Overview

Brief Summary

Summary

The Japanese pond turtle, Mauremys japonica (Family Geoemydidae), is endemic to Japan and is distributed in Honshu, Shikoku, Kyushu, and adjacent small islands. The turtle is found in various freshwater habitats such as swamps, marshes, irrigated rice paddies, ponds, lakes, and rivers. Many of these habitats have been the objects of recent rapid land developments, or under the constant influences of human activities, obviously involving population declines of this species. The overexploitaion by pet dealers and the prevalence of artificially introduced species with similar ecological requirements could be reducing the numbers of this turtle as well. Thus, although the turtle seems still to be relatively abundant in most districts, preservation of its habitats, as well as regulations for the handling of this species and the control of invasive turtles (especially of the red-eared slider Trachemys scripta elegans) should be considered urgently for the conservation of this species. Accumulation of field data for various ecological aspects of the Japanese pond turtle is also strongly desired in order to formulate effective conservation actions.
  • Yasukawa, Y., Yabe, T. and Ota, H. 2008. Mauremys japonica (Temminck and Schlegel 1835) – Japanese pond turtle. In: Rhodin, A.G.J., Pritchard, P.C.H., van Dijk, P.P., Saumure, R.A., Buhlmann, K.A., and Iverson, J.B. (Eds.). Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN/SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Research Monographs No. 5, pp. 003.1-003.6, doi:10.3854/crm.5.003.japonica.v1.2008, http://www.iucn-tftsg.org/cbftt
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© IUCN/SSC Tortoise and Freshwater Turtle Specialist Group

Source: IUCN SSC Tortoise and Freshwater Turtle Specialist Group

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Japan. Restricted to Honshu, Kyoshu, and Shikoku.
  • Yasukawa, Y., Yabe, T. and Ota, H. 2008. Mauremys japonica (Temminck and Schlegel 1835) – Japanese pond turtle. In: Rhodin, A.G.J., Pritchard, P.C.H., van Dijk, P.P., Saumure, R.A., Buhlmann, K.A., and Iverson, J.B. (Eds.). Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN/SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Research Monographs No. 5, pp. 003.1-003.6, doi:10.3854/crm.5.003.japonica.v1.2008, http://www.iucn-tftsg.org/cbftt
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© IUCN/SSC Tortoise and Freshwater Turtle Specialist Group

Source: IUCN SSC Tortoise and Freshwater Turtle Specialist Group

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Asia
Distribution: S Japan (Honshu, Kyoshu, Shikoku)  
Type locality: Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 16.2 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mauremys japonica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACAAATCATAAAGATATTGGCACCTTATATTTAATTTTTGGGGCCTGAGCAGGTATAGTAGGCACAGCATTAAGTTTATTAATCCGCGCAGAATTAAGCCAACCGGGGGCCCTCCTAGGGGAC---GACCAAATCTATAATGTTATCATTACAGCCCATGCCTTTATTATAATTTTCTTCATGGTTATACCCATTATAATCGGCGGCTTTGGAAACTGACTTGTGCCACTAATAATTGGGGCGCCAGATATGGCATTCCCACGTATAAACAATATAAGCTTCTGGCTTCTACCACCATCCCTACTTTTACTTCTAGCCTCCTCAGGAATTGAAGCAGGCGCAGGCACAGGCTGAACTGTGTACCCGCCATTAGCTGGAAACCTGGCCCACGCTGGTGCCTCTGTAGATTTAACTATCTTTTCCCTTCACCTAGCAGGTGTGTCATCAATTTTAGGGGCCATCAACTTTATCACCACAGCAATTAACATAAAATCTCCAGCTATATCACAGTACCAAACACCTTTATTTGTATGATCCGTACTTATCACAGCCGTCCTATTACTACTCTCACTACCAGTACTCGCCGCAGGTATTACTATACTACTCACAGACCGAAACCTAAATACAACCTTCTTCGACCCTTCAGGGGGAGGGGACCCAATTTTATACCAACACCTGTTTTGATTTTTTGGTCACCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mauremys japonica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/nt
Lower Risk/near threatened

Red List Criteria

Version
2.3

Year Assessed
2000
  • Needs updating

Assessor/s
Asian Turtle Trade Working Group

Reviewer/s
Buhlmann, K., Rhodin, A. & van Dijk, P.P. (Tortoise & Freshwater Turtle Red List Authority)

Contributor/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

  • Yasukawa, Y., Yabe, T. and Ota, H. 2008. Mauremys japonica (Temminck and Schlegel 1835) – Japanese pond turtle. In: Rhodin, A.G.J., Pritchard, P.C.H., van Dijk, P.P., Saumure, R.A., Buhlmann, K.A., and Iverson, J.B. (Eds.). Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN/SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Research Monographs No. 5, pp. 003.1-003.6, doi:10.3854/crm.5.003.japonica.v1.2008, http://www.iucn-tftsg.org/cbftt
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© IUCN/SSC Tortoise and Freshwater Turtle Specialist Group

Source: IUCN SSC Tortoise and Freshwater Turtle Specialist Group

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Japanese pond turtle

The Japanese pond turtle (Mauremys japonica) is a species of turtles in the family Geoemydidae endemic to Japan. Its Japanese name is nihon ishigame, Japanese stone turtle. Its population has decreased somewhat due to habitat loss, but it is not yet considered a threatened species.

This species is known to hybridize with the Chinese pond turtle, the Chinese stripe-necked turtle, and the Chinese box turtle (and possibly other Geoemydidae) in captivity. As these three species are much rarer and strongly declining in the wild, this should be avoided.[3]

References[edit source | edit]

  1. ^ Temminck, C. J., and H. Schlegel. 1835. Reptilia. Chelonii. In: Ph. Fr. de Siebold, 1833-1838, Fauna Japonica. Leyden. 144 pp.
  2. ^ Fritz Uwe; Peter Havaš (2007). "Checklist of Chelonians of the World". Vertebrate Zoology 57 (2): 229. ISSN 18640-5755. Archived from the original on 2010-12-17. Retrieved 29 May 2012. 
  3. ^ Buskirk, James R.; Parham, James F. & Feldman, Chris R. (2005). On the hybridisation between two distantly related Asian turtles (Testudines: Sacalia × Mauremys). Salamandra. 41: 21-26. PDF fulltext
  • Asian Turtle Trade Working Group (2000). Mauremys japonica. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 29 July 2007.
  • Ernst, C. H. & Barbour, R. W. (1989). Turtles of the World. Smithsonian Institution Press, Washington, D.C.
  • Highfield, A. C. (1996). Practical Encyclopedia of Keeping and Breeding Tortoises and Freshwater Turtles. Carapace Press, London, England.
  • Pritchard, P. C. H. (1979). Encyclopedia of Turtles. TFH Publications, Neptune, New Jersey.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!