Overview

Brief Summary

Species Abstract

The Antarctic minke whale (Balaenoptera bonaerensis), is a large cetacean, in the family of Rorquals (Balaenoptera). The Minke is a baleen whale, meaning that instead of teeth, it has long plates which hang in a row (like the teeth of a comb) from its upper jaws. Baleen plates are strong and flexible; they are made of a protein similar to human fingernails. Baleen plates are broad at the base (gumline) and taper into a fringe which forms a curtain or mat inside the whale's mouth. Baleen whales strain huge volumes of ocean water through their baleen plates to capture food: tons of krill, other zooplankton, crustaceans and small fish.

Balaenoptera bonaerensis is among the smallest among the rorquals. Mature males average 8.36 m ineters (m) length and weigh 6.85 tons, but an adult reach a total length of 9.63 m and a body mass of 11.05 tons. Females are slightly longer with a mean total length of 7.57 m and a maximum measured length of 10.22 m. On average, B. bonaerensis is slightly longer than all forms of B. acutorostrata. Similar to Balaenoptera acutorostrata, Antarctic minke whales are dark grey on the back with a pale ventral side. The main recognition character that allows for the distinction of Antarctic minke whales from Balaenoptera acutorostrata is the absence of a white patch on the flippers in Antarctic minke whales. The rostrum is narrow and pointed. The dorsal fin is hook-shaped and located about two-thirds the length of the body from the anterior. Baleen plates are black on the left side and on the posterior two thirds of the right side, while the remaining baleen plates are white. The baleen plate filaments average about 3.0 mm in diameter. Antarctic minke whales have larger skulls than Balaenoptera acutorostrata.

Minke whales in Antarctic feeding areas can be solitary or form small groups. They are generally seen in groups of two to four individuals. Distribution of individuals within these groups is relatively random. There seems to be an enhanced amount of clustering in relatively enclosed areas (e.g., bays) as opposed to open water habitats. Antarctic minke whales sometimes uses the rostrum to break ice several centimeters in thickness to create breathing holes. The distance between two neighboring holes usually ranges from 200 m to 300 m. The species is noted to actively avoid ships that are in motion; furthermore, it uses “porpoising” behavior in doing so.

  • * Encyclopedia of Earth. Lead author: Encyclopedia of Life. 2011. ed. C.Michael Hogan. ed.-in-chief Cutler J.Cleveland. National Council for Science and the Environment. Washington DC http://www.eoearth.org/article/Antarctic_Minke_Whale
  • * D.Mellinger and C.Carson. 2000. Characteristics of minke whale (Balaenoptera acutorostrata) pulse trains recorded near Puerto Rico. Marine Mammal Science, 16(4): 739-756
  • * W.Perrin. 2010. Balaenoptera bonaerensis Burmeister, 1867. In: Perrin, W.F. World Cetacea Database. Accessed through: Perrin, W.F. World Cetacea Database
  • *
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth; Encyclopedia of Life

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Minke whales according to MammalMAP

Until recently, minke whales were considered as a single species, but mitochondrial DNA testinghas differentiated between the common minke whale and the Antarctic minke whale.

The Antarctic minke whale (Balaenoptera bonaerensis) is the larger species of minke whale.  However, in whale terms, they are still relatively small – usually less than 10 meters in length and weighing on average 9 tonnes.  These whales can be found in all oceans in the southern hemisphere.

In the polar regions, they are commonly found within 160 km of pack ice especially during winter.  Antarctic minke whales sometimes use their rostrum to break ice to create breathing holes.  Most minke whales seem to migrate between summer and winter grounds but some populations appear to remain in Antarctic waters throughout the year.  Population distribution north of Antarctica is difficult to assess as there is significant overlap with common minke whales.

Antarctic minke whales can be solitary or form small groups of 2 – 4 individuals.  Minke whales are notorious for their curiosity and are one of the most frequently observed Balaenopterabecause of their habit of approaching stationary boats. 

Antarctic minke whales are baleen whales that feed primarily on Antarctic krill (Euphausia superba).  Krill comprises 100% of stomach contents of Antarctic minke whales caught at the ice edge and 94% of the stomach contents of minke whales in the offshore zone.  Feeding at the ice edge is more common in the early morning.

The IUCN Red List classifies Antarctic minke whales as a data deficient species as there is no formal estimate of population abundance.

For more information on MammalMAP, visit the MammalMAP virtual museum or blog.

Creative Commons Attribution 3.0 (CC BY 3.0)

© MammalMAP

Supplier: MammalMAP

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

circum-global southern hemisphere
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Balaenoptera bonaerensis is considered a southern hemisphere species, although there is a single record from Suriname (60°N) (Rice 1998). In summer they are abundant throughout the Antarctic south of 60°S, occurring in greatest densities near the ice edge, and to some extent within the pack ice and in polynyas. Particularly high densities have been observed in some years in high Antarctic areas such as Prydz Bay, the Weddell Sea and the Ross Sea (Kasamatsu et al. 1997). Although B. acutorostrata has been found in the Antarctic as far south as 65°S it is much less common there than B. bonaerensis (Pastene 2006a), such that all “minke whale” abundance estimates south of 60°S can for practical purposes be treated as referring to B. bonaerensis.

Minke whales are seen outside the Antarctic in summer (Kasamatsu and Miyashita 1983) but much of the summer data is ambiguous with respect to identification as B. acutorostrata or B. bonaerensis, such that it remains unclear whether significant numbers of B. bonaerensis occur outside the Antarctic in summer.

The winter distribution is less well known. There is a wintering area off Costinha, Brazil (7°S), where minke whales, almost exclusively B. bonaerensis, were the target of a whaling operation during 1964–85, with the peak abundance in October (da Rocha and Braga 1982, Holt, de la Mare and van Beek 1982). The recovery in this fishery of two whales marked in the Antarctic in Area II at 62° and 69°S (Buckland and Duff 1989) demonstrates that at least some individuals from the Brazilian population migrate to the Antarctic. Minke whales were also seen (and small numbers caught) off Durban, South Africa: the seasonal distribution was bimodal, with peaks in April/May and September/October, suggestive of migration past the area (Best 1982). There are occasional records from Peru (VanWaerebeek and Reyes 1994).

