Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"An animal that does not begin to shiver until temperatures reach -70 C, the arctic fox is one of the most superbly cold-adapted mammals. Its dense, multi-layered coat, which is several inches thick during winter, provides excellent heat insulation. Short ears, a short muzzle, and short limbs reduce heat loss by minimizing the amount of body surface area exposed to the cold. Even the pads on the soles of the feet are covered with fur to insulate them. Arctic foxes change color seasonally. Most populations are grayish-brown in summer and white in the winter. Others are dark brown or blush-gray in summer and ""blue,"" a steely blue-gray, in the winter. Like other foxes, arctic foxes tend to be solitary and mostly nocturnal. They hunt for lemmings, voles, birds, and other prey in the summer, but scavenge for carrion during the harsh winter, sometimes following polar bears or wolves to feed on the remains of caribou or seals the larger predators have killed."

Links:
Mammal Species of the World
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:40, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Arctic foxes are found in the treeless tundra extending through the arctic regions of Eurasia, North America, Greenland, and Iceland.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Arctic Fox has a circumpolar distribution in all Arctic tundra habitats. It breeds north of and above the tree line on the Arctic tundra in North America and Eurasia and on the alpine tundra in Fennoscandia, ranging from northern Greenland at 88°N to the southern tip of Hudson Bay, Canada, 53°N. The southern edge of the species' distribution range may have moved somewhat north during the 20th century resulting in a smaller total range (Hersteinsson and Macdonald 1992). The species inhabits most Arctic islands and many islands in the Bering Sea. The Arctic Fox was also introduced to previously isolated islands in the Aleutian chain at the end of the 19th century by the fur industry (Bailey 1992), where they are now often being eliminated by bird conservation efforts (Walton et al. 2013). The Arctic Fox has also been observed on the sea ice up to the North Pole. They may occur up to 3,000 m asl in elevation.

During the last glaciation, the Arctic Fox had a distribution along the ice edge, and Arctic Fox remains have been found in a number of Pleistocene deposits over most of Europe and large parts of Siberia (Dalén et al. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Circumarctic. In North America: northern and western Alaska and northern Canada south to northern Northwest Territories, northeastern Alberta, northern Manitoba, and northern Quebec; sometimes farther south.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 5200 g.

Average basal metabolic rate: 7.665 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 91 cm

Weight: 4000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are 10%-20% larger than females.

Length:
Average: 853 mm males; 821 mm females
Range: 830-1,100 mm males; 713-850 mm females

Weight:
Average: 3.5 kg males; 2.9 kg females
Range: 3.2-9.4 kg males; 1.4-3.2 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Arctic foxes are found mainly in arctic and alpine tundra, usually in coastal areas.

Habitat Regions: polar ; terrestrial

Terrestrial Biomes: tundra ; icecap

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Inhabits Arctic and alpine tundra on the continents of Eurasia, North America and the Canadian archipelago, Siberian islands, Greenland, inland Iceland and Svalbard, and Sub-Arctic maritime habitat in the Aleutian island chain, Bering Sea Islands, Commander Islands and coastal Iceland.

The Arctic Fox is an opportunistic predator and scavenger but in most inland areas, the species is heavily dependent on fluctuating rodent populations. The species' main prey items include lemmings, both Lemmus spp. and Dicrostonyx spp. (Macpherson 1969, Angerbjörn et al. 1999). In Fennoscandia, Lemmus lemmus was the main prey in summer (85% frequency of occurrence in faeces) followed by birds (Passeriformes, Galliformes and Caridriiformes, 34%) and reindeer (Rangifer tarandus) (21%; Elmhagen et al. 2000). In winter, ptarmigan and grouse (Lagopus spp.) are common prey in addition to rodents and reindeer (Kaikusalo and Angerbjörn 1995). Changes in fox populations have been observed to follow those of their main prey in three- to five-year cycles (Macpherson 1969, Angerbjörn et al. 1999, 2013) with up to 20 cubs produced by a single female (Tannerfeldt and Angerbjörn 1998).

