Molecular Biology and Genetics

Molecular Biology

Barcode data: Palythoa sp. singaporensis JDR-2008

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCCGGAACTATGTTGGGGGAC---GACCATCTTTATAATGTAATCGTGACTGCGCATGCTTTTGTTATGATCTTTTTCCTGGTGATGCCGGTGATGATAGGGGGGTTTGGGAATTGGTTGGTGCCGCTA---TATATCGGTGCACCAGATATGGCCTTCCCGCGACTAAATAACATTAGTTTCTGGCTCTTGCCCCCCGCCCTAATTCTATTGTTGGGTTCCGCCTTTGTGGAACAGGGGGCAGGAACAGGTTGGACGGTGTATCCGCCTCTTTCAGCCATTCAAGCTCAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Palythoa sp. singaporensis JDR-2008

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Palythoa sp. JVK-2006

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AGCCGTTGGGTGTTTTCCACTAATCATAAAGATATCGGCACATTATATCTAATATTTGGTGTTGGGGCCGGTATGGTAGGAACAGCTTTCAGTATGTTGATAAGGTTAGAACTTTCTGCCCCCGGAACTATGTTGGGGGAC---GACCATCTTTATAATGTAATCGTGACTGCGCATGCCTTTGTTATGATCTTTTTCCTGGTGATGCCGGTGATGATAGGGGGGTTTGGGAATTGGTTGGTGCCGCTATATATCGGTGCACCAGATATGGCCTTCCCGCGACTAAATAACATTAGTTTCTGGCTCTTGCCCCCCGCCCTAATTCTATTGTTGGGTTCCGCCTTTGTGGAACAGGGGGCAGGAACAGGTTGGACGGTGTATCCGCCCCTTTCAGCCATTCAAGCTCATTCGGGGGGGGCCGTGGACATGGCTATATTTAGCCTCCACTTGGCCGGGGTCTCTTCCATCTTAGGGGCTATGAATTTTATCACCACTATATTTAATATGAGGGCCCCGGGTATGACAATGGATAGATTGCCACTATTTGTGTGGTCTATCTTAATCACCGCCTTCTTATTGTTACTGTCTTTGCCCGTATTGGCCGGGGCTATAACCATGCTGTTGACAGATAGGAATTTTAACACTACTTTCTTTGACCCCGCCGGAGGGGGGGACCCGATTCTGTTTCAACATCTCTTTTGGTTTTTTGGCCATCCGGAGGTTTATATTCTAATATTGCCTGGTTTTGGGATGATCTCCCAAATAATTCCCACCTTTGCTGCTAAAAAACAAATTTTTGGATACTTGGGCATGGTCTATGCAATGTTATCTATTGGGGTATTAGGCTTTATTGTGTGGGCTCACCACATGTTTACAGTAGGGATGGACATAGATACCAGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Palythoa sp. JVK-2006

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Palythoa sp. 289

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGGTAGGAACAGCTTTC---AGTATGTTGATAAGGTTAGAACTTTCTGCCCCCGGAACTATGTTGGGGGAC---GACCATCTTTATAATGTAATCGTGACTGCGCATGCCTTTGTTATGATCTTTTTCCTGGTGATGCCGGTGATGATAGGGGGGTTTGGGAATTGGTTGGTGCCGCTA---TATATCGGTGCACCAGATATGGCCTTCCCGCGACTAAATAACATTAGTTTCTGGCTCTTGCCCCCCGCCCTAATTCTATTGTTGGGTTCCGCCTTTGTGGAACAGGGGGCAGGAACAGGTTGGACGGTGTATCCGCCCCTTGCAGCCATTCAAGCTCATTCGGGGGGGGCCGTGGACATG---GCTATATTTAGCCTCCACTTGGCCGGGGTCTCTTCCATCTTAGGGGCTATGAATTTTATCACCACTATATTTAATATGAGGGCCCCGGGTATGACAATGGATAGATTGCCACTATTTGTGTGGTCTATCTTAATCACCGCCTTCTTATTGTTACTGTCTTTGCCCGTATTGGCCGGG---GCTATAACCATGCTGTTGACAGATAGGAATTTTAACACTACTTTCTTTGACCCCGCCGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Palythoa sp. 289

