Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"An animal that does not begin to shiver until temperatures reach -70 C, the arctic fox is one of the most superbly cold-adapted mammals. Its dense, multi-layered coat, which is several inches thick during winter, provides excellent heat insulation. Short ears, a short muzzle, and short limbs reduce heat loss by minimizing the amount of body surface area exposed to the cold. Even the pads on the soles of the feet are covered with fur to insulate them. Arctic foxes change color seasonally. Most populations are grayish-brown in summer and white in the winter. Others are dark brown or blush-gray in summer and ""blue,"" a steely blue-gray, in the winter. Like other foxes, arctic foxes tend to be solitary and mostly nocturnal. They hunt for lemmings, voles, birds, and other prey in the summer, but scavenge for carrion during the harsh winter, sometimes following polar bears or wolves to feed on the remains of caribou or seals the larger predators have killed."

Links:
Mammal Species of the World
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:40, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Arctic Fox has a circumpolar distribution in all Arctic tundra habitats. It breeds north of and above the tree line on the Arctic tundra in North America and Eurasia and on the alpine tundra in Fennoscandia, ranging from northern Greenland at 88°N to the southern tip of Hudson Bay, Canada, 53°N. The southern edge of the species' distribution range may have moved somewhat north during the 20th century resulting in a smaller total range (Hersteinsson and Macdonald 1992). The species inhabits most Arctic islands but only some islands in the Bering Strait. The Arctic Fox was also introduced to previously isolated islands in the Aleutian chain at the end of the 19th century by fur industry (Bailey 1992). It has also been observed on the sea ice up to the North Pole.

During the last glaciation, the Arctic Fox had a distribution along the ice edge, and Arctic Fox remains have been found in a number of Pleistocene deposits over most of Europe and large parts of Siberia (Chesemore 1975).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Arctic foxes are found in the treeless tundra extending through the arctic regions of Eurasia, North America, Greenland, and Iceland.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Angerbjörn, A., P. Hersteinsson, T. Tannerfeldt. 2005. "Arctic fox (Vulpes lagopus)" (On-line). IUCN Canid Specialist Group. Accessed September 27, 2007 at http://www.canids.org/species/Alopex_lagopus.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Circumarctic. In North America: northern and western Alaska and northern Canada south to northern Northwest Territories, northeastern Alberta, northern Manitoba, and northern Quebec; sometimes farther south.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Average mass: 5200 g.

Average basal metabolic rate: 7.665 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 91 cm

Weight: 4000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are 10%-20% larger than females.

Length:
Average: 853 mm males; 821 mm females
Range: 830-1,100 mm males; 713-850 mm females

Weight:
Average: 3.5 kg males; 2.9 kg females
Range: 3.2-9.4 kg males; 1.4-3.2 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Arctic and alpine tundra on the continents of Eurasia, North America and the Canadian archipelago, Siberian islands, Greenland, inland Iceland and Svalbard. Subarctic maritime habitat in the Aleutian island chain, Bering Sea Islands, Commander Islands and coastal Iceland.

The Arctic Fox is an opportunistic predator and scavenger but in most inland areas, the species is heavily dependent on fluctuating rodent populations. The species' main prey items include lemmings, both Lemmus spp. and Dicrostonyx spp. (Macpherson 1969; Angerbjörn et al. 1999). In Fennoscandia, Lemmus lemmus was the main prey in summer (85% frequency of occurrence in faeces) followed by birds (Passeriformes, Galliformes and Caridriiformes, 34%) and reindeer (Rangifer tarandus) (21%; Elmhagen et al. 2000). In winter, ptarmigan and grouse (Lagopus spp.) are common prey in addition to rodents and reindeer (Kaikusalo and Angerbjörn 1995). Changes in fox populations have been observed to follow those of their main prey in three- to five-year cycles (Macpherson 1969; Angerbjörn et al. 1999).