Foxes living near ice-free coasts have access to both inland prey and sea birds, seal carcasses, fish and invertebrates connected to the marine environment, leading to relatively stable food availability and a more generalist strategy (Hersteinsson and Macdonald 1996). In late winter and summer, foxes found in coastal Iceland feed on seabirds (Uria aalge, U. lomvia), seal carcasses and marine invertebrates. Inland foxes rely more on ptarmigan in winter, and migrant birds, such as geese and waders, in summer (Hersteinsson and Macdonald 1996). In certain areas, foxes rely on colonies of Arctic geese, which can dominate their diet locally (Samelius and Lee 1998). Some populations switch between lemmings, migratory birds and marine resources depending on intra- and interannual variations in prey availability. The Arctic Fox depends also on remains of carrion left by larger predators, e.g. Polar Bear, Grey Wolf Canis lupus, and Wolverine Gulo gulo. It is itself a victim of predation, mainly from Red Fox, Wolverine, Golden Eagle, and humans.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Tundra, usually near shores. Ranges far out onto pack ice in winter. Commonly uses dumps in northern Alaska. When inactive, occupies underground den in bank or hillside; may tunnel into snowbank in winter. Breeding range in North America is mostly on the coastal plain and coastal regions of continental Canada and High Arctic islands. Young are born in underground dens. See Garrott et al. (1983) and Anthony (1996) for den site characteristics in northern and western Alaska, respectively.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

In Alaska, migrates seaward in fall and early winter, reverse movement in late winter and early spring. Long-distance movements of several hundred kilometers have been recorded (Underwood and Mosher 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The arctic fox is an opportunistic feeder, eating practically any animal, alive or dead. Although it prefers small mammals, it will eat insects, berries, carrion, and even the stool of animals or human beings. Generally, its winter diet consists of marine mammals, invertebrates, sea birds, fish, and seals. For populations living more inland and in the summer, the diet consists mostly of lemmings. During the summer months, when food is much more readily available, arctic foxes collect a surplus amount of food and carries it back to their dens, where it is stored under stones for later use.

Animal Foods: birds; mammals; fish; eggs; carrion ; insects

Plant Foods: fruit

Other Foods: dung

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Opportunistic. Eats lemmings, voles, ground squirrels, young hares, birds, bird eggs, berries, carrion (e.g., leftovers from polar bear kills), and garbage when available; sometimes may prey on ringed seal pups in their subnivean birth lairs. May cache food, including bird eggs, for later use.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Alopex lagopus preys on:
Lagopus
Plectrophenax nivalis
Calidris maritima
Rissa
Cepphus
Fratercula
Fulmarus glacialis
Alle alle
Somateria
Gavia stellata
Clangula hyemalis
Microtus
Anser anser
Chen caerulescens
Phoca largha

Based on studies in:
Norway: Spitsbergen (Coastal)
Russia (Tundra)

This list may not be complete but is based on published studies.
  • V. S. Summerhayes and C. S. Elton, Further contributions to the ecology of Spitzbergen, J. Ecol. 16:193-268, from p. 217 (1928).
  • V. S. Summerhayes and C. S. Elton, Contributions to the ecology of Spitsbergen and Bear Island, J. Ecol. 11:214-286, from p. 232 (1923).
  • T. Dunaeva and V. Kucheruk, Material on the ecology of the terrestrial vertebrates of the tundra of south Yamal, Bull. Soc. Nat. Moscou (N.S., Zool. Sect.) 4(19):1-80 (1941).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Relatively solitary, may congregate around carcass or dump. Home range much larger in winter than in summer. Based on a few radiotelemetry studies, adult home range is around 10-20 sq km. In Svalbard, mean home range of 3 breeding females was 48 sq km; home range estimates based on occupied dens were between 46 and 75 sq km; large size may have been due to relatively low food resources compared to other regions (Prestrud 1992). Populations vary, peak 1-2 years following peak in small mammal population. Populations in Fennoscandia may be limited by food availability via effects on reproduction (Angerbjorn et al. 1991). One den per 12-34 sq km in northern Alaska; density highest near development. One den per 24 sq km in Svalbard; for dens with litters, 1 den per 75 sq km (Prestrud 1992).

This is the most common predator of arctic birds (e.g., of black brant and lesser snow goose).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Activity cycles may peak at midnight or at midnight and noon (Underwood and Mosher 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
16.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16.3 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Arctic foxes are monogamous and usually mate for life.

Mating System: monogamous

Mating occurs from April to July, births take place from April through June for the first litter, and July or August for the second litter. The average gestation period is about 49-57 days. The number of young per litter varies with the availability of food, especially lemmings. The usual litter size is 5-8 cubs, although as many as 25 have been known. The young are weaned at about 2-4 weeks and emerge from the den. They reach sexual maturity in as little as ten months. The male parent stays with the cubs, helping to feed them. He mates with the female a few weeks after the first litter is born.

Range number of offspring: 1 to 5.

Average number of offspring: 2.8.

Range gestation period: 46 to 58 days.

Range weaning age: 28 to 60 days.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual

Average birth mass: 70 g.

Average number of offspring: 9.

Average age at sexual or reproductive maturity (male)

Sex: male:
304 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
304 days.

