Overview

Distribution

Range Description

This species is extremely widespread throughout southern and Southeast Asia (Gaulke and Horn 2004). Varanus salvator salvator is endemic to Sri Lanka, while V. s. macromaculatus occurs throughout southern Asia and Southeast Asia, and as far north as southern China (Koch et al. 2007, Somaweera and Somaweera 2009). It also occurs on Borneo and Sumatra. V. s. andamensis is endemic to the Andaman Islands and V. s. bivittatus occurs on Java and some of the Lesser Sunda islands (Gaulke and Horn 2004, Horn and Gaulke 2004, Koch et al. 2007). Recent work has shown that the species is absent from northeastern Myanmar, northern and northeastern Thailand, all but coastal Cambodia, and all of Laos except for the ranges on the Vietnam border (Cota et al. 2009); it is also absent from northwestern Vietnam, Yunnan, and all but the immediate coastal strip of south China adjacent to Hainan, as well as Timor and Seram and from part of the Lesser Sunda chain (M. Cota and S. Sweet pers. comm.). Although the species has an upper elevational limit of 1,800 m above sea level, it is typically a lowland species which is common only in areas up to 600 m and rare at higher altitudes, particularly above 1,000 m (M. Gaulke pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Varanus salvator occurs throughout much of southern Asia, from India in the west to the Philippines and the Indo-Australian islands in the east.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Asia
Distribution: Sri Lanka, NE India (incl. Nicobar Islands, Andaman Islands), Bangladesh, Myanmar (= Burma), Cambodia, Laos, Vietnam, S China (Hong Kong, Guangdong, Hainan, Guangxi, S Yunnan), Thailand (incl. Phuket), Malaysia (incl. Pulau Tioman, Johor: Pulau Besar), Singapore, Indonesia (Borneo, Sumatra, Nias, Enggano, Bangka, Kalimantan, Java, Bali, Lombok, Sumbawa, Flores, Wetar, Sulawesi),  USA (possibly introduced to Florida)  adamanensis: Andaman Islands;
Type locality: Port Blair, Andaman Islands.  bivittatus: Java, Bali, Lombok, Sumbawa, Flores, Ombai (Alor), Wetar and some neighbouring islands within the Sunda arch, Indonesia;
Type locality: Java (designated by MERTENS 1959).  komaini: Thailand.
Type locality: Amphoe La-ngu, Satun Prov., Thailand, and Thai-Malaysian bodeer area.  macromaculatus: Thailand, Cambodia, Laos, Vietnam, Myanmar, Bangladesh, Malaysia, Indonesia (Sumatra, Borneo)  salvator: restricted to Sri Lanka (KOCH et al. 2007);
Type locality: America (in error); emended to "Ceylon" (= Sri Lanka) by Mertens (1959).  ziegleri: Obi Island, Indonesia;
Type locality: Kali Telaga, Obi Island, Maluku Province, Central Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Varanus salvator is reported to grow to 3 meters in length, but most adults are 1.5 meters long at most. Individuals have a black temporal band edged with yellow that extends back from each eye. The neck of this monitor is very long with an elongated snout. The nostrils are close to the end of the nose. The tail is laterally compressed and has a dorsal keel. The scales on the top of the head are relatively large, whil those on the back are smaller in size and are keeled.

The color of the Water Monitor is usually dark brown or blackish, with yellow spots on the underpart of the lizard. The yellow markings on the species tend to diminish as the individual becomes older (Steel, 1996).

  • Steel, R. 1996. Living Dragons. London: Ralph Curtis Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is semi-aquatic and opportunistic and inhabits a variety of natural habitats, such as primary forests and mangrove swamps (Gaulke and Horn 2004, Weijola 2010). The presence of man does not deter these monitors from areas with human disturbance (Gaulke et al. 1999), as they have been reported to thrive in agricultural areas (e.g., rice, oil palm) and even cities with canal systems (e.g. in Sri Lanka, where they are not or hardly disturbed, hunted and prosecuted by man; M. Gaulke pers. comm.) and second-growth forest (S. Sweet pers. comm.). Furthermore, their aquatic habits provide them with a measure of safety (E. Pianka pers. comm.), and their generalist diet may provide added ecological plasticity to this species (Somaweera and Somaweera 2009). In Borneo and Sulawesi, the species in this complex seem to be less tolerant of human activities and do not generally thrive in agricultural regions where there is extensive loss of natural vegetation (S. Sweet pers. comm.).

