Articles on this page are available in 1 other language: Spanish (7) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thamnophilus doliatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Thamnophilus doliatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTCATTAACCGATGACTATTCTCTACCAACCACAAAGACATTGGCACTCTCTACCTAATTTTTGGGGCATGAGCCGGAATAATTGGAACTGCCCTAAGCCTCCTAATCCGAGCTGAACTCGGACAACCAGGAACCCTACTAGGCGATGACCAAATTTATAACGTAATCGTCACTGCTCATGCATTCGTCATAATCTTCTTCATAGTTATACCCATCATAATCGGCGGATTCGGTAACTGATTAGTTCCCCTAATAATCGGAGCCCCCGACATAGCATTCCCGCGAATAAACAATATAAGCTTCTGACTCCTTCCCCCCTCTTTCCTTCTCCTCTTGGCCTCCTCCACAGTAGAAGCAGGAGTTGGAACAGGATGAACAGTATACCCCCCACTAGCCGGTAATCTTGCCCATGCTGGAGCTTCAGTAGACCTAGCCATCTTTTCCCTTCACCTAGCCGGTGTTTCCTCCATTTTAGGGGCAATTAACTTTATCACAACCGCAATCAATATAAAACCCCCAGCACTATCACAATATCAAACTCCCTTATTCGTCTGATCCGTCCTTATCACTGCCGTATTACTGCTCCTATCCCTCCCAGTCCTTGCCGCCGGCATCACAATGCTACTCACAGACCGTAACCTAAATACAACCTTCTTCGATCCAGCTGGGGGAGGAGACCCAATTCTTTACCAACACTTATTCTGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight (A. Panjabi in litt. 2008)

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Barred Antshrike

The barred antshrike (Thamnophilus doliatus) is a passerine bird in the antbird family. It is found in the Neotropics from Tamaulipas, Mexico, through Central America, Trinidad and Tobago, and a large part of South America east of the Andes as far south as northern Argentina, Bolivia and Paraguay. There is one accepted record from southern Texas.[2] It is found in a wide range of wooded habitats (even gardens and parks) in both humid and arid regions. Throughout a large part of its range, it is among the most common antbirds.

Description[edit]

Female
Male in Panama
Juvenile female in Goias, Brazil

The barred antshrike is typically 16.5 cm (6.5 in) long, and weighs 25 g (0.88 oz). The male is barred all over with black and white, and has a white-based black crest that is raised in display. The female is rufous above with a chestnut crest. The sides of her head and neck are streaked with black, and the underparts are rich buff.

The subspecies vary primarily in the overall darkness and the amount of barring and hue of the underparts. For example, in the Tobagonian race T. d. tobagensis males are whiter below, and females darker, than in the nominate subspecies. The most distinctive subspecies is capistratus of the Caatinga in north-eastern Brazil, where males have uniform black crown (no white barring to the base) and females have streaked throat and faintly barred belly. It is also the only subspecies where the iris is deep maroon-red (not yellow). It has recently been suggested that it should be considered a separate species, the Caatinga barred antshrike.

Behavior[edit]


Problems playing this file? See media help.

It is typically found as territorial pairs. The female lays two purple-marked creamy white eggs in a deep cup nest in a shrub, which are incubated by both sexes for 14 days to hatching. The chicks fledge in another 12–13 days.

Barred antshrike is an insectivore which feeds on ants and other arthropods at or near the ground; it sometimes follows columns of army ants, and will take small lizards and berries. It is a skulking species, which may be located by its chuckling hu-hu-hu-hu-hu-hu song, often performed as a duet by a pair of birds, or a growled graaaaa.

References[edit]

  • ffrench, Richard (1991). A Guide to the Birds of Trinidad and Tobago (2nd edition ed.). Comstock Publishing. ISBN 0-8014-9792-2. 
  • Hilty, Steven L (2003). Birds of Venezuela. London: Christopher Helm. ISBN 0-7136-6418-5. 
  • Assis, C. P., Raposo, M. A., Stopiglia, R., and Parrini, R. (2007). Validation of Thamnophilus capistratus Lesson, 1840 (Passeriformes, Thamnophilidae). The Auk 124(2): 665–676.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!