Parental Investment: altricial ; post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Monestrous, pair-bond may be lifelong. Usually breeds March- April. Gestation lasts 51-54 days. Litter size depends on food supply. Young are born April-June (appear above ground in June in northern Alaska), tended by both parents until mid-August. dispersal. Maximum recorded longevity was 6-7 years in northwestern Canada (Hiruki and Stirling 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vulpes lagopus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTCTCTACTAACCACAAAGATATTGGCACTTTATACTTGCTGTTTGGAGCATGGGCCGGTATAGTAGGCACCGCCCTAAGCCTTCTGATTCGAGCCGAATTAGGCCAACCTGGCACCTTGTTAGGAGAC---GATCAGATCTACAACGTAATCGTAACCGCACACGCCTTTGTAATAATCTTCTTTATAGTAATACCAATTATAATTGGAGGGTTCGGAAACTGATTAGTTCCCCTAATAATTGGTGCTCCTGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTTCTTCTACTATTAGCATCTTCCATAGTAGAAGCGGGCGCGGGAACAGGGTGAACCGTGTATCCACCACTAGCTGGCAACCTGGCTCACGCCGGAGCATCAGTAGATCTTACAATTTTCTCTCTTCACCTGGCCGGAGTCTCTTCAATTCTAGGGGCCATTAATTTTATTACTACTATTATTAATATAAAACCTCCTGCCATATCCCAATACCAAACCCCATTATTTGTATGATCAGTCCTAATTACAGCGGTTCTATTGCTATTATCGCTACCAGTACTAGCTGCTGGGATTACTATACTTCTAACGGATCGCAACCTTAACACAACATTTTTCGATCCTGCTGGAGGAGGGGATCCTATTTTATACCAACACTTGTTTTGATTCTTCGGACACCCCGAGGTCTATATTTTAATCTTGCCTGGGTTTGGTATAATCTCCCACATCGTCACTTACTATTCAGGGAAAAAAGAACCCTTTGGTTATATAGGAATGGTATGAGCAATAATGTCTATCGGGTTTTTAGGTTTTATCGTGTGAGCTCATCACATATTCACTGTAGGAATAGACGTGGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vulpes lagopus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The arctic fox has been driven out of some regions, such as northern Scandinavia, because of predators like the red fox. The arctic fox has been hunted by humans for its pelt, and also hunted in Iceland because of being a pest to sheep farmers. Humans also keep arctic foxes in captivity in fur farms. Nevertheless, populations have remained relatively stable.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Angerbjörn, A. & Tannerfeldt, M.

Reviewer/s
Hoffmann, M. & Sillero-Zubiri, C.

Contributor/s
Hersteinsson, P.

Justification
The Arctic Fox has a circumpolar distribution in all Arctic tundra habitats, with a global population in the order of several hundred thousand animals. Most populations fluctuate widely in numbers between years in response to varying lemming numbers, but in most areas population status is believed to be good and there is no reason to believe that the species currently qualifies for listing as threatened under any of the criteria.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The world population of Arctic Foxes is in the order of several hundred thousand animals. Most populations fluctuate widely in numbers between years in response to varying lemming numbers. In most areas, however, population status is believed to be good. The species is common in the tundra areas of Russia, Canada, coastal Alaska, Greenland and Iceland. Exceptions are Fennoscandia, islands in the Bering Sea (Mednyi Island, Russia; Pribilof Islands, Alaska, e.g., St Paul), where populations are at critically low levels and appear to be declining further. On some Aleutian Islands, Alaska, non-native Arctic Foxes are being eradicated in the course of bird conservation efforts (Walton et al. 2013). Vagrant Arctic Foxes are common over the northern sea-ice where can move several thousands of kilometres following Polar Bears Ursus maritimus as scavengers (Tarroux et al. 2010).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Hunting for fur has long been a major mortality factor for the Arctic Fox. With the decline of the fur hunting industry, the threat of over-exploitation is lowered for most Arctic Fox populations. They may also be subject to direct persecution (as on St. Paul Island). Misinformation as to the origin of Arctic Foxes on the Pribilofs continues to foster negative attitudes and the long-term persistence of this endemic subspecies is in jeopardy. In areas connected to marine ecosystems, Arctic Foxes may also be affected by indirect threats, such as diseases and the effects of persistent organic pollutants (Sonne et al. 2008); indeed, an emerging threat in Fennoscandia is the impact of sarcoptic mange on populations (Mörner 1992). In some areas, gene swamping by farm-bred blue foxes (see Conservation) may threaten native populations (Norén et al. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic Foxes face several types of threats resulting from global climate change. The most significant of these threats is probably the loss of the tundra habitat that the species inhabits. As warming temperatures allow new plant species from the south to colonize the region, large extents of tundra habitat are expected to slowly be replaced by boreal forest. Forest habitat is known to be highly unsuitable for Arctic Foxes (IUCN 2009).