Although the species may inhabit all the habitats listed above in at least parts of its range, they cannot all be considered equally as important. The habitats considered most important to this species are mangrove vegetation, swamp and wetlands at altitudes of below 1,000 m (Gaulke and Horn 2004).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Varanus salvator is semi-aquatic and has a wide range of habitats. They are frequently seen on river banks and in swamps. The Water Monitor is a water-dependent species and has been known to cross large stretches of water, explaining its wide distribution.(Taylor, 1966).

Though also found on flat land, a typical burrow is in a river bank. The entrance starts on a downward slope but then increases forming a shallow pool of water. The average length is about 9.5 m, the average depth is about 2 m, and the average temperature is around 26 degrees Celsius (Traeholt, 1995).

Terrestrial Biomes: forest

Aquatic Biomes: rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Water Monitor is an extreme carnivore. This means that the lizard will eat about any animal that it believes it can consume (see additional comments). Among some of the common prey includes: birds and their eggs, small mammals (especially rats), fish, lizards, frogs, snakes, juvenile crocodiles, and tortoises. Like the Komodo Dragon, the Water Monitor has been known to dig up corpses of humans and devour them as well.

The primary hunting technique used by Varanus salvator, as well as by other monitors, is characterized by 'open pursuit' hunting, rather than stalking and ambushing. The lizard is very fast for it size due to its powerful leg muscles (Shine & Harlow, 1996).

While hunting for aquatic prey, Varanus salvator can remain submerged for up to 30 minutes (Taylor, 1963).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
10.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.7 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Males are normally larger than the females, usually twice as large in mass. The maturation of the male occurs when the individual is about 1-meter in size and the female at about 50-cm. The breeding season begins in April and lasts until October. However the testes of the male are the largest during April and the female is more receptive, thus there is an increase in reproductive success the earlier fertilization takes place (Shine, 1996).

Larger females produce a larger clutch size than smaller individuals. The eggs are usually deposited along rotting logs or stumps.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Varanus salvator

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC5130-08|NC_010974|Varanus salvator| ACCCGCTGACTCTTCTCCACAAACCACAAAGACATTGGAACCCTTTACCTTATCTTTGGCACCTGAGCCGGAATAATTGGAACCGCCATA---AGCCTTCTTATCCGAGCGGAACTTAGCCAGCCCGGAACCATTCTCGGAAAT---GACCAAATCTATAACGTTGTAGTAACCGCACACGCGCTCGTCATAATCTTCTTTATAGTTATGCCAATCATAATCGGGGGCTTTGGAAACTGGCTAGTTCCCCTAATA---ATTGGTGCCCCAGACATGGCCTTTCCACGAATGAACAACATAAGTTTCTGACTCCTCCCCCCTTCACTACTCCTTCTCCTTGCCTCAGCCTGAGTCGAAACTGGCTCTGGAACAGGATGAACCGTATATCCACCCCTCGCAGGAAATATGGCCCACGCCGGGGCATCAGTCGACCTA---ACAATCTTCTCCCTCCATCTGGCAGGCATTTCATCAATCCTTGGTGCTATCAACTTCATCACCACATGTATCAATATAAAACCCCCTGCAATAACACAATACCACATACCCCTATTCGTGTGGTCAGTCTTAATTACCGCAGTCCTCCTCCTCCTCTCCCTTCCAGTTCTTGCAGCA---GGAATCACCATACTCCTGACAGATCGCAACTTAAATACCTCTTTCTTTGACCCAGCCGGTGGAGGGGACCCAATCCTTTACCAACACCTATTCTGATTCTTCGGACACCCAGAGGTATACATTTTAATCTTGCCCGGGTTTGGAATAATTTCCCACATCATCTCCTACTACTCCAACAAGAAA---GAACCATTTGGCTACATAGGCATAGTATGGGCCATAATATCAATTGGTCTACTTGGATTCCTAGTCTGAGCCCACCACATATTTACTGGTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Varanus salvator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Bennett, D., Gaulke, M., Pianka, E.R., Somaweera, R. & Sweet, S.S.

