Overview

Comprehensive Description

Brief

"Scales 17:18 or 19:17 or 16: 14 rows. Ventrals 190-213. Anal scale divided. Subcaudals 100-146, paired."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Throughout India
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Near-East Asia
Distribution: Afghanistan, Bangladesh, Burma (Myanmar), Cambodia, China (Chekiang, Hupeh, Jiangxi, Fujian, Guangdong, Hainan, Guangxi, Yunnan, Xizang, Hong Kong), India (Maharashtra (Pune (=Poona) district, Nasrapur), Karnataka (Castle Rock) [A. Captain, pers. comm.]), Andamans, Sri Lanka,  Indonesia (Sumatra, Java),  Iran, Laos, West Malaysia, Nepal, Myanmar Pakistan, Taiwan, Thailand, Turkmenistan, U.S.S.R., Vietnam  maximus: Sri Lanka  
Type locality: India
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Holotype for Ptyas mucosus
Catalog Number: USNM 7510
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1854
Locality: No Further Locality Data, Hong Kong, China, Asia
  • Holotype: Hallowell, E. 1860. Proc. Acad. Nat. Sci. Philadelphia. 12: 503.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

General Habitat

Wide variety of habitats
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The Dhaman or Indian rat snake (Ptyas mucosus)is a large (up to 3.5 m) colubrid that is found throughout most of southern Asia and western Indonesia. It is often described as a nervous snake, both quick to strike and prone to defensive displays, including the production of a distinctive low frequency sound. As part of its defensive display, this snake mediolaterally compresses the anterior portion of its body and expands its throat region ventrally. During this display, the snake produces a deep, rumbling defensive growl.

There is substantial overlap between the geographic distribution and ecological preferences of the Indian Rat Snakea and the King Cobra (Ophiophagus hannah). There are several accounts in the literature describing the Indian Rat Snake as resembling or mimicking the King Cobra, especially with respect to its defensive behavious and  defensive sounds. As part of its defensive display, the King Cobra passes an exhalent airstream over a series of tracheal diverticula which act as resonating chambers, acoustically modifying the hiss into a low frequency growl (Young 1991). While similar tracheal diverticula are found in some other snakes, including a congener of the Indian Rat Snake, P. korros, they are lacking in the Indian Rat Snake (Young 1992). Young et al. (1999) examined the morphological basis of sound production in the Indian Rat Snake in an effort to document the acoustic properties of this defensive sound, the Their analysis confirmed  the acoustic similarities between the growls produced by these two species and yielded some hypotheses regarding the production of these sounds. Given that these sounds are produced only during defensive displays, that these snake species have considerable overlap in geographic range and habitat preference, and that the King Cobra has a highly toxic venom, Young et al. suggest that the defensive growl may indeed be an example of acoustic Batesian mimic.

(Young et al. 1999 and references therein)

  • Young, B.A. 1991. The morphological basis of "growling" in the King Cobra (Ophiophagus hannah). Journal of Experimental Zoology 260: 275-287.
  • Young, B.A. 1992. Tracheal diverticula in snakes: possible functions and evolution. Journal of Zoology 227: 567-583.
  • Young, B.A., J. Solomon, and G. Abishahin. 1999. How many ways can a snake growl? The morphology of sound production in Ptyas mucosus and its potential mimicry of Ophiophagus. Herpetological Journal 9: 89-94.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11.3 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ptyas mucosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GCTGGTACCGGATGAACAGTATACCCCCCACTATCAGGAAATTTAGTACACTCAGGCCCATCAGTTGACTTAGCCATTTTTTCCCTACATTTAGCAGGCGCTTCCTCCATCCTGGGGGCAATTAACTTCATTACAACATGCATTAATATAAAACCTAAATCCATACCAATGTTCAATATCCCACTATTTGTATGGTCAGTTCTTATTACAGCCATTATACTCTTACTAGCCCTGCCAGTACTAGCAGCAGCAATCACCATACTATTAACTGACCGAAACCTCAACACCTCTTTCTTTGATCCCTGTGGAGGAGGAGACCCAGTACTATTTCAACACCTGTTCTGATTTTTCGGCCACCCAGAAGTCTACATTCTCATCTTACCAGGGTTCGGTATCGTGTCAAGTATTATCACATTCTATACAGGAAAAAAAAACACATTTGGATACACAAGCATAATCTGAGCAATAATGTCTATTGCTATCCTGGGTTTCGTTGTTTGAGCACACCAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ptyas mucosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ptyas mucosa