Another threat to the Arctic Fox comes from Red Foxes, which compete with them for food and prey on Arctic Fox kits and adults. While the northern limits of the Red Fox’s range are determined by the productivity of the habitat, the southern limits of the Arctic Fox’s range are determined by the presence of the Red Fox. The encroachment of Red Foxes into more northern areas has already been documented and is likely to continue as the tundra warms (Fuglei and Ims 2008).

The changing climate also drives changes in prey abundance. Numbers of Arctic rodents, particularly lemmings, are known to fluctuate greatly, but historically such fluctuations have been fairly regular and cyclical. It is predicted, however, that climate change will lead to instability in the population sizes of these and other important prey species, such as voles. Lemmings and voles do not hibernate through the winter. Instead they continue to forage in the space between the frozen ground of the tundra and the snow, almost never appearing on the surface. This is possible because the snow provides good insulation from the severe Arctic winter conditions. Mild weather and wet snow lead to the collapse of these under-snow spaces, destroying the lemmings’ burrows, while ice crust formation reduces the insulating properties of the snow pack and may make food plants inaccessible. The combination of milder and shorter winters is predicted to decrease the regularity of lemming cycles, and population peaks in some populations have not occurred since the 1990s (IUCN 2009).

Any declines of important prey species are likely to have significant impacts on Arctic Fox populations. Declines of Arctic Fox numbers attributable to prey declines have already been observed in some Scandinavian populations. It is possible that although species such as lemmings may decrease in number, other potential prey species may begin to thrive in the new climate. Unfortunately for the Arctic Fox, the associated arrival of species such as the Red Fox would almost certainly cancel out any benefits from these changes (IUCN 2009). Arctic Foxes inhabiting coastal regions are likely to be less affected by declines of rodents than inland populations (Fuglei and Ims 2008). However, because Polar Bears and Ringed Seals are expected to decline due to climate change, coastal populations are likely to face reductions in alternative food sources such as Ringed Seal pups and the remains of Polar Bear prey (IUCN 2009).

Arctic Foxes are unable to persist in environments other than their native tundra habitat. This means that individuals living in southern parts of the species’ range will probably need to move north if they are to survive. Arctic Foxes, however, already occur in some of the most northerly parts of the world and their total available habitat is shrinking. This means that that the number of Arctic Foxes that can be supported worldwide is likely to decrease. Arctic Foxes living on Arctic islands may ultimately prove to be the safest of all populations. Such locations are generally at very high latitudes and will be among the last to face changes in tundra habitat and invasion by Red Foxes. Furthermore, the likely loss of the ice sheets currently connecting these islands to the continental landmasses will prevent access by Red Foxes (Fuglei and Ims 2008). However, island populations often tend to be more vulnerable to losses of genetic variation, which can cause health or reproductive problems.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is not included in the CITES Appendices.

In most of its range, the Arctic Fox is not protected. However, the species and its dens have had total legal protection in Sweden since 1928, in mainland Norway since 1930, and in Finland since 1940. In Europe, the Arctic Fox is a priority species under the Actions by the Community relating to the Environment (ACE). It is therefore to be given full protection. On St. Paul Island the declining Arctic Fox population currently has no legal protection (Walton et al. 2013). In Norway (Svalbard), Greenland, Canada, Russia, and Alaska, trapping is limited to licensed trappers operating in a defined trapping season. The enforcement of these laws appears to be uniformly good. In Iceland, bounty hunting takes place over most of the country outside nature reserves.

For occurrence in protected areas, good information is available only for Sweden and Finland. For Iceland, Arctic Foxes could potentially appear in most protected areas.

An action plan has been developed for Arctic Foxes in Sweden (Elmhagen 2008) and status reports have been published for Norway (Ulvund et al. 2013) and Finland (Kaikusalo et al. 2000). In Sweden, Norway and Finland, a conservation project led to significant increases in the population (Angerbjörn et al. 2013).

The Arctic Fox occurs widely in captivity on fur farms and has been bred for fur production for over 70 years. The present captive population originates from a number of wild populations and has been bred for characteristics different from those found in the wild, including large size. Escaped "blue" foxes may already be a problem in Fennoscandia (and to a lesser extent in Iceland) due to gene swamping (Norén et al. 2009). In Norway, foxes bred in captivity have successfully been released into the wild (Landa et al. 2014).

