Overview

Comprehensive Description

Brief

"Scales 17:18 or 19:17 or 16: 14 rows. Ventrals 190-213. Anal scale divided. Subcaudals 100-146, paired."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Throughout India
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Near-East Asia
Distribution: Afghanistan, Bangladesh, Burma (Myanmar), Cambodia, China (Chekiang, Hupeh, Jiangxi, Fujian, Guangdong, Hainan, Guangxi, Yunnan, Xizang, Hong Kong), India (Maharashtra (Pune (=Poona) district, Nasrapur), Karnataka (Castle Rock) [A. Captain, pers. comm.]), Andamans, Sri Lanka,  Indonesia (Sumatra, Java),  Iran, Laos, West Malaysia, Nepal, Myanmar Pakistan, Taiwan, Thailand, Turkmenistan, U.S.S.R., Vietnam  maximus: Sri Lanka  
Type locality: India
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Holotype for Ptyas mucosus
Catalog Number: USNM 7510
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1854
Locality: No Further Locality Data, Hong Kong, China, Asia
  • Holotype: Hallowell, E. 1860. Proc. Acad. Nat. Sci. Philadelphia. 12: 503.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

General Habitat

Wide variety of habitats
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11.3 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ptyas mucosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GCTGGTACCGGATGAACAGTATACCCCCCACTATCAGGAAATTTAGTACACTCAGGCCCATCAGTTGACTTAGCCATTTTTTCCCTACATTTAGCAGGCGCTTCCTCCATCCTGGGGGCAATTAACTTCATTACAACATGCATTAATATAAAACCTAAATCCATACCAATGTTCAATATCCCACTATTTGTATGGTCAGTTCTTATTACAGCCATTATACTCTTACTAGCCCTGCCAGTACTAGCAGCAGCAATCACCATACTATTAACTGACCGAAACCTCAACACCTCTTTCTTTGATCCCTGTGGAGGAGGAGACCCAGTACTATTTCAACACCTGTTCTGATTTTTCGGCCACCCAGAAGTCTACATTCTCATCTTACCAGGGTTCGGTATCGTGTCAAGTATTATCACATTCTATACAGGAAAAAAAAACACATTTGGATACACAAGCATAATCTGAGCAATAATGTCTATTGCTATCCTGGGTTTCGTTGTTTGAGCACACCAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ptyas mucosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ptyas mucosa

Scale pattern
An oriental rat snake found in southern India.

Ptyas mucosa, commonly known as the oriental ratsnake,[1] Indian rat snake,[3] or dhaman,[1] is a common species of colubrid snake found in parts of South and Southeast Asia. Growing to nearly 2 m (6.6 ft), they are large snakes and their colour varies from pale browns in dry regions to nearly black in moist forest areas. They are frequently found in urban areas where rodents thrive.

Geographic range[edit]

Afghanistan, Bangladesh, Burma (Myanmar), Cambodia, China (Zhejiang, Hubei, Jiangxi, Fujian, Guangdong, Hainan, Guangxi, Yunnan, Tibet, Hong Kong), India, Sri Lanka, Indonesia (Sumatra, Java), Iran, Laos, West Malaysia, Nepal, Myanmar, Pakistan (Sindh area), Taiwan, Thailand, Turkmenistan, Vietnam

Type locality: India.

Natural enemies[edit]

It is normally the favorite reptilian prey of the King Cobra.

Description[edit]

Description from Boulenger's Fauna of British India: Reptilia and Batrachia volume of 1890:

Snout obtuse, slightly projecting;
eye large; rostral a little broader than deep, visible from above;
suture between the internasals shorter than that between the prefrontals;
frontal as long as its distance from the end of the snout, as long as the parietals or slightly shorter;
usually three loreals;
one large preocular, with a small subocular below;
two postoculars;
temporals 2+2;
8 Upper labials, fourth and fifth entering the eye;
5 Lower labials in contact with the anterior chin shields, which are shorter than the posterior; the latter in contact anteriorly.
dorsal scales in 17 rows at midbody, more or less strongly keeled on the posterior part of the body.
Ventrals 190-208;
anal divided;
subcaudals 95-135, divided.

Brown above, frequently with more or less distinct black crossbands on the posterior part of the body and on the tail;

young usually with light crossbands on the front half of the body.
Lower surface yellowish;
the posterior ventral and the caudal shields may be edged with black.[4]

Behavior[edit]

When threatened they are capable of growling. This has been suggested as a possible case of mimicry of the King Cobra.[5] However, this mimicry often proves to be a disadvantage if the snake lives with humans; more often than not, this snake is mistaken for the King Cobra or a related animal such as the Indian Cobra, and frequently killed because of this.

References[edit]

  1. ^ a b c d The Reptile Database. www.reptile-database.org.
  2. ^ Boulenger, G.A. 1893. Catalogue of the Snakes in the British Museum (Natural History). Volume I., Containing the Families...Colubridæ Aglyphæ, part. Trustees of the British Museum (Natural History). (Taylor and Francis, Printers). London. xiii + 448 pp. + Plates I.- XXVIII. (Zamenis mucosus, pp. 385-386.)
  3. ^ Das, I. 2002. A Photographic Guide to Snakes and Other Reptiles of India. Ralph Curtis Books. Sanibel Island, Florida. 144 pp. ISBN 0-88359-056-5. (Ptyas mucosa, p. 43.)
  4. ^ Boulenger, G.A. (1890), "Reptilia and batrachia", The Fauna of British India including Ceylon and Burma (London: Secretary of State for India in Council), 1 (Google eBook), retrieved 2012-03-13 
  5. ^ Young, B.A., Solomon, J., Abishahin, G. 1999 How many ways can a snake growl? The morphology of sound production in Ptyas mucosus and its potential mimicry of Ophiophagus. Herpetological Journal 9 (3):89-94

Further reading[edit]

  • David, P., and I. Das. 2004. On the grammar of the gender of Ptyas Fitzinger, 1843 (Serpentes: Colubridae). Hamaddryad 28 (1 & 2): 113-116.
  • Günther, A. 1898. Notes on Indian Snakes in Captivity. Ann. Mag. Nat. Hist., Series 7, 1: 30-31. (Zamenis mucosus, p. 30.)
  • Jan, G., & F. Sordelli. 1867. Iconographie générale des Ophidiens: Vingt-quatrième livraison. Baillière. Paris. Index + Plates I.- VI. ("Coryphodon Blumenbachi, Merr.", Plate III., Figures 2-4.)
  • Lazell, J.D. 1998. Morphology and the status of the snake genus Ptyas. Herpetological Review 29 (3): 134.
  • Linnaeus, C. 1858. Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, diferentiis, synonymis, locis. Tomus I. Editio Decima, Reformata. L. Salvius. Stockholm. 824 pp. (Coluber mucosus, p. 226.)
  • Morris, P.A. 1948. Boy's Book of Snakes: How to Recognize and Understand Them. A volume of the Humanizing Science Series, edited by Jacques Cattell. Ronald Press. New York. viii + 185 pp. ("The Indian Rat Snake", pp. 136–137, 181.)
  • Nixon, A.M.A., and S. Bhupathy. 2001. Notes on the occurrence of Dhaman (Ptyas mucosus) in the higher altitudes of Nilgiris, Western Ghats. Cobra (44): 30-31.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!