Overview

Brief Summary

Biology

North African populations mate from April to May, and again in autumn, but this varies greatly according to locality and altitude. Nesting occurs in May and June and more than one clutch may be produced each season. Eurasian and Middle Eastern tortoises generally nest in May or June, but nesting has been observed from April to July. Clutches typically contain between one and seven eggs (average three to four), but large Algerian tortoises (T. g. whitei) lay clutches of as many as 12 to 14 eggs. Depending on their location, this species may hibernate during winter, and aestivate throughout summer (2). The Greek tortoise is herbivorous, feeding on a variety of herbaceous plants and grasses across its range (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The Greek tortoise is also known as the spur-thighed tortoise for the large conical tubercle it has on each thigh. Several subspecies are recognised, which vary greatly in colour and size. The high, domed upper shell (carapace) is around 20 cm in length in T. g. graeca, but almost twice as large in T. g. ibera. The carapace varies from yellow or tan with black or dark-brown blotching to totally grey or black, while the lower shell (plastron) may be yellow to greenish-yellow, brown, or grey, with some dark-brown or black markings. Neck, limbs, and tail are yellowish brown to grey, while the head ranges from yellow to brown, grey, or black, with or without dark spotting. Large, overlapping scales cover the front of the forelimbs and there are five claws on each foot (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Continent: Africa Near-East Asia Europe
Distribution: S Spain, Italy incl. Sardinia and Sicily (introduced), France (introduced), former Yugoslavia: Serbia, Montenegro, N Greece (including Aegean islands, e.g. Limnos, Lesbos, Chios, Samos, Samothraki),  Albania, Romania, Bulgaria, Turkey, Morocco, Algeria, Tunisia, Libya, Israel, Syria, Iran, N Iraq Russia (eastwards to Transcaucasus; Dagestan),   acording to the 1994 IUCN Red List of Threatened Animals: Albania, Algeria, Armenia, Azerbaijan, Bulgaria, Egypt, France, E Georgia, Greece, Iran, Iraq, Israel, Italy, Jordan, Lebanon, Libya, Macedonia, Moldova, Morocco, Romania, Russia, Spain, Syria, Tunisia, Turkey, Turkmenistan, Ukraine, Yugoslavia  armeniaca: Trans-Caucasus  anamurensis: Cape Anamur and SW coast of Turkey.  antakyensis: S Turkey  flavominimaralis: Tunisia  floweri: Negev (S arid Israel);
Type locality: “Negev”.  ibera: S Sebia, Greece (Lesbos, Samos), Romania through Iran.  lamberti: NW Morocco  nabeulensis: Tunisia, NW Libya;
Type locality: Nabeul, N Tunisia  nikolskii: Georgia, Russia (western Caucasus)  pallasi: Russia (Daghestan)  perses: SE Turkey, NE Iraq, SC Iran (Zagros mountains)   soussensis: Souss valley, Morocco;
Type locality: Vincity of Agadir, 30°28'N, 9°55'W.  terrestris: Israel, Lebanon, Jordan, Syria, SE Turkey.  zarudnyi: E Iran  
Type locality: "Africa," according to Linnaeus 1758:352; however, the caption of the holotype, Plate 204 of Edwards 1751 reads "Loc. Santa Cruz in West Barbary" (=old fort Santa Cruz near Oran, Algeria, according to Strauch (1862:67). Mertens and Müller (1928:22), designated it as "Santa Cruz, in der Westberberei, Nordafrika" (after KING & BURKE 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Native to southern Spain, northern Africa, Eastern Europe and the Middle East (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Syntype for Testudo graeca nabeulensis
Catalog Number: USNM 10980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: No Further Locality Data, Algeria, Africa
  • Syntype: Duméril, A. & Bibron, G. 1835. Contenant l'Histoire de Toutes les Espèces de l'Ordre des Tortues ou Chéloniens, et les Generalities de celui des Lézards ou Sauriens. Erpétologie Générale ou Histoire Naturelle complète des Reptiles. 2: 44.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North African populations occupy semi-arid scrub, grassland and brush areas in the Atlas Mountains to approximately 1,900 m above sea level, but can also be found among coastal dunes, marshland borders, rocky, brushy hillsides, and pine woods (2) (5). Eurasian and Middle-Eastern populations are found on plateaus and mountains to about 2,700 m above sea level, most often on dry open steppes, barren hillsides, and wastelands where vegetation varies from sea dune grasses to scrub thorn or dry woodlands (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 127 years (captivity) Observations: There is anecdotal evidence of one individual living over 200 years (Castanet 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Testudo graeca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGTTTTTAACCCGCTGATTTTTTTCCACTAACCATAAAGATATTGGCACCTTGTACTTGATTTTTGGGGCCTGAGCAGGAATAGTAGGTACAGCACTAAGCCTGTTAATCCGTGCAGAATTAAGCCAACCTGGAGCTCTCTTAGGGGATGACCAGATTTACAACGTTATTGTTACAGCTCACGCCTTTGTTATAATTTTCTTCATAGTTATACCAATCATAATCGGCGGCTTCGGAAACTGACTTGTACCATTAATAATTGGCGCACCAGATATAGCATTTCCACGTATAAATAACATAAGTTTTTGACTTCTACCACCATCCCTACTGCTACTGCTAGCCTCATCAGGAATTGAAGCAGGCGCAGGCACAGGCTGAACTGTATACCCCCCCCTAGCTGGAAACTTAGCCCACGCCGGTGCCTCCGTAGACCTAACTATTTTTTCCCTGCACCTGGCAGGTGTATCATCAATTCTAGGTGCTATCAATTTTATTACTACAGCAATTAATATAAAACCCCCAGCCATATCACAATACCAAACACCCCTATTTGTATGATCAGTACTTATCACAGCCGTCCTATTACTACTTTCACTACCAGTACTTGCTGCAGGTATTACTATACTACTTACAGACCGAAACCTAAATACAACTTTCTTTGATCCTTCTGGAGGAGGAGACCCAATCTTATACCAACACCTATTCTGATTCTTTGGCCATCCTGAGGTATACATCTTAATCTTACCCGGATTTGGCATAATTTCCCATGTCGTTACCTATTACGCCGGCAAAAAAGAACCATTTGGGTACATAGGAATAGTTTGAGCAATAATATCCATCGGATTCCTTGGCTTTATTGTATGAGCCCATCATATATTTACTGTAGGAATAGATGTAGACACCCGAGCCTACTTTACATCAGCAACAATAATCATTGCCATCCCAACAGGAGTAAAAGTATTCAGCTGACTAGCTACTCTACATGGAGGAATGATTAAGTGAGATGCTCCTATATTATGAGCACTCGGCTTTATCTTCTTATTTACTATTGGAGGCCTCACAGGCATTGTACTAGCTAATTCATCCTTAGACATTGTACTACATGATACCTACTATGTAGTAGCACACTTCCACTACGTACTCTCTATGGGAGCTGTATTCGCCATTATAGCAGGATTCACCCATTGATTCCCCCTTTTTACTGGATACTCATTACACCAAACTTGAGCAAAAGCCCATTTCGTAGTAATATTTACAGGAGTCAATATAACATTTTTTCCCCAACATTTCCTAGGCCTAGCCGGAATACCACGACGCTACTCCGACTACCCAGATGCATATACCCTATGAAATTCTATTTCATCAATCGGATCTTTAATTTCCCTAATAGCAGTAACCATAATAATATTCATTATCTGAGAAGCATTATCTTCAAAACGAAAAGTAATAACAATCGAGCTCACATCTACCAATGTAGAATGACTGCACGGTTGTCCACCCCCATACCACACCTACGAAGAACCAGCCCACGTACAAACCCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Testudo graeca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1cd