The following gaps still exist in knowledge of the Arctic Fox:

1) Little is known concerning the impact of diseases on fox populations, e.g. sarcoptic mange and Echinococcus multilocularis. Allied to this is our lack of knowledge of the epidemiology of Arctic rabies.

2) Considering the northward spread of the Red Fox in certain areas, studies are necessary to determine the effects of competition between Red Foxes and Arctic Foxes on various population parameters and Arctic Fox life-history patterns.

3) The non-recovery of the Fennoscandian population is a cause for concern, and requires specific attention, especially in terms of disease and genetics.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Requirements: Removal or management of arctic foxes at or near brant colonies may increase nest success and assist re-establishment or expansion of depleted brant colonies; the same undoubtedly is true for seabird colonies (Raveling 1989, Anthony et al. 1991, Bailey 1993, Birkhead and Nettleship 1995).

Introduced, sterile red foxes have been used to eliminate introduced arctic foxes from some islands (Bailey 1992, 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

In Iceland, arctic foxes sometimes take lambs from sheep flocks. Farmers have been encouraged since the late thirteenth century to shoot and/or kill these predators in order to protect their livestock.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The fur of the arctic fox is prized by the fur industry, and these foxes have been intensively trapped. On the Pribiloff Islands of Alaska, arctic foxes have been regularly farmed for their fur since 1865, and they have long been important to the economy of the native people living withing their range.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Commonly trapped for pelts (thousands each year in Alaska, tens of thousands per year in Canada) (Underwood and Mosher 1982); Sachs Harbour on Banks Island, Northwest Territories, is the most productive trapping area in Canada (Hiruki and Stirling 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Introduced and/or colonizing populations on islands often have devastating effects on seabird communities (Lensink 1984, Bailey 1993, Birkhead and Nettleship 1995). Arctic foxes can limit numbers and distribution of nesting brant (Raveling 1989) and are regarded as an impediment to restoration of Aleutian Canada goose populations (Bailey 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Arctic fox

For other uses, see Arctic fox (disambiguation).

The arctic fox (Vulpes lagopus), also known as the white fox, polar fox, or snow fox, is a small fox native to the Arctic regions of the Northern Hemisphere and common throughout the Arctic tundra biome.[1][3] It is well adapted to living in cold environments. It has a deep thick fur which is brown in summer and white in winter. Its body length ranges from 46 to 68 cm (18 to 27 in), with a generally rounded body shape to minimize the escape of body heat.

The arctic fox preys on any small creatures it can find, including lemmings, voles, ringed seal pups, fish, and seabirds. It will also eat carrion, berries, and seaweed. Arctic foxes form monogamous pairs during the breeding season and usually stay together in family groups of multiple generations in complex underground dens.

Adaptations[edit]

Arctic fox sleeping with its tail wrapped round it.

The arctic fox lives in some of the most frigid extremes on the planet but does not start to shiver until the temperature drops to −70 °C (−94 °F). Among its adaptations for survival in the cold is its dense, multi-layered, pelage which provides excellent insulation,[4][5] a system of countercurrent heat exchange in the circulation within the paws to retain core temperature, and a good supply of body fat. The fox has a low surface area to volume ratio, as evidenced by its generally compact body shape, short muzzle and legs, and short, thick ears. Since less of its surface area is exposed to the arctic cold, less heat escapes from the body. Its paws have fur on the soles for additional insulation and this helps it to walk on ice. The arctic fox has such keen hearing that it can determine exactly where a small animal is moving under the snow. When it has located its prey, it pounces and punches through the snow to catch its victim. Its fur changes color with the seasons: in most populations it is white in the winter to blend in with snow, while in the summer it is greyish-brown or darker brown. In some populations however it is a steely bluish-gray in the winter and a paler bluish-gray in summer.[4][6]

Reproduction[edit]

Arctic foxes do not hibernate and are active all year round. They build up their fat reserves in the autumn, sometimes increasing their body-weight by more than 50%. This provides greater insulation during the winter and a source of energy when food is scarce. They live in large dens in frost-free, slightly raised ground. These are complex systems of tunnels covering as much as 1,000 m2 (1,200 sq yd) and are often in eskers, long ridges of sedimentary material deposited in formerly glaciated regions. They have multiple entrances and may have been in existence for many decades and used by many generations of foxes.[7]

Arctic foxes tend to form monogamous pairs in the breeding season and maintain a territory around the den. Breeding usually takes place in April and May and the gestation period is about 52 days. Litters tend to average five to eight kits but exceptionally contain as many as twenty-five (the largest litter size in the order Carnivora).[8] Both the mother and father help to raise the young which emerge from the den when three to four weeks old and are weaned by nine weeks of age.[7]