Japanese scouting vessel data indicated high abundance of minke whales (species ambiguous) in November between 10°–30°S in the central South Pacific and in much of the eastern and southern Indian Ocean from the tropics southwards to 50°S (Miyashita et al. 1995). The limited information available from low-latitude surveys from the 1987/88 season onwards, when the two minke whale species were reliably distinguished, indicates that most of the minke whales were B. bonaerensis (Nishiwaki et al. 1991), probably on route from (as yet unknown) low-latitude breeding grounds to the Antarctic. The lack of any known areas of high concentration in winter suggests that the breeding distribution is rather dispersed and largely offshore (Kasamatsu et al. 1995). The species identity of minke whales seen in Indonesian waters in November (Miyashita et al. 1995) is unclear.

At least some of the Antarctic minke whale population remains in the Antarctic in winter (Ensor 1989), but the proportion has not been quantified.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Balaenoptera bonaerensis occurs in polar to tropical waters of the southern hemisphere. It occurs in large numbers south of 60º S, throughout the Antarctic. The distribution is more difficult to assess north of the Antarctic because of its co-occurrence with Balaenoptera acutorostrata. As a result, the boundaries of the species’ winter distributions remain largely undefined. Balaenoptera bonaerensis is observed off the coast of Brazil and South Africa and there have been occasional sightings in Peru. An unknown proportion of the species remains in Antarctic waters during the winter.

Biogeographic Regions: antarctica (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Mead, J., R. Brownell Jr. 2005. Order Cetacea. Pp. 2142 in D Wilson, D Reeder, eds. Mammal Species of the World. A Taxonomic and Geographic Reference (3rd Ed.). Baltimore: John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Balaenoptera bonaerensis is among the smallest rorqual species. Mature males average 8.36 m in length and weigh 6.85 tons, but they can reach a total length of 9.63 m and a weight of 11.05 tons. Females are slightly longer with a mean total length of 7.57 m and a maximum measured length of 10.22 m. On average, B. bonaerensis is slightly longer than all forms of B. acutorostrata. Similar to common minke whales, Antarctic minke whales are dark grey on the back with a pale ventral side. The main recognition character that allows for the distinction of Antarctic minke whales from common minke whales is the absence of a white patch on the flippers in Antarctic minke whales. The rostrum is narrow and pointed. The dorsal fin is hook-shaped and located about two-thirds the length of the body from the anterior. Baleen plates are black on the left side and on the posterior 2/3 of the right side, while the remaining baleen plates are white. The baleen plate filaments average about 3.0 mm in diameter. Antarctic minke whales have larger skulls than common minke whales.

Range length: 6.32 to 10.22 m.

Average length: Males: 8.36; Females:8.89 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

  • Konishi, , Tamura, Zenitani, Bando, Kato, Walloe. 2008. Decline in energy storage in the Antarctic minke whale (Balaenoptera bonaerensis) in the Southern Ocean. Polar Biology, 31(12): 1509-1520.
  • Perrin, W., R. Brownell Jr. 2002. Encyclopedia of Marine Mammals. San Diego: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
While in the Antarctic, minke whales feed almost exclusively on krill, primarily Euphausia superba, but also E. crystallorophias (ice krill), E. frigida, and Thysanoessa macrura (Tamura and Konishi 2006). Observed densities of minkes are highest near the edge of the pack ice, but these whales also occur within the pack ice (Shimada and Kato 2006). It is not known whether Antarctic Minke Whales also feed to any significant extent while outside the Antarctic on their wintering grounds or migration routes. Best (1982) found a very low level of feeding, almost entirely on euphausiids, by Antarctic minke whales taken in winter off Durban, South Africa. Antarctic minke whales may themselves be an important prey for type-A Killer Whales Orcinus orca (Pitman and Ensor 2003).

Generation time
The generation time is estimated to be 22 years (Taylor et al. 2007).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Balaenoptera bonaerensis can be found in marine waters from polar to tropical regions, generally within 160 km of the edge of pack ice. While mostly found at the ice edge, B. bonaerensis can also be found within the pack ice and in polynyas. Association with pack ice is especially pronounced during winter.

Habitat Regions: temperate ; tropical ; polar ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

  • Thiele, D., E. Chester, S. Moore, A. Sirovic, J. Hidlebrand, A. Friedlaender. 2004. Seasonal variability in whale encounters in the Western Antarctic Peninsula. Deep-Sea Research Part II - Tropical Studies in Oceanography, 51(17-19): 2311-2325.
  • Schueller, G. 2004. Rorquals (Balaenopteridae). Pp. 119-130 in M Hutchins, A Evans, J Jackson, D Kleiman, J Murphy, D Thoney, eds. Grzimek's Animal Life Encyclopedia, Vol. Vol. 15: Mammals IV., 2nd ed Edition. Detroit: The Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.706 - 19.048
  Nitrate (umol/L): 0.892 - 30.497
  Salinity (PPS): 33.652 - 35.585
  Oxygen (ml/l): 5.330 - 8.066
  Phosphate (umol/l): 0.264 - 2.110
  Silicate (umol/l): 4.095 - 64.738

Graphical representation

Temperature range (°C): -1.706 - 19.048

Nitrate (umol/L): 0.892 - 30.497

Salinity (PPS): 33.652 - 35.585

Oxygen (ml/l): 5.330 - 8.066

Phosphate (umol/l): 0.264 - 2.110

Silicate (umol/l): 4.095 - 64.738
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

mostly inshore
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Trophic Strategy

Food Habits

Antarctic minke whales feed mainly on krill (Euphausia superba). Euphausia superba comprises 100% of stomach contents of minke whales caught at the ice edge and 94% (by weight) of the stomach contents of minke whales in the offshore zone. Euphausia crystarollophias was also found in smaller quantities in the stomachs of Antarctic minke whales caught in coastal areas. Other prey include Euphasi frigida and Thysanoessa macrura. This is in contrast to common minke whales, which feed on a more diverse array of fish and invertebrates. Antarctic minke whales feed primarily in the early morning and late evening and most feeding activity is observed at the edge of pack ice. Daily food consumption in the summer was estimated at 3.6 to 5.3% of body weight, representing an important proportion of krill biomass in the study area. It is likely that Antarctic minke whales eat much smaller quantities of food during the austral winter or perhaps forage very little at all on wintering grounds (Best 1982 as cited in Reilly et al., 2008). The blubber layer thickens as the feeding season progresses but mean blubber thickness in individuals has decreased over the 18 year period between 1987 and 2005. This might suggest a decrease in food availability in Antarctic waters.