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Tortoise & Freshwater Turtle Specialist Group

Reviewer/s

Contributor/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2006 (1) and listed on Appendix II of CITES (3). There are several recognised subspecies, although taxonomic classification continues to be hotly debated. The IUCN only lists one subspecies, T. g. nikolskii, which is classified as Critically Endangered (CR) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

The Greek tortoise is threatened by illegal harvesting for the pet trade, as well as habitat loss and degradation, mostly due to overgrazing by livestock (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Various studies have been conducted into the population status, ecology and biology of the Greek tortoise, but these have largely been restricted to the northern part of its range, notably in Spain and Greece (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spur-thighed tortoise

The spur-thighed tortoise or Greek tortoise (Testudo graeca) is one of five species of Mediterranean tortoise (genus Testudo, family Testudinidae). The other four species are the Hermann's tortoise (Testudo hermanni), Russian tortoise (Testudo horsfieldii), Egyptian tortoise (Testudo kleinmanni), and marginated tortoise (Testudo marginata).

Distribution[edit]

The spur-thighed tortoise's habitat is North Africa, southern Europe, and southwest Asia. It is prevalent in the Black Sea coast of the Caucasus (from Russia Anapa to Abkhazia Sukhumi to the south), as well as in Georgia, Armenia, Azerbaijan, and Dagestan.

Characteristics[edit]

The Greek tortoise (Testudo graeca ibera) is often confused with Hermann's tortoise (Testudo hermanni). However, notable differences enable them to be distinguished.