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Palythoa sp. 296

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGGTGTTGGGGCCGGTATGGTAGGAACAGCTTTC---AGTATGTTGATAAGGTTAGAACTTTCTGCCCCCGGAACTATGTTGGGGGAC---GACCATCTTTATAATGTAATCGTGACTGCGCATGCCTTTGTTATGATCTTTTTCCTGGTGATGCCGGTGATGATAGGGGGGTTTGGGAATTGGTTGGTGCCGCTA---TATATCGGTGCACCAGATATGGCCTTCCCGCGACTAAATAACATTAGTTTCTGGCTCTTGCCCCCCGCCCTAATTCTATTGTTGGGTTCCGCCTTTGTGGAACAGGGGGCAGGAACAGGTTGGACGGTGTATCCGCCCCTTTCAGCCATTCAAGCTCATTCGGGGGGGGCCGTGGACATG---GCTATATTTAGCCTCCACTTGGCCGGGGTCTCTTCCATCTTAGGGGCTATGAATTTTATCACCACTATATTTAATATGAGGGCCCCGGGTATGACAATGGATAGATTGCCACTATTTGTGTGGTCTATCTTAATCACCGCCTTCTTATTGTTACTGTCTTTGCCCGTATTGGCCGGG---GCTATAACCATGCTGTTGACAGATAGGAATTTTAACACTACTTTCTTTGACCCCGCCGGAGGGGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Palythoa sp. 296

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Palythoa sp. PM2

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AATATTTGGTGTTGGGGCCCG---------------------------------------GTATGG---------GTAGGAACAGCTTTCAGTATGTTGATAAGGTTAGAACTTTCTGCCCCCGGAACTATGTTGGGGGAC---GACCATCTTTATAATGTAATCGTGACTGCGCATGCCTTTGTTATGATCTTTTTCCTGGTGATGCCGGTGATGATAGGGGGGTTTGGGAATTGGTTGGTGCCGCTATATATCGGTGCACCAGATATGGCCTTCCCGCGACTAAATAACATTAGTTTCTGGCTCTTGCCCCCCGCCCTAATTCTATTGTTGGGTTCCGCCTTTGTGGAACAGGGGGCAGGAACAGGTTGGACGGTGTATCCGCCCCTTGCAGCCATTCAAGCTCATTCGGGGGGGGCCGTGGACATGGCTATATTTAGCCTCCACTTGGCCGGGGTCTCTTCCATCTTAGGGGCTATGAATTTTATCACCACTATATTTAATATGAGGGCCCCGGGTATGACAATGGATAGATTGCCACTATTTGTGTGGTCTATCTTAATCACCGCCTTCTTATTGTTACTGTCTTTGCCCGTATTGGCCGGGGCTATAACCATGCTGTTGACAGATAGGAATTTTAACACTACTTTCTTTGACCCCGCCGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Palythoa sp. PM2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Palythoa sp. PM1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AATATTTGGTGTTGGGGCCCG---------------------------------------GTATGG---------GTAGGAACAGCTTTCAGTATGTTGATAAGGTTAGAACTTTCTGCCCCCGGAACTATGTTGGGGGAC---GACCATCTTTATAATGTAATCGTGACTGCGCATGCCTTTGTTATGATCTTTTTCCTGGTGATGCCGGTGATGATAGGGGGGTTTGGGAATTGGTTGGTGCCGCTATATATCGGTGCACCAGATATGGCCTTCCCGCGACTAAATAACATTAGTTTCTGGCTCTTGCCCCCCGCCCTAATTCTATTGTTGGGTTCCGCCTTTGTGGAACAGGGGGCAGGAACAGGTTGGACGGTGTATCCGCCCCTTGCAGCCATTCAAGCTCATTCGGGGGGGGCCGTGGACATGGCTATATTTAGCCTCCACTTGGCCGGGGTCTCTTCCATCTTAGGGGCTATGAATTTTATCACCACTATATTTAATATGAGGGCCCCGGGTATGACAATGGATAGATTGCCACTATTTGTGTGGTCTATCTTAATCACCGCCTTCTTATTGTTACTGTCTTTGCCCGTATTGGCCGGGGCTATAACCATGCTGTTGACAGATAGGAATTTTAACACTACTTTCTTTGACCCCGCCGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Palythoa sp. PM1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Palythoa sp. mutaki 1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTTGGTGTTGG------------------------------------------------GGCCCNGGTATGGTAGGAACAGCTTTCAGTATGTTGATAAGGTTAGAACTTTCTGCCCCCGGAACTATGTTGGGGGAC---GACCATCTTTATAATGTAATCGTGACTGCGCATGCCTTTGTTATGATCTTTTTCCTGGTGATGCCGGTGATGATAGGGGGGTTTGGGAATTGGTTGGTGCCGCTATATATCGGTGCACCAGATATGGCCTTCCCGCGACTAAATAACATTAGTTTCTGGCTCTTGCCCCCCGCCCTAATTCTATTGTTGGGTTCCGCCTTTGTGGAACAGGGGGCAGGAACAGGTTGGACGGTGTATCCGCCCCTTGCAGCCATTCAAGCTCATTCGGGGGGGGCCGTGGACATGGCTATATTTAGCCTCCACTTGGCCGGGGTCTCTTCCATCTTAGGGGCTATGAATTTTATCACCACTATATTTAATATGAGGGCCCCGGGTATGACAATGGATAGATTGCCACTATTTGTGTGGTCTATCTTAATCACCGCCTTCTTATTGTTACTGTCTTTGCCCGTATTGGCCGGGGCTATAACCATGCTGTTGACAGATAGGAATTTTAACACTACTTTCTTTGACCCCGCCGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Palythoa sp. mutaki 1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Palythoa sp. mutaki 2