Animal Foods: aquatic crustaceans; zooplankton

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Eats non-insect arthropods); planktivore

  • Ichii, T., H. Kato. 1991. Food and daily food consumption of southern minke whales in the Antarctic. Polar Biology, 11: 479-487.
  • Tamura, T., K. Konishi. 2006. Feeding habits and prey consumption of Antarctic minke whales, Balaenoptera bonaerensis in JARPA research area.
  • Reilly, S., J. Bannister, P. Best, M. Brown, R. Brownell Jr, D. Butterworth, P. Clapham, J. Cook, G. Donovan, J. Urbán, A. Zerbini. 2008. "Balaenoptera bonaerensis" (On-line). 2008 IUCN Red List of Threatened Species. Accessed February 05, 2009 at http://www.iucnredlist.org/details/2480.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Antarctic minke whales are predators of krill, mainly Euphasia superba and are preyed on by killer whales (Orcinus orca). They may compete with other mammals and birds feeding on krill, such as penguins (Spheniscidae), crabeater seals (Lobodon carcinophaga), and blue whales (Balaenoptera musculus). Antarctic minke whales may also be the host of several types of microorganisms. For instance, they are often observed to have a film of diatoms on their skin. The extent of this film is thought to be correlated with the amount of time a whale has spent in cold waters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Antarctic minke whales seem to be the main prey for type-A killer whales in Antarctica (Orcinus orca). Antarctic minke whales also represent a large proportion of Japanese whaling catches and have become an increasingly important in recent years with the decline of larger Balaenoptera species populations.

Known Predators:

  • Pitman, R., P. Ensor. 2003. Three forms if killer whales (Orcinus orca) in Antarctic waters. Journal of Cetacean Research and Management, 5(2): 131-139.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Balaenoptera acutorostrata in the North Atlantic produces an extensive range of sounds. Mellinger and Carson (2000) analyzed pulse trains of minke whales in the Caribbean and classified them into two categories: the “speed-up” trains and the less common “slow-down” trains. Pulse trains are sequences of pulses produced at regular or irregular intervals. There is limited information, however, as to whether this type of vocalization is also present in B. bonaerensis and what function it serves in B. acutorostrata.

Communication Channels: acoustic

Perception Channels: visual ; acoustic ; ultrasound

  • Mellinger, D., C. Carson. 2000. Characteristics of minke whale (Balaenoptera acutorostrata) pulse trains recorded near Puerto Rico. Marine Mammal Science, 16(4): 739-756.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In an 18-year study of energy storage in Antarctic minke whales, Konishi et al. (2008) aged a total of 4,268 mature whales (mature males and pregnant females). They used measurement of the earplug, a layered keratinized and fatty structure inside the external auditory canal, to determine age. The oldest whale aged in their study was 73 years old according to this technique.

Range lifespan

Status: wild:
73 (high) years.

  • Lockyer, C. 1972. The age at sexual maturity of the southern fin whale (Balaenoptera physalus) using annual layer counts in the ear plug. Journal du Conseil International pour l’Exploration de la Mer, 34(2): 276-294.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lucena (2006) suggested that Antarctic minke whales are polygamous, judging by the structure of groups in breeding grounds. Little is known about mating behavior in any rorqual.

Mating System: polygynandrous (promiscuous)

Kasamatsu et al. (1995) found that minke whales (probably Balaenoptera bonaerensis) migrate far north but their main breeding areas are probably between 10º and 20º S. Breeding populations may be relatively dispersed and do not seem to be associated with the coast. The generation time is estimated to be about 22 years.

Antarctic minke whales, like common minke whales, have a gestation period of 10 months, after which a single young is born at about 2.7 meters long. Calves stay with their mother for up to 2 years and may nurse for 3 to 6 months.

In Antarctic minke whales, the age at which sexual maturity is reached has been shown to have decreased from an average of age 11 in the cohorts of 1950’s to about 7 years old in the 1970’s cohorts.

Breeding interval: Antarctic minke whale females can breed up to every year, although it is more common for them to breed less often.

Breeding season: It is thought that the breeding season occurs during the austral summer.

Average number of offspring: 1.

Average gestation period: 10 months.

Range weaning age: 3 to 6 months.

Range time to independence: 2 (high) years.

Average age at sexual or reproductive maturity (female): 7 years.

