Overview

Brief Summary

Biology

Although not a particularly social animal, the Asian tortoise seems to have more complex vocalisations and other communication methods than other tortoises (2) (8). Males engage in vocal disputes and aggressive behaviour to discourage rivals from courting nearby females. The rather elaborate courtship involves head-bobbing and 'fixation' by the male, in which males fully extend their head and neck and keep it pointed towards the female as they move around (2). 'Trailing' is another courtship behaviour employed by the male prior to mounting, involving the male following very closely behind the female, and both males and females vocalise during courtship (2) (6). The Asian tortoise is unique among turtles and tortoises in building a nest on the surface of the ground, and in providing maternal protection of the eggs (9). For a few days before laying, the female gathers up leaves and debris into a mound on which to place her clutch (2). Unlike most tortoises, which use their hindlimbs to excavate nest sites, Asian tortoises use their forelimbs to 'backsweep' surface leaf-litter (2) (8). Reported clutch sizes in captivity range from 21 to 53 eggs, which the female then covers with vegetation and guards, frequently piling more vegetation on top. If the eggs are threatened by a potential predator, the female will first attempt to drive them away by pushing and biting, but if this fails, she then defends the eggs by sprawling her body over them (2). This behaviour normally lasts just a few days following egg-laying, although up to six weeks of nest-guarding has been recorded (6). No other turtle or tortoise exhibits this high level of parental care and protection. It is thought that this behaviour helps protects the eggs by distracting and confusing the predators, and that frequently adding material to the nest may also help conceal the scent of the eggs (2). The Asian tortoise is chiefly herbivorous, typically feeding on grasses, vegetables, leaves, seedlings, herbs, fruits and fungi, although invertebrates and amphibians have occasionally been recorded in the diet (2) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

This tortoise is the largest inhabiting Asia, and the fourth largest in the world (4). Two subspecies are currently recognised: M. e. emys is commonly known as the Asian brown tortoise, and is characterised by a light to dark brown upper shell (carapace); while M. e. phayrei is commonly known as the Burmese brown tortoise, and is larger and darker in colour, having a charcoal to black upper shell (carapace) (2) (5). The forelimbs have five large claws and are covered on the front with large, heavy, overlapping scales. By contrast, the hindlimbs end in four pointed claws and bare a conspicuous cluster of very large tubercular scales on the thigh either side of the tail. These are so large that the species is sometimes referred to as the six-footed tortoise (5) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Manouria emys is native to southern and southeastern Asia, ranging from extreme eastern India (Assam) through, Bangladesh, and south and east through Myanmar, Thailand, Malaysia, and onto the islands of Sumatra and Borneo. Imported specimens have been found in Vietnam.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Asia
Distribution: India (Assam), Bangladesh,  Myanmar (= Burma), Tailand and Malaysia,  Indonesia (Sumatra, Borneo)  emys: S Tahiland, Malaysia, Sumatra, Borneo;
Type locality: Sumatra  phayrei: N/W Thailand to NE India;
Type locality: Arakan; Tenasserim Provinces’.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The Burmese brown tortoise is distributed from Assam in India, through Burma and Bangladesh to northern and west-central Thailand, while the Asian brown tortoise reportedly occurs in southern Thailand, Peninsula Malaysia, Sumatra and Borneo (6) (7). However, records of specimens with characteristics of the Asian brown tortoise are found as far northwest as Assam in India, and an intergrade between the two subspecies has been reported from southern Thailand to northern Malaysia, and also in Bangladesh. Thus, the true distribution of each subspecies may require further research and revision (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Manouria emys is the largest tortoise inhabiting Asia. Several characteristics of its shell distinguish it from other species. The cervical scute in the shell of the brown tortoise is shorter and wider when compared to other south Asian tortoises. The brown tortoise also has divided supracaudal scutes, whereas other tortoises do not. It has many scales on its hind thighs, a domed carapace, slightly serrated posterior marginals, and varies in color from brown to black, depending upon the subspecies. There are two recognized subspecies: Manouria emys emys is commonly called the Asian brown tortoise, while M. e. phayrei is called the Burmese brown tortoise. The Burmese brown tortoise is larger (it can grow to 60 centimeters and weigh 37 kilograms) and is darker. The brown tortoise can grow to 50 centimeters and weigh 20 kilograms. Like all tortoises, Males tend to have longer, thicker tails than those of females and also have concave plastra (which functions to facilitate mating).

Range mass: 20 to 37 kg.