Foxes living near ice-free coasts have access to both inland prey and sea birds, seal carcasses, fish and invertebrates connected to the marine environment, leading to relatively stable food availability and a more generalist strategy (Hersteinsson and Macdonald 1996). In late winter and summer, foxes found in coastal Iceland feed on seabirds (Uria aalge, U. lomvia), seal carcasses and marine invertebrates. Inland foxes rely more on ptarmigan in winter, and migrant birds, such as geese and waders, in summer (Hersteinsson and Macdonald 1996). In certain areas, foxes rely on colonies of Arctic geese, which can dominate their diet locally (Samelius and Lee 1998).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Arctic foxes are found mainly in arctic and alpine tundra, usually in coastal areas.

Habitat Regions: polar ; terrestrial

Terrestrial Biomes: tundra ; icecap

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Tundra, usually near shores. Ranges far out onto pack ice in winter. Commonly uses dumps in northern Alaska. When inactive, occupies underground den in bank or hillside; may tunnel into snowbank in winter. Breeding range in North America is mostly on the coastal plain and coastal regions of continental Canada and High Arctic islands. Young are born in underground dens. See Garrott et al. (1983) and Anthony (1996) for den site characteristics in northern and western Alaska, respectively.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

In Alaska, migrates seaward in fall and early winter, reverse movement in late winter and early spring. Long-distance movements of several hundred kilometers have been recorded (Underwood and Mosher 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The arctic fox is an opportunistic feeder, eating practically any animal, alive or dead. Although it prefers small mammals, it will eat insects, berries, carrion, and even the stool of animals or human beings. Generally, its winter diet consists of marine mammals, invertebrates, sea birds, fish, and seals. For populations living more inland and in the summer, the diet consists mostly of lemmings. During the summer months, when food is much more readily available, arctic foxes collect a surplus amount of food and carries it back to their dens, where it is stored under stones for later use.

Animal Foods: birds; mammals; fish; eggs; carrion ; insects

Plant Foods: fruit

Other Foods: dung

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic. Eats lemmings, voles, ground squirrels, young hares, birds, bird eggs, berries, carrion (e.g., leftovers from polar bear kills), and garbage when available; sometimes may prey on ringed seal pups in their subnivean birth lairs. May cache food, including bird eggs, for later use.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Alopex lagopus preys on:
Lagopus
Plectrophenax nivalis
Calidris maritima
Rissa
Cepphus
Fratercula
Fulmarus glacialis
Alle alle
Somateria
Gavia stellata
Clangula hyemalis
Microtus
Anser anser
Chen caerulescens
Phoca largha

Based on studies in:
Norway: Spitsbergen (Coastal)
Russia (Tundra)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Relatively solitary, may congregate around carcass or dump. Home range much larger in winter than in summer. Based on a few radiotelemetry studies, adult home range is around 10-20 sq km. In Svalbard, mean home range of 3 breeding females was 48 sq km; home range estimates based on occupied dens were between 46 and 75 sq km; large size may have been due to relatively low food resources compared to other regions (Prestrud 1992). Populations vary, peak 1-2 years following peak in small mammal population. Populations in Fennoscandia may be limited by food availability via effects on reproduction (Angerbjorn et al. 1991). One den per 12-34 sq km in northern Alaska; density highest near development. One den per 24 sq km in Svalbard; for dens with litters, 1 den per 75 sq km (Prestrud 1992).

This is the most common predator of arctic birds (e.g., of black brant and lesser snow goose).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Activity cycles may peak at midnight or at midnight and noon (Underwood and Mosher 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
16.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16.3 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Arctic foxes are monogamous and usually mate for life.

Mating System: monogamous

Mating occurs from April to July, births take place from April through June for the first litter, and July or August for the second litter. The average gestation period is about 49-57 days. The number of young per litter varies with the availability of food, especially lemmings. The usual litter size is 5-8 cubs, although as many as 25 have been known. The young are weaned at about 2-4 weeks and emerge from the den. They reach sexual maturity in as little as ten months. The male parent stays with the cubs, helping to feed them. He mates with the female a few weeks after the first litter is born.

Range number of offspring: 1 to 5.

Average number of offspring: 2.8.

Range gestation period: 46 to 58 days.

Range weaning age: 28 to 60 days.