Average age at sexual or reproductive maturity (male): 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Female Antarctic minke whales gestate, nurse, and protect their young for up to two years. Males do not provide parental care. The milk of their close relatives, common minke whales (Balaenoptera acutorostrata), contains lactose and several other oligosaccharides, some of which have never been found in any other mammalian species. These new oligosaccharides may have a function in the immunity of the neonate.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Kasamatsu, F., S. Nishiwaki, H. Ishikawa. 1995. Breeding areas and southbound migrations of southern minke whales Balaenoptera acurostrata. Marine Ecology Progress Series, 119: 1-10.
  • Lucena, A. 2006. Minke whale Balaenoptera bonaerensis (Burmeister)(Cetacea, Balaenopteridae) population structure in the breeding grounds off South Atlantic Ocean. Revista Brasileira de Zoologia, 23(1): 176-185.
  • Thomson, R., D. Butterworth, H. Kato. 1999. Has the age at transition of Southern Hemisphere minke whales declined over recent decades?. Marine Mammal Science, 15(3): 661-682.
  • Urashima, T., H. Sato, J. Munakata, T. Nakamura, I. Arai, T. Saito, M. Tetsuka, Y. Fukui, H. Ishikawa, C. Lydersen, K. Kovacs. 2002. Chemical characterization of the oligosaccharides in beluga (Delphinapterus leucas) and Minke whale (Balaenoptera acutorostrata) milk. Comparative Biochemistry and Physiology B-Biochemistry and Molecular Biology, 132(3): 611-624.
  • Schueller, G. 2004. Rorquals (Balaenopteridae). Pp. 119-130 in M Hutchins, A Evans, J Jackson, D Kleiman, J Murphy, D Thoney, eds. Grzimek's Animal Life Encyclopedia, Vol. Vol. 15: Mammals IV., 2nd ed Edition. Detroit: The Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balaenoptera bonaerensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGCTGACTATTCTCAACCAACCACAAAGACATTGGCACCCTATACTTACTATTTGGTGCCTGAGCAGGAATAGTAGGCACTGGTCTAAGCTTATTAATCCGCGCTGAGCTAGGTCAGCCCGGCACACTAATCGGAGACGACCAAGTCTATAACGTATTAGTAACAGCCCACGCCTTCGTGATAATCTTTTTCATGGTTATGCCTATTATAATTGGCGGATTCGGAAACTGACTGGTCCCCCTAATAATTGGAGCACCCGACATAGCTTTTCCCCGTATAAATAATATAAGCTTCTGACTACTCCCTCCTTCTTTCTTACTATTAATAGCATCTTCAATAGTCGAAGCCGGTGCAGGTACAGGCTGAACTGTATATCCTCCTTTAGCCGGAAACCTAGCACATGCAGGAGCCTCAGTTGACCTCACCATCTTCTCCCTACACCTAGCCGGCGTATCCTCAATCCTCGGAGCCATCAACTTCATCACAACTATCATCAATATAAAACCACCCGCCATAACCCAATATCAAACTCCCCTTTTCGTATGATCCGTCCTAGTCACAGCAGTACTACTCTTACTATCATTACCCGTCTTAGCAGCCGGAATCACTATACTACTTACTGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGTGGAGGAGACCCCATTCTATACCAACACCTATTCTGATTCTTTGGTCACCCCGAAGTATATATTCTAATTCTTCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAAGAACCTTTCGGTTATATAGGAATAGTTTGAGCTATAGTATCCATTGGGTTCCTAGGCTTTATCGTATGAGCCCACCACATGTTTACAGGAGGTTTAGACGTTGACACGCGAGCATACTTCACATCAGCTACTATAATTATTGCCATTCCCACAGGAGTAAAAGTCTTCAGCTGATTAGCAACACTACACGGAGGTAACATTAAATGATCCCCTGCCCTAATATGAGCCCTAGGTTTCATCTTCCTCTTCACAGTGGGCGGCCTAACTGGTATTGTCCTAGCCAACTCATCACTAGACATTGTCCTACACGACACCTACTACGTAGTCGCTCATTTCCACTATGTGTTATCAATAGGAGCAGTCTTCGCCATCATAGGAGGCTTTGTCCACTGATTCCCACTATTCTCAGGGTATACACTTAACCCAACATGAACAAAAATTCATTTCATAATCATATTTGTAGGTGTAAACCTAACATTCTTTCCACAACACTTCTTAGGCCTATCCGGTATACCTCGACGGTACTCCGACTACCCAGACGCCTACACAACATGAAATACCATCTCATCCATAGGCTCCTTTATTTCACTAACAGCAGTTATACTAATAATCTTCATTATCTGAGAAGCATTCGCATCCAAACGAGAAGTACTAGCAGTAGATCTCACCACTACCAACCTCGAATGACTAAACGGGTGTCCTCCACCATACCATACATTCGAAGAACCTGCATTCGTCAACCCAAAATGATCAAGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Balaenoptera bonaerensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
Although there is no accepted estimate of current abundance, the population size is clearly in the hundreds of thousands. The data analysed by standard methods suggest a reduction of approximately 60% between the 1978–91 period and the 1991–2004 period. However, alternative hypotheses to explain the apparent decline are still under investigation. If the decline is real, its extent and causes are currently unknown, and it may still be continuing. The corresponding population reduction thresholds (criterion A2) are 30% for Vulnerable and 50% for Endangered, measured over a 3-generation time window, which in this case is estimated to be approximately 66 years (22 years per generation). If the decline proves to be largely or mainly an artefact, or proves to have been transient in the light of analyses of more recent data, the species would qualify as Least Concern. If it were real, the species would qualify as Endangered. Pending resolution of the uncertainties relating to the apparent decline, however, the species is listed as Data Deficient (DD).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The International Union for the Conservation of Nature and Natural Resources (IUCN) currently lists the species as “Data Deficient”. However, it has been suggested that the species has declined by about 60% between the periods 1978–91 and 1991–2004. If the decline is shown to be an artifact or to have been transient, the species would then be classified as “Least Concern” whereas it would be classified as “Endangered” if it was demonstrated to be an actual decline. The Peru population was added to Appendix I of CITES in 1986 and withdrawn from it in 2001. The predicted substantial decline in the extent of Antarctic sea ice may dramatically effect krill populations and the Antarctic minke whale populations that depend on them.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
As for other baleen whales, the IWC’s management of Antarctic Minke Whales has been based on six Areas, I through VI, which are longitudinal pie slices 50°–70° wide. The population structure is poorly known, but recent analyses suggest a genetic distinction between whales in the Indian Ocean sector of the Antarctic (west of 165°E) and the Pacific Ocean sector (east of this line) with presumably some overlap (Pastene 2006b). With the exception of the two marked whales mentioned above, the relationship between the Antarctic distribution and putative breeding areas is largely unknown.