Testudo graeca ibera
Testudo graeca, male
Greek tortoiseHermann's tortoise
Large symmetrical markings on the top of the headOnly small scales on the head
Large scales on the front legsSmall scales on the front legs
Undivided carapace over the tailTail carapace almost always divided
Notable spurs on each thighNo spurs
Isolated flecks on the spine and rib platesIsolated flecks only on the spinal plates
Dark central fleck on the undersideTwo black bands on the underside
Shell somewhat oblong rectangularOval shell shape
Widely stretched spinal platesSmall spinal plates
Movable posterior plates on undersideFixed plates on underside


Subspecies[edit]

Testudo graeca, 4 years

The division of spur-thighed tortoises into subspecies is difficult and confusing. Given the huge range over three continents, the various terrains, climates, and biotopes have produced a huge number of varieties, with new subspecies constantly being discovered. Currently, at least 20 subspecies are published:

  • T. g. graeca (North Africa and South Spain)
  • T. g. soussensis (South Morocco)
  • T. g. marokkensis (North Morocco)
  • T. g. nabeulensis - Tunisian spur-thighed tortoise (Tunisia)
  • T. g. cyrenaica (Libya)
  • T. g. ibera (Turkey)
  • T. g. armeniaca - Armenian tortoise (Armenia)
  • T. g. buxtoni (Caspian Sea)
  • T. g. terrestris (Israel/Lebanon)
  • T. g. zarudnyi (Iran/Azerbaijan)
  • T. g. whitei (Algeria)

This incomplete listing shows the problems in division into subspecies. The differences in form are primarily in size and weight, as well as coloration, which ranges from dark brown to bright yellow, and the types of flecks, ranging from solid colors to many spots. Also, the bending-up of the edges of the carapace ranges from minimal to pronounced. So as not to become lost in the number of subspecies, recently a few tortoises previously classified as Testudo graeca have been assigned to different species, or even different genera.

The genetic richness of Testudo graeca is also shown in their crossbreeding. Tortoises of different form groups often mate, producing offspring with widely differing shapes and color. Perhaps the best means of identification for the future is simply the place of origin.

The smallest, and perhaps the prettiest, of the subspecies is the Tunisian spur-thighed tortoise. It has a particularly bright and striking coloration. However, these are also the most sensitive tortoises of the species, so they cannot be kept outdoors in temperate climates, as cold and rainy summers quickly cause the animals to become ill. They are also incapable of long hibernation.

At the other extreme, animals from northeastern Turkey are very robust, such as Hermann's tortoise. The largest specimens come from Bulgaria. Specimens of 7 kilograms (15 lb) have been reported. In comparison, the Tunisian tortoise has a maximum weight of 0.7 kg (1.5 lb). Testudo graeca is also closely related to the marginated tortoise (Testudo marginata). The two species can interbreed, producing offspring capable of reproduction.

Sexing[edit]

Males differ from females in six main points. Firstly, they are generally smaller. Their tails are longer and taper to a point evenly, and the cloacal opening is farther from the base of the tail. The underside is somewhat curved, while females have a flat shell on the underside. The rear portion of a male's carapace is wider than it is long. Finally, the posterior plates of the carapace often flange outward.

Mating and reproduction[edit]

T. g. ibera
T. graeca

Immediately after waking from hibernation, the mating instinct starts up. The males follow the females with great interest, encircling them, biting them in the limbs, ramming them, and trying to mount them. During copulation, the male opens his mouth, showing his red tongue and making squeaking sounds.

During mating, the female stands still, bracing herself with her front legs, moving the front part of her body to the left and right in the same rhythm as the male's cries. One successful mating will allow the female to lay eggs multiple times. When breeding in captivity, the pairs of females and males must be kept separate. If multiple males in are a pen, one takes on a dominant role and will try to mate with the other males in the pen. If more males than females are in a pen, the males might kill each other to mate with the female.

One or two weeks before egg-laying, the animals become notably agitated, moving around to smell and dig in the soil, even tasting it, before choosing the ideal spot to lay the eggs. One or two days before egg-laying, the female takes on an aggressive, dominant behavior, mounting another animal as for copulation and making the same squeaking sound the male produces during copulation. The purpose for this behavior is to produce respect in the tortoise community, so that the female will not be disturbed by the others during egg laying. Further details of egg-laying behavior are the same as those detailed for the marginated tortoise.

Trade[edit]

Spur-thighed tortoises are commonly traded as pets. In source countries such as Morocco, this can lead to unsustainable removal of wild individuals for local pet trade and for export. [2]

See also[edit]

Notes[edit]

References[edit]

  1. ^ Fritz, Uwe; Havaš, Peter (2007). "Checklist of Chelonians of the World". Vertebrate Zoology 57 (2): 296–300. ISSN 18640-5755. Archived from the original on 2010-12-17. Retrieved 29 May 2012. 
  2. ^ Bergin and Nijman (2014). "Open, Unregulated Trade in Wildlife in Morocco’s Markets, TRAFFIC Bulletin". Retrieved 23 March 2015. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!