Average birth mass: 70 g.

Average number of offspring: 9.

Average age at sexual or reproductive maturity (male)

Sex: male:
304 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
304 days.

Parental Investment: altricial ; post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Monestrous, pair-bond may be lifelong. Usually breeds March- April. Gestation lasts 51-54 days. Litter size depends on food supply. Young are born April-June (appear above ground in June in northern Alaska), tended by both parents until mid-August. dispersal. Maximum recorded longevity was 6-7 years in northwestern Canada (Hiruki and Stirling 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vulpes lagopus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0289-06|AY598508|Vulpes lagopus| AATCGATGATTATTCTCTACTAACCACAAAGATATTGGCACTTTATACTTGCTGTTTGGAGCATGGGCCGGTATAGTAGGCACCGCCCTA---AGCCTTCTGATTCGAGCCGAATTAGGCCAACCTGGCACCTTGTTAGGAGAC---GATCAGATCTACAACGTAATCGTAACCGCACACGCCTTTGTAATAATCTTCTTTATAGTAATACCAATTATAATTGGAGGGTTCGGAAACTGATTAGTTCCCCTAATA---ATTGGTGCTCCTGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTTCTTCTACTATTAGCATCTTCCATAGTAGAAGCGGGCGCGGGAACAGGGTGAACCGTGTATCCACCACTAGCTGGCAACCTGGCTCACGCCGGAGCATCAGTAGATCTT---ACAATTTTCTCTCTTCACCTGGCCGGAGTCTCTTCAATTCTAGGGGCCATTAATTTTATTACTACTATTATTAATATAAAACCTCCTGCCATATCCCAATACCAAACCCCATTATTTGTATGATCAGTCCTAATTACAGCGGTTCTATTGCTATTATCGCTACCAGTACTAGCTGCT---GGGATTACTATACTTCTAACGGATCGCAACCTTAACACAACATTTTTCGATCCTGCTGGAGGAGGGGATCCTATTTTATACCAACACTTGTTTTGATTCTTCGGACACCCCGAGGTCTATATTTTAATCTTGCCTGGGTTTGGTATAATCTCCCACATCGTCACTTACTATTCAGGGAAAAAA---GAACCCTTTGGTTATATAGGAATGGTATGAGCAATAATGTCTATCGGGTTTTTAGGTTTTATCGTGTGAGCTCATCACATATTCACTGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Vulpes lagopus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Angerbjörn, A., Hersteinsson , P. & Tannerfeldt, M.

Reviewer/s
Sillero-Zubiri, C. & Hoffmann, M. (Canid Red List Authority)

Contributor/s

Justification
The Arctic Fox has a circumpolar distribution in all Arctic tundra habitats, with a global population in the order of several hundred thousand animals. Most populations fluctuate widely in numbers between years in response to varying lemming numbers. In most areas population status is believed to be good.

History
  • 2004
    Least Concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The arctic fox has been driven out of some regions, such as northern Scandinavia, because of predators like the red fox. The arctic fox has been hunted by humans for its pelt, and also hunted in Iceland because of being a pest to sheep farmers. Humans also keep arctic foxes in captivity in fur farms. Nevertheless, populations have remained relatively stable.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The world population of Arctic Foxes is in the order of several hundred thousand animals. Most populations fluctuate widely in numbers between years in response to varying lemming numbers. Only a few populations have been studied directly. In most areas, however, population status is believed to be good. The species is common in the tundra areas of Russia, Canada, coastal Alaska, Greenland and Iceland. Exceptions are Fennoscandia, Mednyi Island (Russia) and Pribilof Islands, where populations are at critically low levels. On the Pribilof Islands, fox populations are now low and appear to be declining further. Vagrant Arctic Foxes are common over the northern sea-ice where they follow polar bears as scavengers.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Hunting for fur has long been a major mortality factor for the Arctic Fox. With the decline of the fur hunting industry, the threat of over-exploitation is lowered for most Arctic Fox populations. In some areas gene swamping by farm-bred blue foxes may threaten native populations. There can also be indirect threats such as diseases and organochlorine contaminants, or direct persecution (as on St. Paul Island for example). Misinformation as to the origin of Arctic Foxes on the Pribilofs continues to foster negative attitudes and the long-term persistence of this endemic subspecies is in jeopardy.