Diet[edit]

Arctic foxes will generally eat any small animal they can find including lemmings, voles, other rodents, hares, birds, eggs and carrion. They scavenge on carcases left by larger predators such as wolves and polar bears and in times of scarcity even eat their feces. In areas where they are present, lemmings are their most common prey[7] and a family of foxes can eat dozens of lemmings each day. During April and May, the arctic fox also preys on ringed seal pups when the young animals are confined to a snow den and are relatively helpless. Fish beneath the ice are also part of the diet and they also consume berries and seaweed and may thus be considered omnivores.[9] This fox is a significant bird egg predator, excepting those of the largest tundra bird species.[10] If there is an overabundance of food, the arctic fox will bury the surplus as a reserve.

Size[edit]

The average head-and-body length of the male is 55 cm (22 in), with a range of 46 to 68 cm (18 to 27 in), while the female averages 52 cm (20 in) with a range of 41 to 55 cm (16 to 22 in).[11][4] The tail is about 30 cm (12 in) long in both sexes. The height at the shoulder is 25 to 30 cm (9.8 to 11.8 in).[12] On average males weigh 3.5 kg (7.7 lb), with a range of 3.2 to 9.4 kg (7.1 to 20.7 lb), while females average 2.9 kg (6.4 lb), with a range of 1.4 to 3.2 kg (3.1 to 7.1 lb).[4]

Taxonomy[edit]

Vulpes lagopus is a 'true fox' belonging to the genus Vulpes of the fox tribe Vulpini. It is classified under the subfamily Caninae of the canid family Canidae. Although it has previously been assigned to its own monotypic genus Alopex, recent genetic evidence now places it in the genus Vulpes along with the majority of other foxes.[3][13]










Arctic fox[14](Fig. 10)



Kit fox




Swift fox[15]





Corsac fox




Rüppell's fox



Red fox






Cape fox





Blanford's fox



Fennec fox





Raccoon dog





Bat-eared fox





It was originally described by Carl Linnaeus in the 10th edition of Systema Naturae in 1758 as Canis lagopus. The type specimen was recovered from Lapland, Sweden. The generic name vulpes is Latin for "fox".[16] The specific name lagopus is derived from Ancient Greek λαγως (lagos, "hare") and πους (pous, "foot"), referring to the hair on its feet similar to those found in cold-climate species of hares.[15]

Subspecies[edit]

Besides the nominate subspecies, Vulpes lagopus lagopus, there are four other subspecies of this fox:

  • Bering Islands arctic fox, Vulpes lagopus beringensis
  • Iceland Arctic fox, Vulpes lagopus fuliginosus
  • Pribilof Islands arctic fox, Vulpes lagopus pribilofensis
  • Greenland arctic fox, Vulpes lagopus foragorapusis
Arctic fox at Svalbard, Norway.
The arctic fox's seasonal furs, summer (top), "blue" (middle) and winter (bottom)

Distribution and habitat[edit]

The arctic fox has a circumpolar distribution and occurs in arctic tundra habitats in northern Europe, northern Asia and North America. Its range includes Greenland, Iceland, Fennoscandia, Svalbard, Jan Mayen and other islands in the Barents Sea, northern Russia, islands in the Bering Sea, Alaska and Canada as far south as Hudson Bay. In the late nineteenth century it was introduced into the Aleutian Islands south west of Alaska. It mostly inhabits tundra and pack ice but is also present in boreal forests in Canada and the Kenai Peninsula in Alaska. They are found at elevations of up to 3,000 m (9,800 ft) above sea level and has been seen on sea ice close to the North Pole.[17]

The arctic fox is the only land mammal native to Iceland.[18] It came to the isolated North Atlantic island at the end of the last ice age, walking over the frozen sea. The Arctic Fox Center in Súðavík contains an exhibition on the arctic fox and conducts studies on the influence of tourism on the population.[19] Its range during the last ice age was much more extensive than it is now, and fossil remains of the arctic fox have been found over much of northern Europe and Siberia.[1]

Conservation status[edit]

Arctic fox skull

The conservation status of the species is in general good and there are estimated to be several thousand individuals in total. The International Union for Conservation of Nature has assessed it as being of "least concern".[1] However the Scandinavian mainland population is acutely endangered, despite being legally protected from hunting and persecution for several decades. The estimate of the adult population in all of Norway, Sweden and Finland is fewer than 200 individuals.[7]

The abundance of the arctic fox tends to fluctuate in a cycle along with the population of lemmings and voles (a 3-to-4-year cycle).[10] The populations are especially vulnerable during the years when the prey population crashes, and uncontrolled trapping has almost eradicated two subpopulations.[7]