Range length: 50 to 60 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Brown tortoises are found in temperate, moist habitats that are influenced by monsoon rains. Moderate temperatures of 55 F to 85 F (13 to 29 degrees Celsius) are preferred. To survive, young Manouria emys need the temperature to be above 65 F (18 degrees Celsius). This species also prefers a humidity of around 60% to 100%. In addition, these tortoises never wander far from a water source, such as a pond. M. emys are typically found in highland tropical forests, and prefers cooler and moister conditions than other tortoise species.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

  • Jacobsen, G., C. Tabaka. 2004. "Burmese Mountain Tortoise - Manouria emys " (On-line). World Chelonian Trust: Conservation and Care. Accessed September 23, 2004 at http://www.chelonia.org/Articles/burmmtortoise.htm.
  • McKeown, S., D. Meier, J. Juvik. 1991. The Management and Breeding of the Asian Forest Tortoise (Manouria emys) in Captivity. Proceedings of the First International Symposium on Turtles & Tortoises: Conservation and Captive Husbandry: 138-159. Accessed September 23, 2004 at http://www.tortoise.org/archives/manouria.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Asian tortoise inhabits temperate moist, broadleaf forest and tropical evergreen rainforest that experience monsoon rains, typically in upland areas (2) (7) (8). Furthermore, this tortoise never wanders far from water (2), and spends most of the warmer parts of the day soaking in pools or in the shade, out of the sun's rays (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Brown tortoises are herbivores for the most part. Their diet typically consists of grasses, vegetables, leaves, and fruits. They have been known to eat other animals on occasion, most of which were small invertebrates and amphibians.

Animal Foods: amphibians; terrestrial worms

Plant Foods: leaves; seeds, grains, and nuts; fruit

Other Foods: fungus

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As an herbivore, M. emys helps in cleaning up leaves, fungi, and fruit that are on the forest floor. They do not have any commensal or mutual relationships that are known, and specific predators of the tortoise were not available for study. Fruit seeds are dispersed through the tortoise's feces.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

This species relies on its strong shell for protection from predators. It's preference for twilight hours for activity, and its brownish color of it may also help avoid predators. Female protection and maintenance of the nest may help protect her offspring during their most vulnerable time of life. Though she cannot deter a vigorous egg-eater, simply by distracting predators and creating a disturbance she may discourage or confuse them. Her frequent nest-building may also help hide the scent of the eggs.

Currently humans are by far the most dangerous predator to this species. We have no specific information on the predators of M. emys, but it is likely that large predators, like tigers, canids, or bears, might attack tortoises. Many smaller predators like foxes and monitor lizards eat tortoise eggs, and predator birds will attack juvenile tortoises.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

This species has more elaborate communication behaviors than other tortoises.

Head-bobbing seems to be a form of social and courtship communication. The two types of bobbing are horizontal bobbing and elevated bobbing. Bobbing is not specific to one sex or the other and can be used by an individual towards either sex. However, during courting by the male, the female does not normally reciprocate head bobbing. At other times, however, head bobbing was reciprocated. Head-bobbing is often accompanied with vocalization.

"Fixation" is a sexually oriented behavior in which a male fully extends his head and neck and keeps it pointed towards the female as they move about. The female does not ever "fixate" on the male. Fixation seems to be an early part of courtship, whether or not the male is successful in courting her.

Trailing is another courting maneuver in which the male follows the female from behind. When the female slows down or stops, the male attempts to mount her. However, if she does not slow or stop, the male resorts to biting her. He bites her nose or legs in an effort to get the female to hold still for mounting.

Another manner of communication is vocalization. Males tend to have rhythmic grunts or bellows. Both males and females have mating calls that they use while head bobbing occurs. Typically the male has longer and more frequent calls when compared to the female. Other purposes of vocalization are not entirely known at this point.

Communication Channels: visual ; tactile

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

We have no information on development in this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The biggest limiting factor in lifespan seems to be predation, either by humans or from habitat destruction.

Average lifespan

Status: wild:
150 years.

Average lifespan

Status: captivity:
19.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Courtship in this species is more elaborate than in other tortoises, During courtship, males head-bob to communicate with prospective mates. The female typically does not bob her head in response during courting, though females do bob heads to communicate with each other and with males when not breeding. The two types of head bobbing are horizontal and elevated bobbing.  Fixation is another courting behavior performed by males. Males fully extend their head and neck and keep it pointed towards the female as the female moves about. As in head-bobbing, the female does not fixate on the male. Trailing is a maneuver in which the male follows the female very closely behind. If the female slows down or stops, the male usually attempts to mount her. If she does not slow or stop, he resorts to biting her to get her to hold still as he mounts her. Both males and females vocalize while courting. The sounds are low, resembling groans and moans, and most often occur during the head-bobbing phase of courtship. Male vocalizations are typically longer in duration than female vocalizations. As with other tortoises, males vocalized during mating is well.