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTGGTGTTGGGGCCGGTATGGTAGGAACAGCTTTCAGTATGTTGATAAGGTTAGAACTTTCTGCCCCCGGAACTATGTTGGGGGAC---GACCATCTTTATAATGTAATCGTGACTGCGCATGCCTTTGTTATGATCTTTTTCCTGGTGATGCCGGTGATGATAGGGGGGTTTGGGAATTGGTTGGTGCCGCTATATATCGGTGCACCAGATATGGCCTTCCCGCGACTAAATAACATTAGTTTCTGGCTCTTGCCCCCCGCCCTAATTCTATTGTTGGGTTCCGCCTTTGTGGAACAGGGGGCAGGAACAGGTTGGACGGTGTATCCGCCCCTTTCAGCCATTCAAGCTCATTCGGGGGGGGCCGTGGACATGGCTATATTTAGCCTCCACTTGGCCGGGGTCTCTTCCATCTTAGGGGCTATGAATTTTATCACCACTATATTTAATATGAGGGCCCCGGGTATGACAATGGATAGATTGCCACTATTTGTGTGGTCTATCTTAATCACCGCCTTCTTATTGTTACTGTCTTTGCCCGTATTGGCCGGGGCTATAACCATGCTGTTGACAGATAGGAATTTTAACACTACTTTCTTTGACCCCGCCGGAGGGGGGGACCCGATTCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Palythoa sp. mutaki 2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Palythoa sp. Amami (brown)

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTAATATTTGGTGTTGGGGCCGGTATGGTAGGAACAGCTTTCAGTATGTTGATAAGGTTAGAACTTTCTGCCCCCGGAACTATGTTGGGGGAC---GACCATCTTTATAATGTAATCGTGACTGCGCATGCCTTTGTTATGATCTTTTTCCTGGTGATGCCGGTGATGATAGGGGGGTTTGGGAATTGGTTGGTGCCGCTATATATCGGTGCACCAGATATGGCCTTCCCGCGACTAAATAACATTAGTTTCTGGCTCTTGCCCCCCGCCCTAATTCTATTGTTGGGTTCCGCCTTTGTGGAACAGGGGGCAGGAACAGGTTGGACGGTGTATCCGCCCCTTTCAGCCATTCAAGCTCATTCGGGGGGGGCCGTGGACATGGCTATATTTAGCCTCCACTTGGCCGGGGTCTCTTCCATCTTAGGGGCTATGAATTTTATCACCACTATATTTAATATGAGGGCCCCGGGTATGACAATGGATAGATTGCCACTATTTGTGTGGTCTATCTTAATCACCGCCTTCTTATTGTTACTGTCTTTGCCCGTATTGGCCGGGGCTATAACCATGCTGTTGACAGATAGGAATTTTAACACTACTTTCTTTGACCCCGCCGGAGGGGGGGACCCGATTCTGTTTCAACATCTCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Palythoa sp. Amami (brown)

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Palythoa sp. Yakushima (green)

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTAATATTTGGTGTTGGGGCCGGTATGGTAGGAACAGCTTTCAGTATGTTGATAAGGTTAGAACTTTCTGCCCCCGGAACTATGTTGGGGGAC---GACCATCTTTATAATGTAATCGTGACTGCGCATGCCTTTGTTATGATCTTTTTCCTGGTGATGCCGGTGATGATAGGGGGGTTTGGGAATTGGTTGGTGCCGCTATATATCGGTGCACCAGATATGGCCTTCCCGCGACTAAATAACATTAGTTTCTGGCTCTTGCCCCCCGCCCTAATTCTATTGTTGGGTTCCGCCTTTGTGGAACAGGGGGCAGGAACAGGTTGGACGGTGTATCCGCCCCTTGCAGCCATTCAAGCTCATTCGGGGGGGGCCGTGGACATGGCTATATTTAGCCTCCACTTGGCCGGGGTCTCTTCCATCTTAGGGGCTATGAATTTTATCACCACTATATTTAATATGAGGGCCCCGGGTATGACAATGGATAGATTGCCACTATTTGTGTGGTCTATCTTAATCACCGCCTTCTTATTGTTACTGTCTTTGCCCGTATTGGCCGGGGCTATAACCATGCTGTTGACAGATAGGAATTTTAACACTACTTTCTTTGACCCCGCCGGAGGGGGGGACCCGATTCTGTTTCAACATCTCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Palythoa sp. Yakushima (green)

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!