The pelts of arctic foxes with a slate blue coloration—an expression of a recessive gene—were especially valuable. They were transported to various previously fox-free Aleutian Islands during the 1920s. The program was successful in terms of increasing the population of blue foxes, but their predation of Aleutian Canadian geese conflicted with the goal of preserving that species.[20]

The arctic fox is losing ground to the larger red fox. This has been attributed to climate change—the camouflage value of its lighter coat decreases with less snow cover.[21] Red foxes dominate where their ranges begin to overlap by killing arctic foxes and their kits.[22] An alternate explanation of the red fox's gains involves the gray wolf: Historically, it has kept red fox numbers down, but as the wolf has been hunted to near extinction in much of its former range, the red fox population has grown larger, and it has taken over the niche of top predator.[citation needed] In areas of northern Europe, there are programs in place that allow the hunting of red foxes in the arctic fox's previous range.

As with many other game species, the best sources of historical and large scale population data are hunting bag records and questionnaires. There are several potential sources of error in such data collections.[23] In addition, numbers vary widely between years due to the large population fluctuations. However, the total population of the arctic fox must be in the order of several hundred thousand animals.[24]

The world population is thus not endangered, but two arctic fox subpopulations are. One is on Medny Island (Commander Islands, Russia), which was reduced by some 85–90%, to around 90 animals, as a result of mange caused by an ear tick introduced by dogs in the 1970s.[25] The population is currently under treatment with antiparasitic drugs, but the result is still uncertain.

The other threatened population is the one in Fennoscandia (Norway, Sweden, Finland and Kola Peninsula). This population decreased drastically around the start of the 20th century as a result of extreme fur prices, which caused severe hunting also during population lows.[26] The population has remained at a low density for more than 90 years, with additional reductions during the last decade.[27] The total population estimate for 1997 is around 60 adults in Sweden, 11 adults in Finland and 50 in Norway. From Kola, there are indications of a similar situation, suggesting a population of around 20 adults. The Fennoscandian population thus numbers around 140 breeding adults. Even after local lemming peaks, the arctic fox population tends to collapse back to levels dangerously close to non-viability.[24]

The arctic fox is classed as a "prohibited new organism" under New Zealand's Hazardous Substances and New Organisms Act 1996 preventing it from being imported into the country.[28]

See also[edit]

References[edit]