We don't have information on whether males or females in this species mate more than once per season, but it's likely that as with other tortoises, both males and females may have multiple mates, with males more frequently mating multiply.

Mating System: polygynandrous (promiscuous)

Reported clutch sizes range from 21 to 53 eggs, but these are all from captive females. Incubation time ranges from 63-84 days, also in captive situations with artificial incubation. We have no information on reproduction in this species in the wild.

Range number of offspring: 23 to 51.

Average number of offspring: 39.

Range gestation period: 63 to 84 days.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Unlike most tortoises, females of Manouria emys do invest in their offspring after they lay their eggs. For a week prior to laying her eggs, the female gathers up leaves and ground debris to make a mound into which she will deposit her clutch. Brown tortoises use their forelimbs to gather debris while other tortoises use the hind limbs to excavate nest sites. After she finishes laying, the mother tortoise covers her eggs with vegetation and litter, and remains at the next site, guarding her eggs and frequently piling more vegetation on them. If a potential predator approaches her nest, she first attempts to drive it away by pushing and even biting. If the predator is too quick or persistent, she will passively defend the eggs by crouching over them. This behavior is unique among chelonians, no other turtle or tortoise exhibits this high a level of parental care.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female)

  • McKeown, S., D. Meier, J. Juvik. 1991. The Management and Breeding of the Asian Forest Tortoise (Manouria emys) in Captivity. Proceedings of the First International Symposium on Turtles & Tortoises: Conservation and Captive Husbandry: 138-159. Accessed September 23, 2004 at http://www.tortoise.org/archives/manouria.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Manouria emys

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1756-06|NC_007693|Manouria emys| ACCCGCTGATTCTTTTCCACTAACCACAAAGACATTGGCACCCTATATTTAATCTTCGGGGCCTGAGCAGGGATAGTAGGCACAGCATTA---AGCCTGTTGATCCGCGCAGAGCTGAGCCAACCCGGGACCCTTCTGGGGGAC---GACCAAATTTACAATGTAATTGTTACAGCCCATGCCTTTATCATAATTTTCTTCATAGTTATACCAATCATAATCGGTGGCTTCGGAAACTGGCTTGTACCACTAATA---ATCGGAGCACCAGATATGGCGTTCCCACGTATGAATAACATAAGTTTCTGACTTTTACCCCCATCCCTACTGCTACTCCTAGCCTCATCAGGGGTTGAAGCAGGTGCGGGCACAGGCTGAACCGTATATCCACCACTAGCGGGAAACTTAGCCCATACTGGTGCCTCCGTAGACCTA---ACCATTTTTTCCCTACATCTCGCTGGTGTATCATCAATTCTAGGGGCTATCAACTTTATTACCACAGCAATTAACATAAAATCCCCGGCCATATCTCAATATCAAACACCCTTATTCGTGTGGTCAGTACTTATTACAGCCGTTCTACTACTACTCTCACTACCTGTACTTGCTGCA---GGCATCACTATATTACTTACAGACCGAAACCTAAATACAACTTTCTTTGACCCTTCAGGAGGAGGAGACCCAATCTTATACCAACACCTGTTCTGATTCTTTGGTCACCCTGAAGTATACATTCTAATCCTACCAGGATTTGGCATAATCTCACATATCGTTACTTATTATGCCGGTAAAAAA---GAACCATTCGGGTACATAGGAATAGTTTGAGCAATAATATCTATTGGATTTCTGGGCTTTATTGTATGAGCCCACCACATATTTACTGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Manouria emys

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A1cd+2cd

Version
2.3

Year Assessed
2000

Assessor/s
Asian Turtle Trade Working Group

Reviewer/s
Buhlmann, K., Rhodin, A. & van Dijk, P.P. (Tortoise & Freshwater Turtle Red List Authority)

Contributor/s

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Insufficiently Known
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

In several parts of Asia, brown are exploited for food and medicine. Habitat destruction is also a factor in their 'vulnerable' status. The pet trade is also a problem, as Brown tortoises are fairly valuable and sought-after animals. Over-consumption and habitat destruction have caused populations of this species to rapidly decline in many parts of its range. The species is considered Endangered by the International Union for the Conservation of Nature is listed in Appendix II of CITES. This is one of many species terrestrial and freshwater turtles and tortoises in Asia that it threatened by commerical over-consumption.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2006 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Like other Asian turtles and tortoises, this species is severely threatened by over-harvesting and exploitation for the food and pet trade, compounded by habitat destruction. Most records indicate that Asian tortoise populations are sparse and extremely fragmented (6). Sadly, being such a large species, the Asian tortoise is a relatively easy target for hunters and collectors (4), and its fairly high market value makes it a much sought after species (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