Ship-based summer surveys of the area south of 60°S have been conducted each summer since 1978/79, under the auspices of the IWC SC, under the International Decade of Cetacean Research (IDCR) —later Southern Ocean Whale and Ecosystem Research (SOWER) — programme, and covering a different Area (or part Area) each year (Matsuoka et al. 2001). These have been used to estimate minke whale population sizes, on the assumption that the bulk of the population is found south of 60°S in the survey season (Branch and Butterworth 2001). The survey vessels do not enter the pack ice, where minke whales are known to occur to some extent (Shimada and Kato 2006).

The IWC SC conducted a major assessment of Antarctic Minke Whales in 1990, and a population estimate of 760,000 was adopted, based on results of the IDCR surveys conducted in the seasons 1982/83 through 1988/89 (IWC 1991). Results of subsequent surveys indicated lower abundances (see Table 1 in linked PDF document, which constitutes an integral part of this assessment), leading the Committee to conclude in 2000 that the estimate of 760,000 was no longer a valid estimate of current abundance (IWC 2001, p. 31). The Committee has not yet adopted a new current estimate, pending the development, testing and implementation of improved analysis methods. Estimates calculated using the standard methodology for comparative purposes (Branch 2006, IWC 2007) were:

After adjusting for the different coverage of the three sets of surveys (which is not simply a multiplication, because the areas unsurveyed in the earlier years tended to be further north), the ratio of the three abundance estimates for the three periods was 0.97:1.00:0.39 (see Table 1 in attached PDF document).

The Committee has to date (January 2007) been unable to determine whether the apparent decline was real or artifactual. The Committee considered the two most likely confounding factors to be: (i) a reduction in sighting efficiency (e.g., due to smaller school sizes and possibly less experienced observers) and (ii) changes in ice extent, such that fewer whales occurred in surveyable open water.

Two additional points were noted (IWC 2007):
(i) The decline was specific to minke whales; estimates for other species (blue, fin, killer, humpback) increased over the period; an explanation for the decline would need to account for this.
(ii) Abundance estimates for Areas IV and V obtained by the Japanese scientific permit whaling programme (JARPA) for the seasons 1989/90 through 2004/05 showed no statistically significant trend.
Further work on the issues of sighting efficiency and whale/ice distribution is underway. The Committee expects to adopt revised abundance estimates in the near future (2008) and to determine whether and to what extent the apparent decline is real.

Some authors have proposed that the population of Antarctic Minke Whales had been increasing up to the late 1960s (e.g. Mori and Butterworth 2006), but this is controversial.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Whaling on this species has not been as intensive as on the larger baleen whales. Substantial catches of Antarctic Minke Whales, apart from some experimental catches in the late 1960s, have been made by pelagic expeditions only since 1971, following depletion of the larger baleen whales (IWC 2006). Nearly 100,000 minke whales have been taken by pelagic whaling expeditions in the Antarctic, in addition to over 14,000 taken from the Brazilian land station at Costinha during 1964–85. Since 1987, pelagic catching has continued under scientific permit – at a much reduced, but increasing, level. The catch in the 2005/2006 season was 853 (Miyashita and Kato 2006). Otherwise, Antarctic minke whales are not subject to any substantially known direct anthropogenic threats. Bycatches in fishing gear have been recorded (e.g. van Waerebeek and Reyes 1994) but there is no indication that the numbers are significant.

During this century, a profound reduction in the extent of sea ice in the Antarctic is expected, and possibly a complete disappearance in summer, as mean Antarctic temperatures rise faster than the global average (Turner et al. 2006). The implications of this for Minke Whales are unclear but warrant monitoring.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Catches of Antarctic Minke Whales were subject to IWC catch limits soon after exploitation started. Catch limits for commercial whaling became zero from 1986 with the coming into effect of the IWC moratorium on commercial whaling. The summer range of Antarctic Minke Whales is also nominally protected by the IWC Southern Ocean Sanctuary, adopted in 1994, which prohibits catches south of a boundary located mainly at 40°S. Neither the moratorium nor the sanctuary’s proscription applies to taking under scientific permits issued by IWC member governments, which have been ongoing from 1987 to the present. Antarctic Minke Whales are listed on Appendix I of CITES, but Japan has held a reservation against this listing since July 2000. Japan also holds a reservation on the Sanctuary provision and therefore is not bound by it. The species is listed in Appendix II of CMS. The species is covered by generic wildlife conservation measures adopted under international treaties.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no recognized direct negative impacts of Antarctic minke whales on human populations. One could hypothesize, however, that potential food competition with other economically important whale species, such as blue whales (Balaenoptera musculus), could have a negative economic impact on their harvest. Larger whale species are considered more valuable in that they provide more meat per unit catch.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Since 1986, commercial whaling has been prohibited by the International Whaling Commision. Balaenoptera bonaerensis is currently taken for scientific whaling by the Japanese. The animals caught in that process can then be sold on the market for food. Before the decline of larger whale species, such as fin and blue whales (Balaenoptera physalus and Balaenoptera musculus, respectively), B. bonaerensis was rarely targeted by whalers due to its comparatively smaller size. Consequently, whaling on Antarctic minke whales has only started relatively recently, since 1971 (IWC 2006 as cited in Reilly et al., 2008).

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Minke whale

Minke whale /ˈmɪnki/, or lesser rorqual, is a name given to two species of marine mammal belonging to a clade[1] within the suborder of baleen whales. The minke whale was given its official designation[2] by Lacepède in 1804,[3] who described a juvenile specimen of Balænoptera acuto-rostrata.[4] The name is a partial translation of Norwegian minkehval, possibly after a Norwegian whaler named Meincke, who mistook a northern minke whale for a blue whale.[5]

Taxonomy[edit]

Most modern classifications split the minke whale into two species;

Taxonomists further categorize the common minke whale into two or three subspecies; the North Atlantic minke whale, the North Pacific minke whale and dwarf minke whale. All minke whales are part of the rorquals, a family that includes the humpback whale, the fin whale, the Bryde's whale, the sei whale and the blue whale.