The Arctic Fox remains the single most important terrestrial game species in the Arctic. Indigenous peoples have always utilized its exceptional fur; and with the advent of the fur industry, the Arctic Fox quickly became an important source of income. Today, leg-hold traps and shooting are the main hunting methods. Because of their large reproductive capacity, Arctic foxes can maintain population levels under high hunting pressure. In some areas, up to 50% of the total population has been harvested on a sustainable basis (Nasimovic and Isakov 1985). However, this does not allow for hunting during population lows, as shown by the situation in Fennoscandia. The Arctic Fox has nevertheless survived high fur prices better than most other Arctic mammals. Hunting has declined considerably in the last decades, as a result of low fur prices and alternative sources of income. In the Yukon, for example, the total value of all fur production decreased from $1.3 million in 1988 to less than $300,000 in 1994.

The Arctic Fox occurs widely in captivity on fur farms and has been bred for fur production for over 70 years. The present captive population originates from a number of wild populations and has been bred for characteristics different from those found in the wild, including large size. Escaped "blue" foxes may already be a problem in Fennoscandia (and to a lesser extent in Iceland) due to gene swamping (Hersteinsson et al. 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Arctic Foxes face several types of threats resulting from global climate change. The most significant of these threats is probably the loss of the tundra habitat that the species inhabits. As warming temperatures allow new plant species from the south to colonize the region, large extents of tundra habitat are expected to slowly be replaced by boreal forest. Forest habitat is known to be highly unsuitable for Arctic Foxes (IUCN 2009).

Another threat to the Arctic Fox comes from Red Foxes, which compete with them for food and prey on Arctic Fox kits and adults. While the northern limits of the Red Fox’s range are determined by the productivity of the habitat, the southern limits of the Arctic Fox’s range are determined by the presence of the Red Fox. The encroachment of Red Foxes into more northern areas has already been documented and is likely to continue as the tundra warms (Fuglei and Ims 2008).

The changing climate also drives changes in prey abundance. Numbers of Arctic rodents, particularly lemmings, are known to fluctuate greatly, but historically such fluctuations have been fairly regular and cyclical. It is predicted, however, that climate change will lead to instability in the population sizes of these and other important prey species, such as voles. Lemmings and voles do not hibernate through the winter. Instead they continue to forage in the space between the frozen ground of the tundra and the snow, almost never appearing on the surface. This is possible because the snow provides good insulation from the severe Arctic winter conditions. Mild weather and wet snow lead to the collapse of these under-snow spaces, destroying the lemmings’ burrows, while ice crust formation reduces the insulating properties of the snow pack and may make food plants inaccessible. The combination of milder and shorter winters is predicted to decrease the regularity of lemming cycles, and population peaks in some populations have not occurred since the 1990s (IUCN 2009).

Any declines of important prey species are likely to have significant impacts on Arctic Fox populations. Declines of Arctic Fox numbers attributable to prey declines have already been observed in some Scandinavian populations. It is possible that although species such as lemmings may decrease in number, other potential prey species may begin to thrive in the new climate. Unfortunately for the Arctic Fox, the associated arrival of species such as the Red Fox would almost certainly cancel out any benefits from these changes (IUCN 2009). Arctic Foxes inhabiting coastal regions are likely to be less affected by declines of rodents than inland populations (Fuglei and Ims 2008). However, because Polar Bears and Ringed Seals are expected to decline due to climate change, coastal populations are likely to face reductions in alternative food sources such as Ringed Seal pups and the remains of Polar Bear prey (IUCN 2009).

