Overview

Distribution

Range Description

This species has a wide distribution from Sudan and Uganda across central Africa and throughout west Africa to Senegal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Ball pythons (Python regius), also known as royal pythons, are found in the grasslands and open forests of West and Central Africa. They are native to the Sudanese subprovince west of the Nile, in southern Sudan, the Bahrel Ghazal and Nuba Mountains Region, from Senegal to Sierra Leone in West Africa, and in the Ivory Coast and some parts of Central Africa.

Biogeographic Regions: ethiopian (Native )

  • De Vosjoli, P., R. Klingenberg, T. Barker, D. Barker. 1995. Ball Python Manual. Santee, California: Advanced Vivarium Systems.
  • Sillman, A., J. Carver, E. Loew. 1999. The photoreceptors and visual pigments in the retina of a boid snake, the ball python (Python regius). Journal of Experimental Biology, 202/14: 1931-1938.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Africa
Distribution: Senegal, Gambia, Guinea Bissau, Guinea, Sierra Leone, Liberia, Ivory Coast, Ghana, Togo, Benin, SW Niger (near the border of Benin), Burkina Faso, Nigeria, Cameroon, Central African Republic, N Democratic Republic of the Congo (Zaire), Mali, Uganda, Sudan (Owen 1956)  
Type locality: unknown 
Type locality: Gambia [GRAY 1842]
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

At birth, ball pythons range from 25 to 43 centimeters in length and grow to 1 to 1.5 meters as adults. There are some reports of ball pythons found in the wild at 1.83 meters in length. Their heads are larger than their relatively slender necks and they are considered heavy-bodied. The typical ball python has large brown markings with lighter medium-brown spots interspersed between the darker spots. They may also have yellow stripes from the nostrils through the eyes. The belly is generally ivory white. Adult female ball pythons are larger than adult males. This sexual dimorphism is not present in neonates, but is apparent in adults. Adult females also have longer jaws than their male counterparts. The resultant increase in swallowing capacity may improve their hunting ability.

Range length: 1 to 1.83 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

  • Aubret, F., X. Bonnet, M. Harris, S. Maumelat. 2005. Sex Differences in Body Size and Ectoparasite Load in the Ball Python, Python regius.. Journal of Herpetology, 39/2: 312-215.
  • Barker, D., T. Barker. 2006. "The Ball Python Care Sheet" (On-line). Accessed February 18, 2010 at http://www.vpi.com/publications/the_ball_python_care_sheet.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits dry areas, from grassland to open forests. It can also be found in agricultural land. This species is an important species for rodent pest control.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Ball pythons spend most of their time on or under the ground in burrows. They are most active at dawn and dusk. They inhabit savanna grasslands or open forests and are found in areas that have been cleared for farming.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Ball pythons are carnivorous and have mobile lower and upper jaws. They use chemical and visual cues to hunt for their prey. Ball pythons sit and wait to ambush prey. As heavy-bodied snakes, they are less active and instead choose good ambush sites. The feeding strategy is to retract the head and neck and strike rapidly. After the rapid strike, they swallow prey alive or immobilize by constriction. They feed almost exclusively on rodents and eat infrequently. Infrequent feeders have adapted by having the capacity to widely regulate gastrointestinal functioning with feeding and fasting. Ball pythons prey on rodents and are vital to controlling these pests, especially in rural communities. Rodent prey includes African giant rats (Cricetomys gambianus), black rats (Rattus rattus), rufous-nosed rats (Oenomys species), shaggy rats (Dasymys species), and grass mice (Lemniscomys species).

Animal Foods: mammals

Primary Diet: carnivore (Eats terrestrial vertebrates)

  • Ott, B., S. Secor. 2007. Adaptive regulation of digestive performance in the genus Python. Journal of Experimental Biology, 210: 340-356.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Ball pythons are found in western to central Africa, just north of the equator. They are found in grasslands and open forests, and in areas with some cover. They are typically found near open water so they can cool themselves during hot weather. They spend most of their time on or in burrows under the ground, although they are able to climb. They are primarily nocturnal and active during the wet season. Bush fires can also affect ball pythons. In addition, farmers may kill ball pythons out of fear.

Ticks are primary parasites, with a slightly higher tick burden in males than females. This may be due to the prolonged periods of immobility in females during the two months of brooding their clutch. Male movement to capitalize on encounters with females may increase their risk of exposure to ticks.  There are also internal parasites found in ball pythons including, Trypanosoma varani, Helpatozoon (Apicomplexa: Adelorina), and Spinicauda regiensis.