The junior synonyms for B. acutorostrata are B. davidsoni (Cope 1872), B. minimia (Rapp, 1837) and B. rostrata (Fabricius, 1780). There is one synonym for B. bonaerensis - B. huttoni (Gray 1874).

Writing in his 1998 classification, Rice recognized two of the subspecies of the common minke whale - B. a. scammoni (Scammon's minke whale) and a further (taxonomically) unnamed subspecies found in the Southern Hemisphere, the dwarf minke whale (first described by Best, 1985).[7]

On at least one occasion, an Antarctic minke whale has been confirmed migrating to the Arctic.[8][9] In addition, at least two wild hybrids between a common minke whale and an Antarctic minke whale have been confirmed.[8][9][10]

Description[edit]

Minke whale skeleton, Museum Koenig, University of Bonn.

The minke whales are the second smallest baleen whale; only the pygmy right whale is smaller. Upon reaching sexual maturity (6–8 years of age), males measure an average of 6.9 m (23 ft) and females 7.4 m (24 ft) in length, respectively. Reported maximum lengths vary from 9.1 to 10.7 m (30 to 35 ft) for females and 8.8 to 9.8 m (29 to 32 ft) for males. Both sexes typically weigh 4–5 t (3.9–4.9 long tons; 4.4–5.5 short tons) at sexual maturity, and the maximum weight may be as much as 10 t (9.8 long tons; 11 short tons).

The minke whale is a black/gray/purple color. Common minke whales (Northern Hemisphere variety) are distinguished from other whales by a white band on each flipper. The body is usually black or dark-gray above and white underneath. Minke whales have between 240 and 360 baleen plates on each side of their mouths. Most of the length of the back, including dorsal fin and blowholes, appears at once when the whale surfaces to breathe.

Minke whales typically live for 30–50 years; in some cases they may live for up to 60 years.

The brains of minke whales have around 12.8 billion neocortical neurons and 98.2 billion neocortical glia.[11]

Behavior[edit]

Multimedia relating to the minke whale
Note that whale calls have been sped up to 10x their original speed.

Problems playing this file? See media help.

The whale breathes three to five times at short intervals before 'deep-diving' for two to 20 minutes. Deep dives are preceded by a pronounced arching of the back. The maximum swimming speed of minkes has been estimated at 38 km/h (24 mph).

Reproduction[edit]

The gestation period for minke whales is 10 months, and calves measure 2.4 to 2.8 m (7.9 to 9.2 ft) at birth. The newborns nurse for five to 10 months. Breeding peaks during the summer months. Calving is thought to occur every two years.[12]

Population and conservation status[edit]

The IUCN Red List labels the common minke whale as Least Concern.[13] The Antarctic minke whale is listed as Data Deficient.[14]

COSEWIC puts both species in the Not At Risk category [1]. NatureServe lists them as G5 which means the species is secure on global range [2].

In 2012, the Scientific Committee of the International Whaling Commission agreed upon a population estimate of 515,000 for the Antarctic minke stock.[15] The Scientific Committee acknowledged that this estimate is subject to a negative bias because some minke whales would have been outside the surveyable ice edge boundaries.

Whaling[edit]

Main article: Whaling
Line chart that shows catches peak at >4,000 in the 1950s, decline to 0 in the late eighties and increase to >1,000 by 2006
Norwegian minke whale quotas (blue line, 1994-2006) and catches (red line, 1946-2005) in numbers (From Norwegian official statistics)

Whaling was mentioned in Norwegian written sources as early as the year 800, and hunting minke whales with harpoons was common in the 11th century[citation needed]. In the 19th century, they were considered too small to chase, and received their name from a young Norwegian whale-spotter in the crew of Svend Foyn, who harpooned one, mistaking it for a blue whale and was derided for it.[16]

By the end of the 1930s, they were the target of coastal whaling by Brazil, Canada, China, Greenland, Japan, Korea, Norway, and South Africa. Minke whales were not then regularly hunted by the large-scale whaling operations in the Southern Ocean because of their relatively small size. However, by the early 1970s, following the overhunting of larger whales such as the sei, fin, and blue whales, minkes became a more attractive target of whalers. By 1979, the minke was the only whale caught by Southern Ocean fleets. Hunting continued apace until the general moratorium on whaling began in 1986.

Following the moratorium, most hunting of minke whales ceased. Japan continued catching whales under the special research permit clause in the IWC convention, though in significantly smaller numbers. The stated purpose of the research is to establish data to support a case for the resumption of sustainable commercial whaling. Environmental organizations and several governments contend that research whaling is simply a cover for commercial whaling. The 2006 catch by Japanese whalers included 505 Antarctic minke whales.

Although Norway initially followed the moratorium, they had placed an objection to it with the IWC and resumed a commercial hunt of the Common minke whale in 1993. The quota for 2006 was set at 1,052 animals, but only 546 were taken.[17] The quota for 2011 is set at 1286.[18] In August 2003, Iceland announced it would start research catches to estimate whether the stocks around the island could sustain hunting. Three years later, in 2006, Iceland resumed commercial whaling.

A 2007 analysis of DNA fingerprinting of whale meat estimated South Korean fishermen caught 827 minke between 1999 and 2003,[19] approximately twice the officially reported number. This raised concerns that some whales were being caught deliberately.

Whale watching[edit]

Photo of whale poking its nose through hole in icepack
Minke whale in the Ross Sea

Due to their relative abundance, minke whales are often the focus of whale-watching cruises setting sail from, for instance, the Isle of Mull in Scotland, County Cork in Ireland and Húsavík in Iceland, and tours taken on the east coast of Canada. They are also one of the most commonly sighted whales seen on whale-watches from New England and eastern Canada. In contrast to humpback whales, minkes do not raise their flukes out of the water when diving and are less likely to breach (jump clear of the sea surface). This, combined with the fact that minkes can stay submerged for as long as 20 minutes, has led some whale-watchers to label them 'stinky minkes'.[20]

In the northern Great Barrier Reef (Australia), a swim-with-whales tourism industry has developed based on the June/July migration of dwarf minke whales. A limited number of reef tourism operators (based in Port Douglas and Cairns) have been granted permits by the Great Barrier Reef Marine Park Authority to conduct these swims, given strict adherence to a code of practice, and that operators report details of all sightings as part of a monitoring program. Scientists from James Cook University and the Museum of Tropical Queensland have worked closely with participating operators and the Authority, researching tourism impacts and implementing management protocols to ensure these interactions are ecologically sustainable.

