Overview

Distribution

Range Description

This widespread species is present from Dagestan (Russia) and northeastern Iran (Kopet Dagh mountain range), through Turkmenistan, Uzbekistan, Kazakhstan, southern Russia, Tajikistan and Kyrgyzstan to northwestern China and northwestern Mongolia. Recorded up to 1,500 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Near-East Asia Europe
Distribution: Soviet Union, Armenia eastward to E Kazakhstan, S Russia (Astrakhan Oblast and Volgograd Oblast), Turkmenistan, Uzbekistan, Kyrgyzstan, Tajikistan,  Turkey, Iraq, NW China (W Xinjiang), NW Mongolia, NE Iran  horvathi: Armenia;
Type locality: “Aralich, am Fusse des Ararat, Armenien” (fide WERMUTH 1967)  saidalievi: Uzbekistan, Tajikistan and Kyrgyzstan (Ferghana Valley); Terra typica: "vicinity of the Kanibadam village (Tajik part of the Fergana Valley)" [= Konibodom village, approximately 40º17' N, 70º25' E, Tajikistan].  varius: from Eastern Kazakhstan through Xinjiang Uygur Autonomous Region, China to western Mongolia. Terra typica: "Hab. in Sibiria australi, versus montes Altaicos"  
Type locality: "in deserti australioris collibus ardentissimis"; restricted to the "Inderskija Gory, Gebiet des unteren Uralflusses" [North Kazakhstan] by Mertens & Müller (1928: 26).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is present in clay and stony desert and semi-desert areas, generally with a sparse cover of vegetation. Animals can be found in dry stream beds and sandy areas mixed with pebbles (Anderson 1999).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phrynocephalus helioscopus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATAGCTGGCTTCACCGGCTCAACAGTCAGCCTGATAGTTCGACTACAATTAATTCAACCAGGCCAATACAACGGAGATACGATATACAACACCTTTATTACACTTCATGCCTTCATTATAATTTTCTTCATAGTAATGCCAATCATAATTGGGGGGTTTGGCAACTGACTAGTGCCCCTAATACTGGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGATTACTACCCCCATCATTTTTCTTACTCTTAATATCATCAAAATTTGGTGACGGTGTAGGCACCGGCTGGACAATCTATCCACCATTAGCAGGAAACATAGCACATTCAAGCCCATCAATANACATAACCATTTTCTCACTACACCTAGCCGGAGCATCCTCAATTCTAGGTGCAATCAATTTCATCACAACCTGCATCAACATAACCCCACACTCAACAATCCCCTACAACTGACCACTATTTGTCTGATCTGTATTTTTTACCGCAATCTTACTACTACTGGCTATTCCAGTATTAGCCGCAGCTATCACAATACTCCTAACAGACCGAAACCTAAACACAACATTCTTTGACACCGCCGGAGGGGGAGACCCTATTCTCTTCCAACACAAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phrynocephalus helioscopus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phrynocephalus helioscopus saidalievi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTATTTTTTATTCGGCGCTATAGCCGGCTTCACCGGATCAACAGTTAGCCTAATAATTCGATTACAACTAATCCAACCAGGCCAATACAACGGAGATA---CAATATACAACACCTTTATTACACTTCACGCTTTCATTATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGATTTGGCAACTGACTTGTACCACTAATACTGGTTGCCCCACACATAGCATTCCCACGAATAAACAACATAAGCTTCTGATTACTTCCTCCATCATTTTTTTTACTCTTAATATCTTCAAAATTCGGTGACGGTGTAGGAACAGGCTGAACAATCTATCCACCATTAGCAGGAAATATAGCACATTCAAGCCCATCAATAGATATAACCATCTTCGCACTACACCTAGCCGGGGCATCCTCAATCCTAGGCGCAATCAACTTCATCACAACCTGCATCAACATAACCCCACACTCAACAATTCCATACAACTGACCACTATTCGTCTGATCTGTATTTTTTACCGCAATCTTGTTACTACTAGCTATCCCAGTATTAGCAGCAGCCATCACAATACTCNTAACAGACCGAAATCTAAACACAACATTCTTTGACCCCGCCGGAGGGGGGGACCCCATTCTCTTCCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phrynocephalus helioscopus saidalievi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phrynocephalus helioscopus helioscopus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTTTACTTTTTATTTGGCGCTATAGCCGGCTTCACTGGCTCAACAGTCAGCCTAATAATTCGACTACAACTAATCCAACCAGG---CCAATACAACGGAGATACGATATACAACACCTTTATTACACTACATGCCTTCATTATAATTTTCTTTATAGTAATGCCAATCATAATTGGTGGATTTGGCAACTGACTAGTGCCCCTAATACTGGGGGCTCCAGACATAGCATTTCCACGAATAAACAACATAAGCTTCTGATTACTACCCCCATCATTTTTCTTACTTTTAATATCATCAAAATTTGGTGACGGCGTAGGCACCGGCTGAACAATCTATCCACCATTAGCAGGAAACATAGCACATTCAAGCCCATCAATAGACATAACCATTTTCTCACTTCACCTAGCCGGGGCATCCTCAATTCTAGGCGCAATCAACTTCATCACAACCTGCATCAACATAACCCCACACTCAACAATCCCATACAACTGACCACTATTTGTCTGATCTGTATTTTTTACCGCAATCTTACTACTCTTGGCTATTCCAGTATTAGCAGCAGCCATTACAATACTTCTAACAGACCGAAACCTAAACACAACATTCTTTGACCCCGCCGGAGGAGGAGACCCAATTCTCTTTCAACACCTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phrynocephalus helioscopus ssp. 3RuHF