Commensal/Parasitic Species:

  • Mukhtar, M., Y. Une, H. Kawabata, A. Takano, H. Sato, H. Watanabe. 2009. Trypanosoma cf. varani in an Imported Ball Python (Python reginus) From Ghana. The Journal of Parasitology, 95/4: 1029-1033.
  • Platt, T., A. Bush. 1979. Spinicauda regiensis n. sp. (Nematoda: Heterakoidea), a parasite of the ball python ( Python regius).. Journal of Helminthology, 53/3: 257-260.
  • Sloboda, M., M. Kamler, J. Bulantova, J. Votypka, D. Modry. 2007. A New Species of Hepatozoon (Apicomplexa: Adeleorina) from Python regius (Serpentes: Pythonidae) and Its Experimental Transmission by a Mosquito Vector. The Journal of Parasitology, 93/5: 1189-1198.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Ball pythons attempt to avoid detection by predators and to seek cover. Defenses include camouflage, escape attempts, bluffing displays, and biting. Ball pythons are best known for “balling,” in which they form a tight ball with the head at the center. There are few known predators of adults, although the trappers of Ghana have reported that black cobras (Naja nigricollis) prey on small and medium pythons. Some known predators, especially of young pythons, include humans (Homo sapiens), carnivorous mammals, and birds of prey.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Vision plays an important role in a ball python’s ability to secure prey. Research on the way these snakes behaved under bright light determined that ultraviolet activity may be a factor in capturing prey. Other research suggests that ball pythons may follow the scent trails of their mammalian prey because those trails reflect ultraviolet light.

Communication Channels: visual ; tactile ; chemical

Perception Channels: visual ; infrared/heat ; tactile ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Ball python hatchlings range from 25 to 43 centimeters; adults from 0.9 to 1.5 meters. The gestation period is about 44 to 54 days. Most ball pythons lay their eggs during the second half of the dry season, from mid-February to the beginning of April. Eggs are then hatched from mid-April to mid June. Approximately 3 weeks after ovulation, a female ball python begins to shed its skin. Eggs are laid about 4 weeks later.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average lifespan of ball pythons in captivity is 20 years. Reports document the maximum lifespan in captivity ranges from 28 years (at the Oakland Zoo) up to 50 years (reported by the Philadelphia Zoo). Average life span in the wild is reported to be 10 years.

Range lifespan

Status: captivity:
48 (high) years.

Average lifespan

Status: captivity:
20 years.

Average lifespan

Status: wild:
10 years.

Average lifespan

Status: captivity:
20 years.

Average lifespan

Sex: male

Status: captivity:
30.5 years.

Average lifespan

Status: captivity:
8.7 years.

  • Bartlett, P., B. Griswold, R. Bartlett. 2001. Reptiles, amphibians, and invertebrates: an identification and care guide. Hauppauge, New York: Barrons Educational series.
  • Bartlett, R., P. Bartlett. 2000. Ball Pythons. Hauppauge, New York: Barrons Educational series.
  • Gorzula, S., W. Nsiah, W. Oduro. 1997. "Survey of the Status and Management of the Royal Python (Python regius) in Ghana" (On-line pdf). Accessed April 23, 2010 at ec.europa.eu/environment/cites/pdf/studies/royal_python_ghana.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 47.5 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

After laying their clutch of eggs, female ball pythons coil around their clutches until hatched (after approximately 2 months). Hatchlings are immediately independent, but remain in the vicinity for months after.

Mating System: polygynandrous (promiscuous)

Ball pythons have long reproductive lives that last from about 27 months to 30 years. The breeding season is primarily from mid-September through mid-November, correlating with the minor rainy season. A clutch is from 1 to 11 eggs. The eggs typically adhere to each other. A few days before hatching they lose their adhesion. After the eggs are no longer attached and are ready to hatch, baby ball pythons slit the shells with their egg tooth and work their way out. Weight at birth is 65 to 103 grams, with an average of 86 grams. Female ball pythons reach reproductive maturity from 27 to 31 months. Males reach reproductive maturity at 16 to 18 months. Both male and female ball pythons have large cloacal spurs.

Humans can determine python sex by placing a probe through the cloacal spur and into the inverted hemipenis. The probe will travel deeper into the base of the tail for male ball pythons, spanning 8 to 10 subcaudal scales in contrast to females in which the probe may be only inserted a distance of 2 to 4 subcaudal scales.