International trade is controlled by the Asian tortoise's listing on CITES Appendix II (6). However, despite the species being uplisted from 'Vulnerable' to 'Endangered' on the IUCN Red List in 2000, the legal export quota from Peninsula Malaysia was raised from 50 wild caught specimens in 1999, to 200 in 2000, and to 500 in 2002 (3) (6). In 2006, this quota was reduced to 400 (3), but this still seems too high for a species facing possible extinction. Although imports are now totally banned in the European Community, this has only served to shift the trade towards Japan and the U.S. (6). The Asian brown tortoise (M. e. emys) is legally protected in Sabah, Malaysia, under the Wildlife Conservation Enactment 1997, and a license is required from the director of the Wildlife Department to hunt or collect wild specimens (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of Manouria emys on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Some people of Southeast Asia use M. emys as a food source and in medications. In addition, M. emys is a profitable animal in the international pet trade.

Positive Impacts: pet trade ; food ; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Asian forest tortoise

Asian forest tortoise (Manouria emys), also known as Asian brown tortoise, is a species of tortoise found in India (Assam), Bangladesh, Burma (or Myanmar), Thailand, Malaysia and Indonesia (Sumatra, Borneo).

Contents

Description

ManouriaFuscaFord.jpg

The largest tortoise in mainland Asia; large adult of the northern subspecies, M.e. phayrei, can reach 25 kg in the wild and much more than that in captivity. Shell considerably depressed, its depth not half its length; anterior and posterior margins reverted, more or less strongly serrated; nuchal present; supracaudal shields two; dorsal shields concentrically striated, often concave; vertebrals much broader than long and at least as broad as costals. Plastron large, gular region somewhat produced and usually notched, hind lobe deeply notched; the pectoral shields may be widely separated from each other, or from a short median suture; axillary shield very small, inguinal large. Head moderate; two large prefrontal shields and a large frontal; beak not hooked; jaws feebly denticulated, the alveolar surface of the upper jaw with a strong median ridge. Fore limb anteriorly with very large, bony, pointed, imbricate tubercles, forming four or five longitudinal series; hind limb with very large bony tubercles on the plantar surface, with others larger, conical, and spur-like on the heel, and a group of still larger conical tubercles on each side on the back of the thighs. Adult dark brown or blackish; carapace of young yellowish brown, with dark-brown markings.

Believed to be among the most primitive of living tortoises, based on molecular and morphological studies. This is the only tortoise which lays its eggs above ground in a nest, which the female constructs of leaf litter. The female uses both front and rear legs to gather material for the nest and lays up to 50 eggs deep inside it. She then sits on and near the nest to protect it, and will 'chase' predators and intruders away. [1]

Subspecies

  • Manouria emys emys: S Thailand, Malaysia, Sumatra, Borneo; Type locality: Sumatra. M. e. emys has separated pectoral scutes while M. e. phayrei has joined pectoral scutes.
  • Manouria emys phayrei: N/W Thailand to NE India; Type locality: Arakan; Tenasserim Provinces'. M. e. phayrei has been named after Sir Arthur Purves Phayre (1812–1885), British Army officer in India who became Commissioner of British Burma.

Cited references

  1. ^ Boulenger, G.A.(1890) Fauna of British India. Reptilia and Batrachia.

Other references

  • Asian Turtle Trade Working Group (2000). Manouria emys. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 11 May 2006. Listed as Endangered (EN A1cd+2 cd v2.3)
  • Anderson, J. 1871 On Testudo Phayrei, Theob. & Dr. Gray. Ann. Mag. Nat. Hist. (4) 8: 324-330
  • Blyth, E. 1854 Notices and descriptions of various reptiles, new or little-known. Part I. J. Asiat. Soc. Bengal 22 [1853]: 639-655
  • Schlegel, H. & Müller, S. 1844 Over de Schildpadden van den Indischen Archipel. In: Temminck,V. (1839–1847) Verhandelingen over de natuurlijke geschiedenis der Nederlandsche overzeesche bezittingen, door de leden der Natuurkundige Commisie in Oost-Indie en andere schrijvers. Leijden folio. Afd. 1 Zoologie in 12 afleveringen, met 45 gekl. pl. - Vitg. door C.J. Temminck, Leiden, Leuchtmans u. Hoeck in comm.: 29-36
  • Stoliczka, F. 1871 Note on Testudo Phayrei. Ann. Mag. Nat. Hist. (4) 8: 212
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!