Minke whales are also occasionally sighted in Pacific waters, in and around the San Juan Islands of Washington State.

References[edit]

  1. ^ Arnason, U., Gullberg A. & Widegren, B. (1993). "Cetacean mitochondrial DNA control region: sequences of all extant baleen whales and two sperm whale species". Molecular Biology and Evolution 10 (5): 960–970. PMID 8412655. Retrieved 2007-07-13. 
  2. ^ It had been inaccurately described by the Danish zoologist Johan Christian Fabricius in 1780, who assumed it must be an already described species, assigned his specimen to Balaena rostrata, a name, however, that was already in use.
  3. ^ Lacepède, Histoire naturelle des cétacées. (Paris, 1804).
  4. ^ Modern orthography makes it Balaenoptera acutitostrata.
  5. ^ "Dictionary.com". Retrieved 2007-08-30. 
  6. ^ Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  7. ^ Best, P. (1985). "External characters of southern minke whales and the existence of a diminutive form". Scientific Reports of the Whales Research Institute 36: 1-33.
  8. ^ a b "Antarctic minke whales migrate to the Arctic" 5 (15). Whales On Line. February 3, 2011. Retrieved 2011-06-15. 
  9. ^ a b Glover, K., et al (2010). Migration of Antarctic Minke Whales to the Arctic 5 (12). PLoS ONE. doi:10.1371/journal.pone.0015197. Retrieved 2011-06-15. 
  10. ^ Glover, K. A., Kanda, N., Haug, T., Pastene, L. A., Øien, N., Seliussen, B. B., Sørvik, A. G. E., and Skaug, H. J. (2013). "Hybrids between common and Antarctic minke whales are fertile and can back-cross". BMC genetics 14 (1): 1-11.
  11. ^ N. Eriksen, Bente Pakkenberg (January 2007). "Total neocortical cell number in the mysticete brain". Anat. Rec. 290 (1): 83–95. doi:10.1002/ar.20404. PMID 17441201. 
  12. ^ http://www.acsonline.org/factpack/MinkeWhale.htm American Cetacean Society: Minke Whale
  13. ^ http://www.iucnredlist.org/details/2474/0
  14. ^ http://www.iucnredlist.org/details/2480/0
  15. ^ http://iwc.int/cache/downloads/6r8jq8llm4cgso0sc0k000w8c/2012%20SC%20REP.pdf
  16. ^ Joseph Horwood, Biology and exploitation of the minke whale (CRC Press) 1989:3.
  17. ^ Tok bare halve hvalkvoten - lofotposten.no
  18. ^ Samme hvalkvote som i år - www.p4.no
  19. ^ Aldhous, Peter (10 May 2007). "High value of whale meat costs minkes in Korea". New Scientist 194 (2603): 10. doi:10.1016/S0262-4079(07)61160-9. 
  20. ^ Look out, it's Stinky Minke - there she blows!, independent.co.uk, July 31, 2005
General references
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Antarctic minke whale

The Antarctic minke whale or southern minke whale (Balaenoptera bonaerensis) is a species of minke whale within the suborder of baleen whales. It is the second smallest rorqual after the common minke whale and the third smallest baleen whale. Although first scientifically described in the mid-19th century, it wasn't recognized as a distinct species until the 1990s. Once ignored by whalers due to its small size and low oil yield, it is now one of the mainstays of the whaling industry alongside its cosmopolitan counterpart the common minke. It is the most abundant baleen whale in the world, numbering in the hundreds of thousands. It is primarily restricted to the Southern Hemisphere (although vagrants have been reported in the North Atlantic) and feeds mainly on euphausiids.

Taxonomy[edit]

History[edit]

In February 1867, a fisherman found an estimated 9.75 m (32 ft) male rorqual floating in the Río de la Plata near Belgrano, about ten miles from Buenos Aires, Argentina. After bringing it ashore he brought it to the attention of the German Argentine zoologist Hermann Burmeister, who described it as a new species, Balaenoptera bonaerensis, the same year.[3] The skeleton of another specimen, a 4.7 m (15.5 ft) individual taken off Otago Head, South Island, New Zealand, in October 1873, was sent by Professor Frederick Wollaston Hutton, keeper of the Otago Museum in Dunedin, to the British Museum in London, where it was examined by the British zoologist John Edward Gray, who described it as a new species of "pike whale" (minke whale, B. acutorostrata) and named it B. huttoni.[4][5] Both descriptions were largely ignored for a century.

Gordon R. Williamson was the first to describe a dark-flippered form in the Southern Hemisphere, based on three specimens, a pregnant female taken in 1955 and two males taken in 1957, all brought aboard the British factory ship Balaena. All three had uniformly pale gray flippers and bicolored baleen, with white plates in the front and gray plates in the back.[6] In the 1970s osteological and morphological studies suggested it was at least a subspecies of the common minke whale, which was designated B. a. bonaerensis, after Burmeister's specimen.[7][8] In the 1980s further studies based on external appearance and osteology suggested there were in fact two forms in the Southern Hemisphere, a larger form with dark flippers and a "diminutive" or "dwarf form" with white flippers, the latter of which appeared to be more closely related to the common form of the Northern Hemisphere.[9][10] This was strengthened by genetic studies using allozyme and mitochondrial DNA analyses, which proposed there were at least two species of minke whale, B. acutorostrata and B. bonaerensis, with the dwarf form being more closely related to the former species.[11][12][13][14] One study, in fact, suggested that sei whales and the offshore form of Bryde's whale were more closely related to one another than either species of minke whale were to each other.[11] The American scientist Dale W. Rice supported these conclusions in his seminal work on marine mammal taxonomy, giving what he called the "Antarctic minke whale" (B. bonaerensis, Burmeister, 1867), full specific status[15] – this was followed by the International Whaling Commission a few years later. Other organizations followed suit.