Breeding interval: Breeding occurs yearly.

Breeding season: Breeding is from mid-September through mid-November, correlating with the minor rainy season.

Range number of offspring: 1 to 11.

Range gestation period: 44 to 54 days.

Range birth mass: 65 to 103 g.

Average birth mass: 86 g.

Average time to independence: 1 minutes.

Range age at sexual or reproductive maturity (female): 27 to 31 months.

Range age at sexual or reproductive maturity (male): 16 to 18 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average number of offspring: 7.

Once female ball pythons lay their eggs, they consistently ball around the eggs for protection. Ball pythons also stay in close proximity to eggs to protect them from predators.

Parental Investment: female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female)

  • Aubret, F., X. Bonnter, R. Shine, S. Maumelat. 2002. Clutch size manipulation, hatching success and offspring phenotype in the ball python ( Python regius ). Biological Journal of the Linnean Society, 78: 263–272.
  • De Vosjoli, P., R. Klingenberg, T. Barker, D. Barker. 1995. Ball Python Manual. Santee, California: Advanced Vivarium Systems.
  • Ellis, T., M. Chappell. 1986. Metabolism, temperature relations, maternal behavior, and reproductive energetics in the ball python (Pythonregius). Journal of Comparative Physiology B, 157/3: 393-403.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Python regius

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC0074-06|AB177878|Python regius| ACCCGTTGACTCTTCTCAACAAACCACAAAGATATCGGCACACTATACCTACTATTTGGCGCATGATCCGGACTAGTAGGCGCCTGCTTA---AGCGTACTTATACGAATAGAACTAACACAACCCGGATCGCTATTTGGCAGT---GACCAAATTTTCAACGTTCTCGTAACAGCCCACGCATTCGTAATAATCTTCTTTATAGTAATACCCATTATAATCGGAGGCTTTGGAAACTGACTTATCCCACTAATA---ATCGGGGCACCCGACATAGCATTCCCACGAATAAATAATATAAGCTTTTGACTCCTTCCCCCAGCACTACTTCTCCTACTATCTTCTTCATATGTGGAAGCAGGCGCAGGAACCGGCTGAACCGTTTACCCACCACTATCAGGCAACATAGTTCACTCGGGCCCCTCAGTAGACCTG---GCAATTTTTTCCCTCCATTTAGCCGGCGCCTCTTCAATCCTAGGGGCAATTAATTTTATCACCACATGTGTTAATATAAAACCAGCATCTATACCAATATTCAACATCCCTTTATTCGTTTGATCCGTATTAATCACAGCAATTATGCTCCTTCTAGCCCTCCCAGTACTAGCAGCA---GCCATTACAATACTCCTAACGGACCGAAATCTAAACACATCATTTTTTGACCCCTCTGGAGGAGGAGACCCCGTACTATTCCAACACCTGTTCTGATTTTTTGGCCACCCTGAAGTTTATATCCTAATTTTACCCGGATTTGGCATTATTTCTAGCATCATCACCTATTACACCGGAAAGAAA---AACACCTTTGGATACACAAGCATAATTTGAGCCATAATATCCATCGCTATTTTAGGTTTCGTAGTTTGAGCACACCACATATTTACAGTCGGCCTTG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Python regius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Auliya, M., Schmitz, A.

Reviewer/s
Böhm, M., Collen, B. & Ram, M. (Sampled Red List Index Coordinating Team)

Contributor/s
De Silva, R., Milligan, HT, Wearn, O.R., Wren, S., Zamin, T., Sears, J., Wilson, P., Lewis, S., Lintott, P. & Powney, G.

Justification
Python regius is exploited for the pet trade, but has been assessed as Least Concern as the suspected population decline is not large enough to warrant threatened status. This species has a large range and can be found in a variety of natural and altered habitats. However, the trade of this species should still be carefully monitored and the numbers exploited should be reduced.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Because of their large range and high, stable population numbers, ball pythons are not considered threatened currently. A change to highly mechanized farming and substantial use of agrochemicals may change survival rates of ball pythons, affecting populations.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no population data available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Locally, this species is poached for meat and leather. However, their biggest threat is the international pet trade. In West Africa, many thousands are captured annually and exported. In 1998, Walls states in some areas of western Africa it is likely that repeated loss of clutches to the pet trade may be leading to local extirpation of the species (Walls 1998). Captive breeding activities were thought to provide a degree of protection for this species, however, it was found that captive breeding does not confer any significant conservation benefit on the species (Jenkins 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix II. Further research into the harvest levels of this species is suggested. Improved captive breeding strategies may help in reducing the pressure from the pet trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are few negative effects of ball pythons on humans, as these snakes do not tend to be aggressive.