Scale pattern
An oriental rat snake found in southern India.

Ptyas mucosa, commonly known as the oriental ratsnake,[1] Indian rat snake,[3] or dhaman,[1] is a common species of colubrid snake found in parts of South and Southeast Asia. Dhamans are large snakes, growing to 2 m (6.6 ft) and occasionally even to 3 m (9.8 ft). Their colour varies from pale browns in dry regions to nearly black in moist forest areas. Dhamans are diurnal, semi-arboreal, non-venomous, and fast-moving. Dhamans eat a variety of prey and are frequently found in urban areas where rodents thrive. The species is also known as ගැරඩියා (geradiya) in Sinhala (Sri Lanka) and ngu sing hang lai in Thai (Thailand).

Geographic range[edit]

Afghanistan, Bangladesh, Burma (Myanmar), Cambodia, China (Zhejiang, Hubei, Jiangxi, Fujian, Guangdong, Hainan, Guangxi, Yunnan, Tibet, Hong Kong), India, Sri Lanka, Indonesia (Sumatra, Java), Iran, Laos, West Malaysia, Nepal, Myanmar, Pakistan (Sindh area), Taiwan, Thailand, Turkmenistan, Vietnam

Type locality: India.

Enemies[edit]

Adult dhamans have few natural enemies other than the king cobras that overlap them in range. Juveniles fear birds of prey, larger reptiles, and mid-sized mammals. They are wary, quick to react, and fast-moving. [4]

Dhamans and related colubrids are aggressively hunted by humans in some areas of their range for skins and meat. Harvesting and trade regulations exist in China and Indonesia but these often go ignored.[5]

Description[edit]

Description from Boulenger's Fauna of British India: Reptilia and Batrachia volume of 1890:

Snout obtuse, slightly projecting;
eye large; rostral a little broader than deep, visible from above;
suture between the internasals shorter than that between the prefrontals;
frontal as long as its distance from the end of the snout, as long as the parietals or slightly shorter;
usually three loreals;
one large preocular, with a small subocular below;
two postoculars;
temporals 2+2;
8 Upper labials, fourth and fifth entering the eye;
5 Lower labials in contact with the anterior chin shields, which are shorter than the posterior; the latter in contact anteriorly.
dorsal scales in 17 rows at midbody, more or less strongly keeled on the posterior part of the body.
Ventrals 190-208;
anal divided;
subcaudals 95-135, divided.

Brown above, frequently with more or less distinct black crossbands on the posterior part of the body and on the tail;

young usually with light crossbands on the front half of the body.
Lower surface yellowish;
the posterior ventral and the caudal shields may be edged with black.[6]

It is the second largest snake in Sri Lanka, after Indian Rock Python.

Ptyas mucosa

Behavior[edit]

Dhamans, though harmless to humans, are fast-moving, excitable snakes. In captivity individuals remain highly territorial and may continue to defend their turf aggressively, attempting to startle or strike at passing objects. Dhamans are diurnal and semiarboreal. They inhabit forest floors, wetlands, rice paddies, farmland, and suburban areas where they prey upon small reptiles, amphibians, birds, and mammals. Adults, unusually for a colubrid, prefer to subdue their prey by sitting on it rather than by constricting, using body weight to weaken prey.[4][7]