Arctic Foxes are unable to persist in environments other than their native tundra habitat. This means that individuals living in southern parts of the species’ range will probably need to move north if they are to survive. Arctic Foxes, however, already occur in some of the most northerly parts of the world and their total available habitat is shrinking. This means that that the number of Arctic Foxes that can be supported worldwide is likely to decrease. Arctic Foxes living on Arctic islands may ultimately prove to be the safest of all populations. Such locations are generally at very high latitudes and will be among the last to face changes in tundra habitat and invasion by Red Foxes. Furthermore, the likely loss of the ice sheets currently connecting these islands to the continental landmasses will prevent access by Red Foxes (Fuglei and Ims 2008). However, island populations often tend to be more vulnerable to losses of genetic variation, which can cause health or reproductive problems.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is not included in the CITES Appendices.

In most of its range, the Arctic Fox is not protected. However, the species and its dens have had total legal protection in Sweden since 1928, in Norway since 1930, and in Finland since 1940. In Europe, the Arctic Fox is a priority species under the Actions by the Community relating to the Environment (ACE). It is therefore to be given full protection. On St. Paul Island the declining Arctic Fox population has currently no legal protection. In Norway (Svalbard), Greenland, Canada, Russia, and Alaska, trapping is limited to licensed trappers operating in a defined trapping season. The enforcement of these laws appears to be uniformly good. In Iceland, bounty hunting takes place over most of the country outside nature reserves.

For occurrence in protected areas, good information is available only for Sweden and Finland. For Iceland, Arctic Foxes could potentially appear in most protected areas.

An action plan has been developed for Arctic Foxes in Sweden (Löfgren and Angerbjörn 1998) and status reports have been published for Norway (Frafjord and Rofstad 1998) and Finland (Kaikusalo et al. 2000). In Sweden and Finland, a conservation project is under way (SEFALO). In 1993, Mednyi Island gained protected status as a Nature Reserve.

The Arctic Fox occurs widely in captivity on fur farms and has been bred for fur production for over 70 years. The present captive population originates from a number of wild populations and has been bred for characteristics different from those found in the wild, including large size. Escaped "blue" foxes may already be a problem in Fennoscandia (and to a lesser extent in Iceland) due to gene swamping (Hersteinsson et al. 1989).

The following gaps still exist in knowledge of the Arctic Fox:

1) Little is known concerning the impact of diseases introduced by humans on fox populations. Allied to this is our lack of knowledge of the epidemiology of Arctic rabies.

2) Considering the northward spread of the red fox in certain areas, studies are necessary to determine the effects of competition between red foxes and Arctic foxes on various population parameters and Arctic fox life-history patterns.

3) The non-recovery of the Fennoscandian population is a cause for concern, and requires specific attention, especially in terms of disease and genetics.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Removal or management of arctic foxes at or near brant colonies may increase nest success and assist re-establishment or expansion of depleted brant colonies; the same undoubtedly is true for seabird colonies (Raveling 1989, Anthony et al. 1991, Bailey 1993, Birkhead and Nettleship 1995).

Introduced, sterile red foxes have been used to eliminate introduced arctic foxes from some islands (Bailey 1992, 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In Iceland, arctic foxes sometimes take lambs from sheep flocks. Farmers have been encouraged since the late thirteenth century to shoot and/or kill these predators in order to protect their livestock.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The fur of the arctic fox is prized by the fur industry, and these foxes have been intensively trapped. On the Pribiloff Islands of Alaska, arctic foxes have been regularly farmed for their fur since 1865, and they have long been important to the economy of the native people living withing their range.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Commonly trapped for pelts (thousands each year in Alaska, tens of thousands per year in Canada) (Underwood and Mosher 1982); Sachs Harbour on Banks Island, Northwest Territories, is the most productive trapping area in Canada (Hiruki and Stirling 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: Introduced and/or colonizing populations on islands often have devastating effects on seabird communities (Lensink 1984, Bailey 1993, Birkhead and Nettleship 1995). Arctic foxes can limit numbers and distribution of nesting brant (Raveling 1989) and are regarded as an impediment to restoration of Aleutian Canada goose populations (Bailey 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Arctic fox

The arctic fox (Vulpes lagopus,[2] formerly known as Alopex lagopus), also known as the white fox, polar fox or snow fox, is a small fox native to Arctic regions of the Northern Hemisphere and is common throughout the Arctic tundra biome. The Greek word alopex, (ἀλώπηξ) means a fox and Vulpes is the Latin version. Lagopus is derived from Ancient Greek lago (λαγως), meaning "hare", + pous (πους), "foot" and refers to the hair on its feet.[3][4] Although it has previously been assigned to its own genus Alopex, genetic evidence places it in Vulpes (Mammal Species of the World) with the majority of the other foxes.[1][5]

Contents

Adaptations

Vulpes lagopus (arctic fox) sleeping with its tail wrapped as a blanket.