Negative Impacts: household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The economic importance of ball pythons to rural communities of central and western Afria is the control of rodents. The magnitude of this benefit is in the millions of dollars per year. Even though ball pythons are exported, there is little direct economic benefit to rural communities except the economic impact of providing lodging and food for trappers.  There are some areas where ball pythons are considered sacred and are fully protected. In these areas there seems to be an awareness of the benefits of these pythons.  Although ball pythons can be bred in captivity, most are imported from Africa. Approximately 30,000 to 50,000 ball pythons are exported annually to America, mostly as hatchlings from wild pythons. Ball pythons are easily handled snakes, which is what makes them good pets. Trappers of ball pythons tend to be economically vulnerable, which drives them towards trapping these snakes for export. Ball pythons are also occasionally eaten.

Positive Impacts: pet trade ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Python regius

Python regius is a nonvenomous python species found in Africa. This is the smallest of the African pythons and is popular in the pet trade, largely due to its typically docile temperament. No subspecies are currently recognized.[2] They are also known as royal pythons or ball pythons.[3] The name "ball python" refers to the animal's tendency to curl into a ball when stressed or frightened.[4] The name "royal python" (from the Latin regius) is based in part on the story that Cleopatra supposedly wore the snake around her wrist.

Contents

Description

Adults generally do not grow to more than 90–120 cm (3.0–3.9 ft) in length,[3] although some specimens have reached 152–182 cm (4.99–5.97 ft), but this is very rare.[5] Females tend to be slightly bigger than males, maturing at an average of 122–137 cm (4.00–4.49 ft). Males usually average around 90–107 cm (3.0–3.51 ft).[6] The build is stocky[3] while the head is relatively small. The scales are smooth[5] and both sexes have anal spurs on either side of the vent.[7] Although males tend to have larger spurs, this is not definitive, and sex is best determined via manual eversion of the male hemipenes or inserting a probe into the cloaca to find the inverted hemipenes (if male).[8] When probing to determine sex, males typically measure eight to ten subcaudal scales, and females typically measure two to four subcaudal scales.[5]

The color pattern is typically black or dark brown with light brown or gold sides and dorsal blotches. The belly is a white or cream that may include scattered black markings.[5] However, those in the pet industries have, through selective breeding, developed many morphs (genetic mutations) with altered colors and patterns.[9]

Geographic range

They are found in Africa from Senegal, Mali, Guinea-Bissau, Guinea, Sierra Leone, Liberia, Ivory Coast, Ghana, Benin,and Nigeria through Cameroon, Chad and the Central African Republic to Sudan and Uganda. No type locality was given in the original description.[1]

Habitat

Ball pythons prefer grasslands, savannas and sparsely wooded areas.[3]

Behavior

This terrestrial species is known for its defense strategy that involves coiling into a tight ball when threatened, with its head and neck tucked away in the middle. In this state, it can literally be rolled around. Favored retreats include mammal burrows and other underground hiding places, where they also aestivate. In captivity, they are considered good pets, for their relatively small size and placid nature make them easy to handle.[3] Captive bred adults rarely bite.

Feeding

In the wild, their diet consists mostly of small mammals, such as African soft-furred rats, shrews and striped mice. Younger individuals have also been known to feed on birds. Pythons imported from the wild tend to be picky eaters and may not respond to food as well as captive-bred pythons, which usually do well on domestic rats and mice, either live, killed, or frozen-thawed.[5] Live feeding a snake can be dangerous for the snake involved and should never be attempted by inexeperienced keepers; it should only ever be a last resort for a snake which has not ate for a considerable amount of time, and has lost weight. The size of the prey item given to a python should be equivalent to or slightly larger than the width of the largest part of its body. This python is known for being a picky eater and may not eat for months, particularly during the winter breeding season. While this is not odd, care should be taken to watch that the snake does not experience significant weight loss. Parasites can also cause the snake to not eat. Other causes of not eating are stress caused by overhandling, or too hot or cold temperatures and not enough areas to hide in the vivarium.[10]

