Overview

Comprehensive Description

Hypsibius dujardini is a member of the phylum Tardigrada, a group of microscopic animals sometimes known as "water bears". This species, named after the French biologist Félix Dujardin, is found in moss and in freshwater habitats and has a cosmopolitan (world-wide) distribution. It is at least largely parthenogenetic (i.e., progeny develop from unfertilized eggs), with females laying eggs that undergo meiosis and then restore a diploid chromosome number by reduplicating chromosomes (rather than by fertilization). However, males have also been described, suggesting that some populations of this species may reproduce sexually. Like other tardigrades, H. dujardini can shut down their metabolism almost entirely and survive long periods in an extremely desiccated state. In this state, tardigrades are highly resistent to extremes of temperature, pressure, and radiation. Desiccated tardigrades sent into space survived exposure to space vacuum and cosmic radiation with no significant effect on survival; exposure to unfiltered solar radiation had a strong negative effect on survival, but some individuals survived even the combined efects of space vacuum and cosmic and solar radiation. (Gabriel et al. 2007; Jönsson et al. 2008)

A broad fundamental question for biologists interested in animal development is how morphological diversity arises through the evolution of developmental mechanisms. Gabriel et al. (2007) suggested that H. dujardini exhibits a variety of features that make it an excellent organism for investigating questions relating to the evolution of development. Tardigrades belong to the same animal superclade (Ecdysozoa) as two of the best studied models for investigating animal development, the fruit fly Drosophila melanogaster (an arthropod) and the nematode worm Caenorhabditis elegans. Thus, background and tools developed for studying these other model systems could leverage investigations of H. dujardini. Gabriel et al. showed that H. dujardini can be cultured continuously for decades (long-term culture of tardigrades has been a challenge historically) and that it has a short generation time, 13 to 14 days at room temperature. Conveniently, it can be cryopreserved for storage at -80° C and thawed months later with a fairly high survival rate. It also has a compact genome (plans to sequence the complete genome of this tardigrade were approved in 2007). The haploid genome size was estimated at ~75 Mb. Twenty other tardigrade species have been assessed for genome size to date, but none have exhibited a genome quite this compact (range: 80 Mb to 800 Mb). The H. dujardini genome is among the smallest so far identified for animals, being less than half the size of the D. melanogaster genome and three-quarters as large as that of C. elegans. The only metazoan genome sizes reported to exceed this level of compactness are found in some nematodes (as small as ∼30 Mb), the placozoan Trichoplax adhaerens (40 Mb), gastrotrichs (≥50 Mb), sponges (≥60 Mb), some polychaete annelids (≥60 Mb), and the larvacean Oikopleura dioica (70 Mb). Both adults and embryos of H. dujardini are optically clear, with much of their anatomy visible by light microscopy, making it possible to follow cell divisions by optically sectioning live embryos using differential interference contrast (DIC) microscopy. Gabriel et al. found that the embryos of H. dujardini have a stereotyped cleavage pattern with asymmetric cell divisions, nuclear migrations, and cell migrations occurring in reproducible patterns and presented a cell lineage of the early embryo and an embryonic staging series. (Gabriel et al. 2007 and references therein)


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

General Ecology

Life cycle data from a lab environment

Each adult produces approximately 3-4 embryos per laying (mean = 3.4 ± 1.9 SD, range 1–10, n = 1411 embryos). Embryos are laid during molting, with the embryos deposited in the shed exoskeleton, called an exuvia, and the adult crawls out of the exuvia soon after producing embryos. Embryos develop in the cast off exuvia until hatching occurs 4 to 4.5 days later. The generation time in a lab environment is 13–14 days at room temperature (mean 13.6 ± 0.8 SD, n = 67).

  • Gabriel, W.N., R. McNuff, S.K. Patel, T.R. Gregory, W.R. Jeck, C.D. Jones and B. Goldstein (2007) The Tardigrade Hypsibius dujardini, a New Model for Studying the Evolution of Development. Developmental Biology 312: 545-559.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Bob Goldstein

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hypsibius dujardini

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGATGATTTTTTTCTACAAACCACAAAGACATTGGAACCCTTTACTTTATTTTTGGTATCTGAAGAGCAACTGTAGGAACCTCCCTAAGCATACTAATTCGTTCTGAGCTTAGCCAACCAGGAAGCTTATTAGGAGACGAACAAATTTACAACGTAACTGTTACCAGACATGCATTTATTATAATTTTCTTCTTTGTAATACCTATTCTAATTGGAGGATTCGGAAACTGATTAATTCCTCTTATAATTGGGGCTCCAGACATAGCTTTCCCTCGCTTAAACAATCTTAGGTTCTGACTTCTACCACCGTCTTTCTTTCTTATTACTTCTAGCACCGTCAGAGAACAGGGGGCCGGTACAGGGTGAACCGTATACCCTCCTCTGGCACACAATTTTGCACATAGAGGTCCAGCAGTGGATCTGACAATTTTTTCCCTTCACCTAGCCGGAGTGTCATCTATTTTAGGGGCAACAAACTTTATTTCAACAATTATTAATATGCGCACATCCTCTATAATACTGGAAAGTATACCCCTCTTTGTTTGATCTGTTCTAATCACGGCAGTTTTACTGCTTTTAGCCCTACCTGTTCTAGCAGGGGCCATTACCATATTGCTACTAGATCGTAACTTTAACACATCCTTCTTCGACCCTAGAGGAGGAGACCCGATTCTCTATCAACACTTATTTTGGTTCTTCGGACACCCAGAAGTATATATTCTGATTCTTCCCGGATTCGGAATCATTTCTCAAATTATTGCCCACTATAGGGGAAAGCATCTAGTATTCGGACATTTAGGGATAGTATACGCTATAAGAACAATTGGTCTCCTAGGGTTTATTGTATGAGCACACCACATGTTTACAGTAGGTATAGATTTAGATACTCGAGCATATTTCACAGCTGCAACTATAATTATTGCAATTCCAACAGGAATTAAGGTTTTCAGATGATTAAGAACCTTATATGGAACGGAAATCAAGCCCAACCCGGCAATACTGTGAAGAATTGGGTTTATCTCCCTATTCACCTGTGGAGGACTAACCGGAGTAGTCCTTTCCAACTCCTCTCTTGATATTGTACTTCATGATACTTATTACGTTGTAGCACATTTCCATTATGTTTTATCTATAGGAGCAGTATTTGCTATTATCGCTGGAATCTCCCATTGATATCCTCTTATTTCAGGCACAACCCTTAACAATAAATGAATAATTTCACAATTTTTACAGATATTCCTAGGGGTAAACCTAACATTTTTTCCACAACACTTTTTAGGTCTAGCCGGAATACCTCGACGGTATGTAGATTATCCAGATACCTTTTTCTCTTGAAATATAATCTCAAGAATTGGGTCTATAATTTCATCACTTAGGGTTATTTTCCTATTTTTCATTATCTGAGAAAGTATGATCTCCCAACGAAACGCCTTTACCCTTATCTACTCTACCCCTCTGTTAGAATGAAAAAGAATTACCCCACCGCCCTCTCACTCTTTTTCACAACTTTGTATTGTAAGAAAAGAGAGATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypsibius dujardini

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Laboratory methods

Methods for maintaining cultures, cryopreservation, staining animals and embryos, genomic prep and PCR are available here.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Bob Goldstein

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!