  1. ^ a b c d Angerbjörn, A.; Hersteinsson, P.; Tannerfeldt, M. (2008). Alopex lagopus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 6 October 2014.
  2. ^ Linnæus, Carl (1758). Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (in Latin) (10 ed.). Holmiæ (Stockholm): Laurentius Salvius. p. 40. Retrieved 23 November 2012. 
  3. ^ a b Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 532–628. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  4. ^ a b c d Alopex lagopus at the Smithsonian
  5. ^ Claudio Sillero-Zubiri, Michael Hoffmann and David W. Macdonald (eds.) (2004). Canids: Foxes, Wolves, Jackals and Dogs. IUCN/SSC Canid Specialist Group.
  6. ^ Arctic Fox Alopex lagopus. Department of Environment and Conservation, Government of Newfoundland and Labrador
  7. ^ a b c d e Angerbjörn, A.; Berteaux, D.; Ims, R. (12 November 2012). "Arctic fox (Vulpes lagopus)". Arctic report card: Update for 2012. NOAA Arctic Research Program. Retrieved 6 October 2014. 
  8. ^ MacDonald, David W. (2004). Biology and Conservation of Wild Canids. Oxford University Press. ISBN 0-19-851556-1. 
  9. ^ Bockstoce, John R. (2009). Furs and frontiers in the far north: the contest among native and foreign nations for the Bering Strait fur trade. Yale University Press. p. 41. ISBN 978-0-300-14921-0. 
  10. ^ a b Truett, Joe Clyde and Johnson, Stephen R. (2000). The natural history of an Arctic oil field: development and the biota. Academic Press. pp. 160–163. ISBN 978-0-12-701235-3. 
  11. ^ "Arctic fox: Alopex lagopus". National Geographic. Retrieved 6 October 2014. 
  12. ^ Boitani, Luigi (1984). Simon & Schuster's Guide to Mammals. Simon & Schuster/Touchstone Books, ISBN 978-0-671-42805-1
  13. ^ Bininda-Emonds, ORP; JL Gittleman; A Purvis (1999). "Building large trees by combining phylogenetic information: a complete phylogeny of the extant Carnivora (Mammalia)". Biol. Rev. 74 (2): 143–175. doi:10.1017/S0006323199005307. PMID 10396181. Retrieved 30 July 2008. 
  14. ^ Lindblad-Toh; Wade, CM; Mikkelsen, TS; Karlsson, EK; Jaffe, DB; Kamal, M; Clamp, M; Chang, JL; Kulbokas, EJ, III et al. et al. (2005). "Genome sequence, comparative analysis and haplotype structure of the domestic dog". Nature 438 (7069): 803–819. doi:10.1038/nature04338. PMID 16341006.  |first11= missing |last11= in Authors list (help); |first12= missing |last12= in Authors list (help); |first13= missing |last13= in Authors list (help); |first14= missing |last14= in Authors list (help); |first15= missing |last15= in Authors list (help); |first16= missing |last16= in Authors list (help); |first17= missing |last17= in Authors list (help); |first18= missing |last18= in Authors list (help); |first19= missing |last19= in Authors list (help); |first20= missing |last20= in Authors list (help); |first21= missing |last21= in Authors list (help); |first22= missing |last22= in Authors list (help); |first23= missing |last23= in Authors list (help); |first24= missing |last24= in Authors list (help); |first25= missing |last25= in Authors list (help); |first26= missing |last26= in Authors list (help); |first27= missing |last27= in Authors list (help); |first28= missing |last28= in Authors list (help); |first29= missing |last29= in Authors list (help); |first30= missing |last30= in Authors list (help)
  15. ^ a b Audet, Alexander M.; Robbins, C. Brian and Larivière, Serge (2002). "Alopex lagopus". Mammalian Species 713 (713): 1–10. doi:10.1644/1545-1410(2002)713<0001:AL>2.0.CO;2. 
  16. ^ Larivière, Serge (2002). "Vulpes zerda". Mammalian Species 714 (714): 1–5. doi:10.1644/1545-1410(2002)714<0001:VZ>2.0.CO;2. 
  17. ^ George A. Feldhamer; Bruce C. Thompson; Joseph A. Chapman (2003). Wild Mammals of North America: Biology, Management, and Conservation. JHU Press. pp. 511–540. ISBN 978-0-8018-7416-1. 
  18. ^ "Wildlife". Iceland Worldwide. iww.is. 2000. Archived from the original on 14 April 2010. Retrieved 22 April 2010. 
  19. ^ "The Arctic Fox Center". Retrieved 19 May 2011. 
  20. ^ Bolen, Eric G. (1998). Ecology of North America. John Wiley and Sons. p. 42. ISBN 978-0-471-13156-4. 
  21. ^ Hannah, Lee (2010). Climate Change Biology. Academic Press. p. 63. ISBN 978-0-12-374182-0. 
  22. ^ Macdonald, David Whyte and Sillero-Zubiri, Claudio (2004). The biology and conservation of wild canids. Oxford University Press. p. 10. ISBN 978-0-19-851556-2. 
  23. ^ Garrott, R. A. and Eberhardt, L. E. (1987). "Arctic fox". In Novak, M. et al. (eds.). Wild furbearer management and conservation in North America. pp. 395–406. ISBN 0774393653. 
  24. ^ a b Tannerfeldt, M. (1997). Population fluctuations and life history consequences in the Arctic fox. Stockholm, Sweden: Dissertation, Stockholm University. 
  25. ^ Goltsman, M.; Kruchenkova, E. P.; MacDonald, D. W. (1996). "The Mednyi Arctic foxes: treating a population imperilled by disease". Oryx 30 (4): 251–258. doi:10.1017/S0030605300021748. 
  26. ^ Lönnberg, E. (1927). Fjällrävsstammen i Sverige 1926. Uppsala, Sweden: Royal Swedish Academy of Sciences. 
  27. ^ Angerbjörn, A. (1995). "Dynamics of the Arctic fox population in Sweden". Annales Zoologici Fennici 32: 55–68.  More than one of |authors= and |author= specified (help)
  28. ^ "Hazardous Substances and New Organisms Act 2003 – Schedule 2 Prohibited new organisms". New Zealand Government. Retrieved 26 January 2012. 

Further reading[edit]

  • Nowak, Ronald M. (2005). Walker's Carnivores of the World. Baltimore: Johns Hopkins Press. ISBN 0-8018-8032-7
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species formerly was included in the genus Alopex. Data from chromosomes, mtDNA, and allozymes all indicate a close relationship among arctic fox, kit fox, and swift fox and do not support the recognition of the arctic fox in a genus separate from the kit and swift foxes (genus Vulpes) (Geffen et al. 1992, Mercure et al. 1993). The mammal lists by Baker et al. (2003) and Wozencraft (in Wilson and Reeder 2005) used the name Vulpes lagopus for the arctic fox.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!