Dhamans mate in late spring and early summer, though in tropical areas reproduction may take place year round. Males establish boundaries of territory using a ritualised test of strength in which they intertwine their bodies. The behaviour is sometime misread by observers as a 'mating dance' between opposite-sex individuals.[7] Females produce 6-15 eggs per clutch several weeks after mating.[4][7]

Adult members of this species emit a growling sound and inflate their necks when threatened. This adaptation may represent mimicry of the king cobra or Indian cobra which overlaps this species in range.[8] The resemblance often backfires in human settlements, though, as the harmless animal is then mistaken for a venomous snake and killed.[4][7]

Nomenclature[edit]

The International Code for Zoological Nomenclature (ICZN) directs that the grammatical gender of any given species name should follow logically from the gender of its associated genus name. As Ptyas is a feminine word form, the proper form of the species name is mucosa. Reference materials older than 2004 often show the masculine form, mucosus, and the CITES list continues to list the species this way.

Gallery[edit]

References[edit]

  1. ^ a b c d The Reptile Database. www.reptile-database.org.
  2. ^ Boulenger, G.A. 1893. Catalogue of the Snakes in the British Museum (Natural History). Volume I., Containing the Families...Colubridæ Aglyphæ, part. Trustees of the British Museum (Natural History). (Taylor and Francis, Printers). London. xiii + 448 pp. + Plates I.- XXVIII. (Zamenis mucosus, pp. 385-386.)
  3. ^ Das, I. 2002. A Photographic Guide to Snakes and Other Reptiles of India. Ralph Curtis Books. Sanibel Island, Florida. 144 pp. ISBN 0-88359-056-5. (Ptyas mucosa, p. 43.)
  4. ^ a b c d http://www.snakesoftaiwan.com/Ptyas%20mucosa/species_ptyas_mucosa.htm
  5. ^ https://docs.google.com/viewer?url=http%3A%2F%2Fwww.traffic.org%2Fspecies-reports%2Ftraffic_species_reptiles25.pdf
  6. ^ Boulenger, G.A. (1890), "Reptilia and batrachia", The Fauna of British India including Ceylon and Burma (London: Secretary of State for India in Council), 1 (Google eBook), retrieved 2012-03-13 
  7. ^ a b c d http://www.siam-info.com/english/snakes_ptyas.html
  8. ^ Young, B.A., Solomon, J., Abishahin, G. 1999 How many ways can a snake growl? The morphology of sound production in Ptyas mucosus and its potential mimicry of Ophiophagus. Herpetological Journal 9 (3):89-94

Further reading[edit]

  • David, P., and I. Das. 2004. On the grammar of the gender of Ptyas Fitzinger, 1843 (Serpentes: Colubridae). Hamaddryad 28 (1 & 2): 113-116.
  • Günther, A. 1898. Notes on Indian Snakes in Captivity. Ann. Mag. Nat. Hist., Series 7, 1: 30-31. (Zamenis mucosus, p. 30.)
  • Jan, G., & F. Sordelli. 1867. Iconographie générale des Ophidiens: Vingt-quatrième livraison. Baillière. Paris. Index + Plates I.- VI. ("Coryphodon Blumenbachi, Merr.", Plate III., Figures 2-4.)
  • Lazell, J.D. 1998. Morphology and the status of the snake genus Ptyas. Herpetological Review 29 (3): 134.
  • Linnaeus, C. 1858. Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, diferentiis, synonymis, locis. Tomus I. Editio Decima, Reformata. L. Salvius. Stockholm. 824 pp. (Coluber mucosus, p. 226.)
  • Morris, P.A. 1948. Boy's Book of Snakes: How to Recognize and Understand Them. A volume of the Humanizing Science Series, edited by Jacques Cattell. Ronald Press. New York. viii + 185 pp. ("The Indian Rat Snake", pp. 136–137, 181.)
  • Nixon, A.M.A., and S. Bhupathy. 2001. Notes on the occurrence of Dhaman (Ptyas mucosus) in the higher altitudes of Nilgiris, Western Ghats. Cobra (44): 30-31.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!