Reproduction

Females are oviparous, with anywhere from three to 11 rather large, leathery eggs being laid (4-6 being most common).[5] These are incubated by the female under the ground, and hatch after 55 to 60 days. Sexual maturity is reached at 11–18 months for males, and 20–36 months for females. Age is only one factor in determining sexual maturity and ability to breed – weight is the second factor. Males will breed at 600 grams or more, but in captivity are often not bred until they are 800 grams (1.7 lb), and females will breed in the wild at weights as low as 800 grams, though 1200 grams or more is most common; in captivity, breeders generally wait until they are no less than 1500 g (3.3 lb). Parental care of the eggs ends once they hatch, and the female leaves the offspring to fend for themselves.[8]

Captivity

These snakes are bred in captivity and are popular as pets, because of their small size (compared to other pythons) and their docile temperament.[11] Wild-caught specimens have greater difficulty adapting to a captive environment, which can result in refusal to feed, and they generally carry internal or external parasites which must be eliminated by administering antiparasitic drugs. Specimens have survived for over 40 years in captivity, with the oldest recorded ball python being more than 48 years old.[12] [5] In captivity, most adult Python regius snakes should be kept in a minimum of a 40 US gallons (150 L), long glass tank, as these pythons are ground dwellers and are highly secretive and largely sedentary. Some large females may require cages up to the 50 US gallons (190 L) long tank. Also, at least two hiding places should be provided at different ends of the tank, one should have a thermostat-controlled heating pad under it to allow the animal to regulate its temperature. Since most snakes are adept at escaping captivity, the tank should have a locking lid. Juveniles in particular may be stressed by overly large cages that do not have sufficient small hiding spaces. For this reason, baby ball pythons do well in a 10 US gallons (38 L) or 15 US gallons (57 L) cage at first. Controlled temperatures of 80 °F (27 °C) with a 90 °F (32 °C) basking area on one end of the cage are necessary for proper health. Humidity should be maintained at 50% to 60% with dry substrate.[8]

Beliefs and folklore

This species is particularly revered in the traditional religion of the Igbo people of southeastern Nigeria. It is considered symbolic of the earth, being an animal that travels so close to the ground. Even among many Christian Igbos, these pythons are treated with great care whenever they happen to wander into a village or onto someone's property; they are allowed to roam freely or are very gently picked up and placed out in a forest or field away from any homes. If one is accidentally killed, many communities in Igboland will still build a coffin for the snake's remains and give it a short funeral.[13]

See also

References

  1. ^ a b McDiarmid RW, Campbell JA, Touré T. 1999. Snake Species of the World: A Taxonomic and Geographic Reference, vol. 1. Herpetologists' League. 511 pp. ISBN 1-893777-00-6 (series). ISBN 1-893777-01-4 (volume).
  2. ^ "Python regius". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=634784. Retrieved 12 September 2007. 
  3. ^ a b c d e Mehrtens JM. 1987. Living Snakes of the World in Color. New York: Sterling Publishers. 480 pp. ISBN 0-8069-6460-X.
  4. ^ Ball Python (Python regius) Caresheet at ball-pythons.net. Accessed 12 September 2007.
  5. ^ a b c d e f g Barker DG, Barker TM. 2006. Ball Pythons: The History, Natural History, Care and Breeding (Pythons of the World, Volume 2). VPI Library. 320 pp. ISBN 0-9785411-0-3.
  6. ^ http://www.peteducation.com/article.cfm?c=17+1831&aid=2422
  7. ^ Ball python at Pet Education. Accessed 12 September 2007.
  8. ^ a b c McCurley, Kevin. 2005. The Complete Ball Python: A Comprehensive Guide to Care, Breeding and Genetic Mutations. ECO & Serpent's Tale Nat Hist Books. 300 pp. ISBN 978-097-131-9.
  9. ^ (P. regius) Base Mutations at Graziani Reptiles. Accessed 12 September 2007.
  10. ^ http://www.ajanimalfarm.com/ballpython.htm
  11. ^ Ball Pythons, Selection and Maintenance at MSN Groups. Accessed 12 September 2007.
  12. ^ Ball python at NERD Herpetocultural Library. Accessed 5 February 2009.
  13. ^ Hambly, Wilfrid Dyson; Laufer, Berthold (1931). "Serpent worship". Fieldiana Anthropology 21 (1). http://www.archive.org/details/serpentworshipin211hamb. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!