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTTTACTTTTTATTTGGCGCTATAGCCGGCTTCACCGGCTCAACAGTCAGCCTAATAATTCGCCTACAACTAATCCAACCAGG---CCAATACAACGGAGATACGATGTACAACACCTTCATTACACTCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGGTTTGGCAATTGATTAGTGCCCTTAATACTAGGGGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGATTATTACCCCCATCATTTTTTTTACTCTTAATATCATCAAAATTTGGTGACGGTGTAGGCACAGGCTGAACAATCTATCCACCATTAGCAGGTAACATAGCACATTCAAGCCCATCAATAGATATAACCATTTTCTCACTACACCTAGCCGGGGCATCCTCAATTCTAGGCGCAATCAATTTCATCACAACCTGCATCAACATAACTCCACACTCAACAATCCCATACAACTGACCACTATTTGTTTGATCGGTATTTTTTACCGCAATTCTACTACTCTTGGCTATTCCAGTATTAGCTGCAGCCATTACAATACTTCTAACAGACCGAAACCTAAACACAACATTCTTTGACCCGGCCGGGGGAGGAGACCCCATTCTCTTCCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phrynocephalus helioscopus ssp. 3RuHF

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phrynocephalus helioscopus ssp. 2RuHF

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTTTATTTTTTATTTGCTGCTATAGCCGGCTTCACCGGCTCAACAGTTAGCCTAATAATTCGACTACAACTAATCCAACCAGG---CCAATATAACGGAGATACAATATACAATACCTTTATTACACTCCATGCCTTCATTATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGGTTCGGCAACTGGCTAGTACCCCTAATACTAGGAGCTCCAGACATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTACTACCTCCATCATTTTTTTTACTCTTAATATCATCAAAATTTGGTGACGGCGTAGGCACAGGCTGAACAATCTACCCGCCATTAGCAGGAAACATAGCACATTCAAGCCCATCAATAGATATAACCATTTTTTCATTACACCTAGCCGGAGCGTCCTCAATTCTGGGTGCAATCAATTTCATCACAACCTGCATCAACATAACCCCACACTCAACAATCCCGTACAACTGACCACTATTTGTCTGATCTGTATTTTTTACCGCAATCTTACTACTCTTGGCTATTCCAGTATTAGCAGCAGCCATTACAATACTTCTAACAGACCGAAACCTAAACACAACATTCTTTGACCCCGCCGGAGGGGGAGACCCTATTCTCTTCCAACACCTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phrynocephalus helioscopus ssp. 2RuHF

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phrynocephalus helioscopus ssp. 1RuHF