Reviewer/s
Böhm, M., Collen, B. & Ram, M. (Sampled Red List Index Coordinating Team)

Contributor/s
De Silva, R., Milligan, HT, Wearn, O.R., Wren, S., Zamin, T., Sears, J., Wilson, P., Lewis, S., Lintott, P. & Powney, G.

Justification
Varanus salvator has been assessed as Least Concern. This species has a wide distribution, can be found in various habitats, and adapts to habitats disturbed by humans. It is also abundant in parts of its range, despite large levels of harvesting. However, significant taxonomic uncertainty still surrounds this species. While morphological analyses have already started to unravel this taxonomic uncertainty, molecular studies are needed to corroborate this evidence. This is of utmost importance since any future taxonomic changes will also warrant a review of the conservation status of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although killed extensively for its skin, this species seems to be resilient. It has been proposed that this is because large females, who produce larger clutches, are avoided by the leather trade (Steel, 1996).

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species group is thought to be abundant in many places (Gaulke and Horn 2004), including some cities like Bangkok (E. Pianka pers. comm.), but no specific population data exists.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The main threat to this species comes from hunting, as the skin of this species is used in the leather trade, its meat is eaten, and its fat is used in traditional medicine. Although in 1998 the annual allowable catch was set at 454,000 (Auliya et al. 1999) and the skin trade has decreased slightly since the 1990s, extensive hunting still occurs in many areas, with national and international protective legislation being ignored. As a result, some populations are likely to go locally extinct. However, in other areas, this species is still abundant (Herrmann 1999, E. Pianka pers. comm.). This resilience may be because of this species' ecological flexibility, high reproductive rates, or the fact that harvesting is mainly concentrated on males (Shine et al. 1996).

Apart from direct utilization of this species, destruction of habitats for oil palm plantations, farming, timber, and firewood have caused declines in population numbers in some areas, particularly in Borneo and Sulawesi, where the species in this complex seem to be less tolerant of human activities and do not generally thrive in agricultural regions (S. Sweet pers. comm.). It is likely that habitat loss was the main reason for population declines in those areas where this species has disappeared (D. Bennett pers. comm.).

In Sri Lanka, the species is not hunted for meat due to the belief that its meat is toxic, but the oil extracted from it is used for traditional medicine and witchcraft. However, this is a very trivial threat compared to the numbers lost from road traffic (R. Somaweera pers. comm.). Since the species can tolerate very polluted habitats, and thrive in areas with high anthropogenic activity, habitat degradation and loss may not be major threats to this species in Sri Lanka (R. Somaweera pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Parts of this species' distribution range coincide with protected areas; however, the species is reported as absent from Yala National Park in Sri Lanka, possibly caused by the high density of crocodiles in the park (Somaweera and Somaweera 2009). Because of the recent changes of Varanus salvator taxonomy based on morphological analyses, DNA sequencing work is urgently needed to validate the genetic differences between subspecies, which is likely to alter the taxonomy of this species and hence the outcome of future conservation assessments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Skins of Varanus salvator are used for dietary protein, ceremonies, medicine, and leather goods. Annual trade in these skins may reach more than 1 million whole skins a year, mostly in Indonesia for the leather trade. Medium-sized individual are preferred because the skin of large animals is too tough and thick to shape (Shine, 1996).

There is small trade in live monitors, but they are not suitable pets for a majority of the owners.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Water monitor

For large firefighting devices, see Deluge gun.
For the Australian species with a similar common names, see Mertens' Water Monitor and Mitchell's Water Monitor.

Contents

Description

The Water monitor, (Varanus salvator) is a large species of monitor lizard capable of growing to 3.21 metres (10.5 ft) in length, with the average size of most adults at 1.5 metres (4.9 ft) long.[1] Maximum weight of Varanus salvator can be over 25 kilograms (55 lb), but most are half that size. Their body is muscular with a long, powerful, laterally compressed tail. Water monitors are one of the most common monitor lizards found throughout Asia, and range from Sri Lanka, India, Indochina, the Malay Peninsula and various islands of Indonesia, living in areas close to water.

Etymology

The generic name Varanus is derived from the Arabic waral (ورل), which translates as "monitor" in English. The specific name is the Latin word for "Saviour" denoting a possible religious connotation.[2] The Water monitor is occasionally confused with the Crocodile monitor (V. salvadorii) because of their similar scientific names.[3]

In Thailand, the word water monitor or actually local word 'เหี้ย' (hia) is used as an insulting word for bad and evil things including a bad person. Its name is also considered a word bringing a bad luck, so some people prefer to call them 'ตัวเงินตัวทอง' which means 'silver and gold' in Thai to avoid the jinx.