The arctic fox lives in some of the most frigid extremes on the planet. Among its adaptations for cold survival are its deep, thick fur,[6] a system of countercurrent heat exchange in the circulation of paws to retain core temperature, and a good supply of body fat. The fox has a low surface area to volume ratio, as evidenced by its generally rounded body shape, short muzzle and legs, and short, thick ears. Since less of its surface area is exposed to the arctic cold, less heat escapes the body. Its furry paws allow it to walk on ice in search of food. The arctic fox has such keen hearing that it can precisely locate the position of prey under the snow. When it finds prey, it pounces and punches through the snow to catch its victim. Its fur changes colour with the seasons: in the winter it is white to blend in with snow, while in the summer it is brown.[7]

Reproduction

The arctic fox tends to be active from early September to early May. The gestation period is 52 days. Litters tend to average 5-8 kits but may be as many as 25[8](the largest in the order Carnivora[9] ) Both the mother and the father help to raise their young. The females leave the family and form their own groups and the males stay with the family.

Foxes tend to form monogamous pairs in the breeding season. Litters are born in the early summer and the parents raise the young in a large den. Dens can be complex underground networks, housing many generations of foxes. Young from a previous year's litter may stay with the parents to help rear younger siblings.[8] The kits are initially brownish; as they become older they turn white. Their coat of fur also changes color when summer arrives, but in winter it is white.

Diet

The arctic fox will generally eat any small animal it can find: lemmings, voles, hares, owls, eggs, and carrion, etc. Lemmings are the most common prey. A family of foxes can eat dozens of lemmings each day. During April and May the arctic fox also preys on ringed seal pups when the young animals are confined to a snow den and are relatively helpless. Fish beneath the ice are also part of its diet. They also consume berries and seaweed and may thus be considered omnivores.[10] It is a significant bird egg predator, excepting those of the largest tundra bird species.[11] If there is an overabundance of food hunted, the arctic fox will bury what the family cannot eat. When its normal prey is scarce, the arctic fox scavenges the leftovers and even feces of larger predators, such as the polar bear, even though the bear's prey includes the arctic fox itself.

Size

The average length is 85.3 cm (33.6 in), with a range of 80 to 110 cm (31 to 43 in), in the male and 82.1 cm (32.3 in), with a range of 71.3 to 85 cm (28.1 to 33 in), in the female.[12] The tail is 31 cm (12.2 in) long in the male and 30 cm (11.8 in) long in the female. It is 25–30 cm (9.8–11.8 in) high at the shoulder.[13] On average males weigh 3.5 kg (7.7 lb), with a range of 3.2 to 9.4 kg (7.1 to 21 lb), while females average 2.9 kg (6.4 lb), with a range of 1.4 to 3.2 kg (3.1 to 7.1 lb).[12]

Subspecies

Besides the nominate, Vulpes lagopus lagopus, there are four subspecies of this fox:

Arctic fox at Svalbard, Norway.
The arctic fox's seasonal furs, summer (top), "blue" (middle) and winter (bottom)

Population and distribution

Arctic fox skull

The arctic fox has a circumpolar range, meaning that it is found throughout the entire Arctic, including the outer edges of Greenland, Russia, Canada, Alaska, and Svalbard, as well as in Subarctic and alpine areas, such as Iceland and mainland alpine Scandinavia. The conservation status of the species is good, except for the Scandinavian mainland population. It is acutely endangered there, despite decades of legal protection from hunting and persecution. The total population estimate in all of Norway, Sweden and Finland is a mere 120 adult individuals.