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTCTACTTTCTATTTGGCGCCATAGCCGGCTTCACCGGATCAACAGTCAGCCTAATAATTCGACTACAACTAATCCAGCCCGGCCAATACAACGGAGATA---CAATATACAATACCTTTATTACTCTCCACGCCTTCATTATAATTTTCTTTATAGTAATACCTATCATAATTGGAGGCTTTGGCAACTGACTAGTCCCCTTAATACTGGGTGCCCCAGACATAGCATTTCCACGAATAAATAACATAAGCTTCTGATTATTACCCCCATCATTTTTTTTACTTTTAATATCATCAAAATTCGGTGACGGTGTAGGAACAGGCTGAACAATCTATCCACCATTAGCAGGAAACATAGCACATTCAAGCCCATCAATAGACATAACCATTTTTGCACTTCACCTAGCCGGAGCATCCTCTATCTTAGGCGCAATCAACTTTATCACAACCTGCATCAACATAACCCCACACTCAACAATTCCATACAATTGACCACTATTCGTCTGATCCGTATTCTTTACTGCGATCTTGTTACTACTGGCTATTCCAGTACTAGCAGCAGCTATCACAATACTTTTAACAGACCGAAACCTAAATACAACATTCTTTGACCCTGCCGGAGGGGGAGACCCTATTCTTTTCCAGCATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phrynocephalus helioscopus ssp. 1RuHF

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phrynocephalus helioscopus varius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTTTATTTTTTATTTGGCGCTATAGCTGGCTTCACCGGCTCAACAGTCAGCCTGATAATTCGACTACAACTAATTCAACCAGG---CCAATACAACGGGGATACGATATACAACACCTTTATTACACTTCATGCCTTCATTATAATTTTCTTTATAGTAATGCCAATCATAATTGGGGGGTTTGGCAACTGACTAGTGCCCCTAATACTGGGAGCCCCAGACATAGCATTCCCACGAATGAACAACATAAGCTTCTGATTACTACCCCCATCATTTTTCTTACTCTTAATATCATCAAAATTTGGTGACGGTGTAGGCACCGGCTGGACAATCTATCCGCCATTAGCAGGAAACATAGCACATTCAAGCCCATCAATAGACATAACCATTTTCTCACTACACCTAGCCGGAGCATCCTCAATTCTAGGTGCAATCAATTTCATCACAACCTGCATCAACATAACCCCACACTCAACAATCCCCTACAACTGACCACTATTTGTCTGATCTGTATTTTTTACCGCAATCTTACTACTCTTGGCTATTCCAGTATTAGCCGCGGCTATCACAATACTTCTAACAGACCGAAACCTAAACACAACATTCTTTGATCCCGCCGGAGGAGGAGACCCTATTCTCTTCCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phrynocephalus helioscopus varius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phrynocephalus helioscopus cameranoi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTTTATTTCTTATTCGGCGCTATAGCCGGCTTCACCGGCTCAACAGTTAGCCTAATAATTCGATTACAACTAATCCAACCAGGCCAATACAACGGAGATA---CAATATACAACACCTTTATTACACTCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGATTCGGCAACTGGCTAGTACCCTTAATACTAGGGGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTATTACCTCCATCATTTTTTTTACTCTTAATATCATCAAAATTTGGTGACGGTGTAGGCACAGGCTGAACAATTTATCCACCATTAGCAGGAAACATAGCACATTCAAGCCCATCAATAGATATAACCATTTTCTCACTACACCTAGCCGGGGCATCCTCAATTCTAGGTGCAATCAATTTCATCACAACCTGCATTAACATAACCCCACACTCAACAATCCCGTACAACTGACCACTATTTGTCTGATCTGTATTTTTTACCGCAATCCTATTACTCTTAGCCATTCCAGTATTAGCAGCAGCCATTACAATACTTCTAACAGACCGAAACCTAAACACAACATTCTTTGATCCCGCCGGAGGGGGGGACCCTATTCTCTTTCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phrynocephalus helioscopus cameranoi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Ananjeva, N., Tuniyev, B., Agasyan, A., Orlov, N., Tuniyev, S. & Anderson, S.

Reviewer/s
Cox, N., Temple, H.J. (Global Reptile Assessment Coordinating Team) & Böhm, M., Collen, B., Ram, M. (Sampled Red List Index Coordinating Team)

Contributor/s
De Silva, R., Milligan, H.T., Wearn, O.R., Wren, S., Zamin, T., Sears, J., Wilson, P., Lewis, S., Lintott, P. & Powney, G.

Justification
Phrynocephalus helioscopus is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is generally a common species, but local declines may occur due to the conversion of land in Central Asia for agricultural use.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In parts of its range, this species is threatened by overgrazing and habitat transformation to agriculture.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Other than general research activities, no direct conservation measures are currently needed for this species as a whole. In view of the species' wide range, it seems likely that it occurs within several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!