The origin of this offensive meaning can be traced back to a time when more people lived in rural areas in close proximity to monitor lizards. Traditionally, Thai villagers lived in 2-story houses, the top floor was for living while the ground floor was designed to be a space for domestic animals such as pigs, chickens, and dogs. Water monitors would enter the ground floor and eat or maim the domestic animals, also hence the other name 'ตัวกินไก่' (Tua kin kai - chicken eater).

In Indonesian and Malay, the water monitor is called 'biawak'.

Water monitor at Kandy Lake, Sri Lanka

Subspecies of Varanus salvator

Behavior and diet

Water monitors can be defensive, using their tail, claws, and jaws when fighting. They are excellent swimmers, using the raised fin located on their tails to steer through water. Water Monitors are carnivores, and have a wide range of foods. They are known to eat fish, frogs, rodents, birds, crabs, and snakes.[2] They have also been known to eat turtles, as well as young crocodiles and crocodile eggs[6] Like the Komodo Dragon, they will often eat carrion.[2]

Conservation

In Hong Kong, it is a protected species under Wild Animals Protection Ordinance Cap 170. In Malaysia, this species is one of the most common wild animals around with numbers comparable to that of the population of macaques there. Although many fall prey to humans via road kill and animal cruelty, it still thrives in most states of Malaysia especially in the shrubs of the east-coast states such as Pahang and Terengganu. Malay "kampung" boys and young working class Malay men often catch and kill water monitors for their own amusement although the widespread population of the species causes the lack of conservation attention. In the east-coast states of Malaysia, this species is very common in roadkill. In Thailand, all monitor lizards are protected species.[7]

Gallery

Closeup of the head
Closeup of split tongue
Resting on tree limb in Bangkok, Thailand
A hatchling

References

  1. ^ Pianka, King & king. Varanoid lizards of the world. 2004
  2. ^ a b c Robert George Sprackland (1992). Giant lizards. Neptune, NJ: T.F.H. Publications. ISBN 0-86622-634-6. 
  3. ^ Netherton, John; Badger, David P. (2002). Lizards: A Natural History of Some Uncommon Creatures--Extraordinary Chameleons, Iguanas, Geckos, and More. Stillwater, MN: Voyageur Press. pp. 140–141. ISBN 0-7603-2579-0. 
  4. ^ a b c Koch, A., M. Auliya, A. Schmitz, U. Kuch & W. Böhme. (2007). Morphological Studies on the Systematics of South East Asian Water Monitors (Varanus salvator Complex): Nominotypic Populations and Taxonomic Overview. pp. 109-180. In Horn, H.-G., W. Böhme & U. Krebs (eds.), Advances in Monitor Research III. Mertensiella 16, Rheinbach.
  5. ^ monitor-lizards.net. "Soterosaurus: Mindanao Water Monitor". http://www.monitor-lizards.net/species/soterosaurus/cumingi.html. Retrieved 20 March 2012. 
  6. ^ Whitaker, Rom (1981) Bangladesh - Monitors and turtles Hamadryad. 6 (3): 7-9
  7. ^ "Species Diversity, Distribution and Proposed Status of Monitor Lizards (Family Varanidae) in Southern Thailand". The Natural History Journal of Chulalongkorn University (Chulalongkorn University) 1 (1): 39–46. 2001-08. http://www2.biology.sc.chula.ac.th/web%20of%20NHJCU%20PDF/1-1,%2039-46.pdf. Retrieved 2009-06-28. 
  • Bennett, Daniel 1995 The water monitor Varanus salvator Reptilian 3 (8): 15-21
  • Das, Indraneil 1988 New evidence of the occurrence of water monitor (Varanus salvator) in Meghalaya J. Bombay Nat. Hist. Soc. 86: 253-255
  • Deraniyagala, P. E. P. 1944 Four New Races of the Kabaragoya Lizard Varanus salvator. Spolia Zeylanica 24: 59-62
  • Pandav, Bivash 1993 A preliminary survey of the water monitor (Varanus salvator) in Bhitarkanika Wildlife Sanctuary, Orissa Hamadryad 18: 49-51
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!