The arctic fox is the only native land mammal to Iceland.[14] It came to the isolated North Atlantic island at the end of the last ice age, walking over the frozen sea. The Arctic Fox Center in Súðavík contains an exhibition on the arctic fox and conducts studies on the influence of tourism on the population.[15]

The abundance of the arctic fox species tends to fluctuate in a cycle along with the population of lemmings and voles (a 3-to-4-year cycle).[11] Because the fox reproduces very quickly and often dies young, population levels are not seriously affected by trapping. The arctic fox has, nonetheless, been eradicated from many areas where humans are settled.

The pelts of arctic foxes with a slate blue coloration—an expression of a recessive gene—were especially valuable. They were transported to various previously fox-free Aleutian Islands during the 1920s. The program was successful in terms of increasing the population of blue foxes, but their predation of Aleutian Canadian geese conflicted with the goal of preserving that species.[16]

The arctic fox is losing ground to the larger red fox. This has been attributed to climate change—the camouflage value of its lighter coat decreases with less snow cover.[17] Red foxes dominate where their ranges begin to overlap by killing arctic foxes and their kits.[18] An alternate explanation of the red fox's gains involves the gray wolf: Historically, it has kept red fox numbers down, but as the wolf has been hunted to near extinction in much of its former range, the red fox population has grown larger, and it has taken over the niche of top predator.[citation needed] In areas of northern Europe, there are programs in place that allow hunting of the red fox in the arctic fox's previous range.

As with many other game species, the best sources of historical and large scale population data are hunting bag records and questionnaires. There are several potential sources of error in such data collections.[19] In addition, numbers vary widely between years due to the large population fluctuations. However, the total population of the arctic fox must be in the order of several hundred thousand animals.[20]

The world population is thus not endangered, but two arctic fox subpopulations are. One is on Medny Island (Commander Islands, Russia), which was reduced by some 85-90%, to around 90 animals, as a result of mange caused by an ear tick introduced by dogs in the 1970s.[21] The population is currently under treatment with antiparasitic drugs, but the result is still uncertain.

The other threatened population is the one in Fennoscandia (Norway, Sweden, Finland and Kola Peninsula). This population decreased drastically around the start of the 20th century as a result of extreme fur prices which caused severe hunting also during population lows.[22] The population has remained at a low density for more than 90 years, with additional reductions during the last decade.[23] The total population estimate for 1997 is around 60 adults in Sweden, 11 adults in Finland and 50 in Norway. From Kola, there are indications of a similar situation, suggesting a population of around 20 adults. The Fennoscandian population thus numbers a total of 140 breeding adults. Even after local lemming peaks, the arctic fox population tends to collapse back to levels dangerously close to non-viability.[20]

The arctic fox is classed as a "prohibited new organism" under New Zealand's Hazardous Substances and New Organisms Act 1996 preventing it from being imported into the country.[24]

