008-11-29. 
  35. ^ "Crocodile makes off with boy". Television New Zealand. Reuters. 5 May 2007. http://tvnz.co.nz/view/page/411749/1098603. Retrieved 2008-11-29. 
  36. ^ Langley, Ricky L. (2005). "Alligator Attacks on Humans in the United States" (PDF). Wilderness and Environmental Medicine 16 (3): 119–124. PMID 16209465. http://www.allenpress.com/pdf/weme_16_303_119_124.pdf. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: No subspecies are recognized, although geographic variation exists among populations in Florida, Jamaica, and the Pacific coast. Populations in Florida, Jamaica, and the Dominican Republic differ from each other in their gene frequencies (Menzies and Kushlan 1991). Densmore and White (1991) used molecular data to assess phylogenetic relationships within the Crocodylia, including all species in the genus Crocodylus; the closest relative of C. acutus was C. intermedius by one analysis using rDNA, C. moreletii by another analysis that used both rDNA and mtDNA; overall, New World species of Crocodylus appeared to be more closely related to each other than to species in other parts of the world. See Ernst et al. (1999) for further taxonomic discussion.

Milián-García et al. (2011) examined microsatellite loci plus DNA sequence data from nuclear (RAG-1) and mitochondrial (cytochrome b and cytochrome oxidase I) genes of Crocodylus acutus and C. rhombifer from Cuba. They found that C. acutus from Cuba is more closely related to C. rhombifer than to C. acutus from Central America. Thus current taxonomy does not appear to be an accurate reflection of evolutionary relationships. The researchers also found evidence of hybridization between the two species in Cuba. Further study is needed before taxonomic issues can be resolved. (Milián-García et al. 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!