References

  1. ^ a b Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000873. 
  2. ^ a b c Angerbjörn, A., Hersteinsson, P. & Tannerfeldt, M. (2008). Alopex lagopus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 11 February 2009.
  3. ^ Alopex lagopus
  4. ^ Vulpes zerda
  5. ^ Bininda-Emonds, ORP; JL Gittleman, A Purvis (1999). "Building large trees by combining phylogenetic information: a complete phylogeny of the extant Carnivora (Mammalia)" (PDF). Biol. Rev. 74 (2): 143–175. doi:10.1017/S0006323199005307. PMID 10396181. http://www.daimi.au.dk/~cmosses/thesis/articles/Bininda_Emonds_Carnivora.pdf. Retrieved 2008-07-30. [dead link]
  6. ^ Canids: Foxes, Wolves, Jackals and Dogs
  7. ^ Arctic Fox Alopex lagopus
  8. ^ a b Dewey, T. and C. Middlebrook. 2007. "Vulpes lagopus" (On-line). Accessed May 16, 2009 at Animal Diversity Web
  9. ^ MacDonald, David W. (2004). Biology and Conservation of Wild Canids. Oxford University Press. ISBN 0-19-851556-1. 
  10. ^ John R. Bockstoce (15 September 2009). Furs and frontiers in the far north: the contest among native and foreign nations for the Bering Strait fur trade. Yale University Press. p. 41. ISBN 978-0-300-14921-0. http://books.google.com/books?id=HY6LvFMSxxwC&pg=PA41. Retrieved 8 December 2011. 
  11. ^ a b Joe Clyde Truett; Stephen R. Johnson (15 May 2000). The natural history of an Arctic oil field: development and the biota. Academic Press. pp. 160–163–. ISBN 978-0-12-701235-3. http://books.google.com/books?id=ELsq-yAP0XkC&pg=PA161. Retrieved 8 December 2011. 
  12. ^ a b Alopex lagopus at the Smithsonian
  13. ^ Boitani, Luigi, Simon & Schuster's Guide to Mammals. Simon & Schuster/Touchstone Books (1984), ISBN 978-0-671-42805-1
  14. ^ "Wildlife". Iceland Worldwide. iww.is. 2000. http://www.iww.is/pages/alife/biglf.html. Retrieved 22 April 2010. 
  15. ^ "The Arctic Fox Center". http://www.arcticfoxcenter.com/. Retrieved May 19, 2011. 
  16. ^ Eric G. Bolen (1998). Ecology of North America. John Wiley and Sons. p. 42. ISBN 978-0-471-13156-4. http://books.google.com/?id=sbYL7JNnMNIC&pg=PA42&dq=arctic+fox+blue+phase#v=onepage&q=arctic%20fox%20blue%20phase&f=false. 
  17. ^ Lee Hannah (17 September 2010). Climate Change Biology. Academic Press. p. 63. ISBN 978-0-12-374182-0. http://books.google.com/books?id=4Vvqw2gdk9QC&pg=PA63. Retrieved 8 December 2011. 
  18. ^ David Whyte Macdonald; Claudio Sillero-Zubiri (26 August 2004). The biology and conservation of wild canids. Oxford University Press. p. 10. ISBN 978-0-19-851556-2. http://books.google.com/books?id=Vrgow9ERQeIC&pg=PA10. Retrieved 8 December 2011. 
  19. ^ Garrott and Eberhardt (1987). "Arctic fox". In Novak, M. et al. (eds.). Wild furbearer management and conservation in North America. pp. 395–406. 
  20. ^ a b Tannerfeldt, M. (1997). Population fluctuations and life history consequences in the Arctic fox.. Stockholm, Sweden: Dissertation, Stockholm University. 
  21. ^ Goltsman et al.; Kruchenkova, E. P.; MacDonald, D. W. (1996). "The Mednyi Arctic foxes: treating a population imperilled by disease". Oryx 30 (04): 251–258. doi:10.1017/S0030605300021748. 
  22. ^ Lönnberg, E. (1927). Fjällrävsstammen i Sverige 1926. Uppsala, Sweden: Royal Swedish Academy of Sciences. 
  23. ^ Angerbjörn, A. et al. (1995). "Dynamics of the Arctic fox population in Sweden". Annales Zoologici Fennici 32: 55–68. 
  24. ^ Hazardous Substances and New Organisms Act 2003 - Schedule 2 Prohibited new organisms, New Zealand Government, http://legislation.govt.nz/act/public/1996/0030/latest/DLM386556.html#DLM386556, retrieved 26 January 2012 

Further reading

  • Nowak, Ronald M. (2005). Walker's Carnivores of the World. Baltimore: Johns Hopkins Press. ISBN 0-8018-8032-7
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species formerly was included in the genus Alopex. Data from chromosomes, mtDNA, and allozymes all indicate a close relationship among arctic fox, kit fox, and swift fox and do not support the recognition of the arctic fox in a genus separate from the kit and swift foxes (genus Vulpes) (Geffen et al. 1992, Mercure et al. 1993). The mammal lists by Baker et al. (2003) and Wozencraft (in Wilson and Reeder 2005) used the name Vulpes lagopus for the arctic fox.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!