Divergence[edit]

Antarctic and common minke whales diverged from each other in the Southern Hemisphere 4.7 million years ago, during a prolonged period of global warming in the early Pliocene which disrupted the Antarctic Circumpolar Current and created local pockets of upwelling, facilitating speciation by fragmenting populations.[16]

Hybrids[edit]

There have been two confirmed hybrids between Antarctic and common minke whales. Both were caught in the northeastern North Atlantic by Norwegian whaling vessels. The first, an 8.25 m (27 ft) female taken off western Spitsbergen (78°02' N, 11°43' E) on 20 June 2007, was the result of a pairing between a female Antarctic minke and a male common minke. The second, a pregnant female taken off northwestern Spitsbergen (79°45' N, 9°32' E) on 1 July 2010, on the other hand, had a common minke mother and an Antarctic minke father. Her female fetus, in turn, was fathered by a North Atlantic common minke, demonstrating that back-crossing is possible between hybrids of the two species.[17][18]

Description[edit]

Size[edit]

The Antarctic minke is among the smallest of the baleen whales, with only the common minke and the pygmy right whale being smaller. The longest caught off Brazil were an 11.9 m (39 ft) female taken in 1969 and an 11.27 m (37 ft) male taken in 1975, the former four feet longer than the second longest females and the latter five feet longer than the second longest males.[19] Off South Africa, the longest measured were a 10.6 m (35 ft) female and a 9.7 m (32 ft) male.[20] The heaviest caught in the Antarctic were a 9 m (29.5 ft) female that weighed 10.4 metric tons[21] and an 8.4 m (27.5 ft) male that weighed 8.8 metric tons.[22] At physical maturity, females average 8.9 m (29.3 ft) and males 8.6 m (28.2 ft). At sexual maturity, females average 8.1 m (26.6 ft) and males 7.6 m (24.9 ft). Calves are estimated to be 2.73 m (9 ft) at birth.[20]

External appearance[edit]

A pair of Antarctic minke whales showing their prominent, falcate dorsal fins
An Antarctic minke whale being slaughtered by the Japanese research vessel Yushin Maru for food, showing the coloration of the baleen

Like their close relative the common minke, the Antarctic minke whale is robust for its genus. They have a narrow, pointed, triangular rostrum with a low splashguard. Their prominent, upright, falcate dorsal fin – often more curved and pointed than in common minkes –is set about two-thirds the way along the back. About half of individuals have a light gray flare or patch on the posterior half of the dorsal fin, similar to that seen in species of dolphins in the genus Lagenorhynchus. They are dark gray dorsally and clean white ventrally. The lower jaw projects beyond the upper jaw and is dark gray on both sides.[23] Antarctic minkes lack the light gray rostral saddle present in the common and dwarf forms.[24] All individuals possess pale, thin blowhole streaks trailing from the blowhole slits, which first veer left and then right – particularly the right streak. These streaks appear to be more prominent and consistent on this species than on either the common or dwarf minke. Most also have a variably colored – light gray, light gray with dark edges, or simply dark – ear streak trailing behind the opening for the auditory meatus, which widens and becomes more diffuse posteriorly. A light gray variably shaped double chevron or W-shaped pattern (analogous to a similar pattern seen on their larger cousin the fin whale)[24] lies between the flippers. This broadens to form a light gray shoulder patch above the flippers. Like common and dwarf minkes, they have two light gray to whitish swaths, called the thorax and flank patches, the former running diagonally up from the axilla and diagonally down again to form a triangular intrusion into the dark gray of the thorax and the latter rising more vertically along its anterior edge and extending further dorsally before gradually sloping posteriorly to merge with the white of the ventral side of the caudal peduncle. A dark gray, roughly triangular thorax field separates the two, while a narrower dark gray shoulder infill separates the thorax patch from the shoulder patch. Two light gray, forward directed caudal chevrons extend from the dark gray field above, forming a whitish peduncle blaze between them. The smooth sided flukes, usually about 2.6 to 2.73 m (8.5 to 9 ft) wide, are dark gray dorsally and clean white (occasionally light gray to gray) ventrally with a thin, dusky margin. Some small, dark gray speckling may be present on the body.[9][25]

Antarctic minkes lack the bright white, transverse flipper band of the common minke and the white shoulder blaze and bright white flipper patch (occupying the proximal two-thirds of the flipper) of the dwarf minke. Instead, their narrow, pointed flippers, about one-sixth to one-eighth of the total body length, are normally either a plain light gray with an almost white leading edge and a darker gray trailing edge or two-toned, with a thin light gray or dark band separating the darker gray of the proximal third of the flipper from the lighter gray of the distal two-thirds. Unlike the dwarf minke, the dark gray between the eye and flipper does not extend unto the ventral grooves of the throat to form a dark throat patch; there is instead an irregularly shaped line running from about the level of the eye to the anterior insertion of the flipper, merging with the light gray of the shoulder patch.[9][10][24][25][26]

The longest baleen plates average 25 to 27 cm (10 to 10.5 inches) in length and about 12.5 to 13.5 cm (5 to 5.3 inches) in breadth and number 155 to 415 pairs (average 273). They are two-toned, with a dark gray outer margin on the posterior plates and a white outer margin on the anterior plates – though there may be some rows of dark plates amongst the white plates.[25] There is a degree of asymmetry, with a smaller number of white plates on the left side than on the right (12% on average for the left versus 34% on average for the right). The dark gray border occupies about one third of the width of the plates (ranging from about one-seventh to over half of its width), with the average width being greater on the left side than on the right. In contrast, dwarf minkes have smaller baleen plates of only 20 cm (8 in) in length, have a greater number of white plates (over 54%, often 100%) that lack this asymmetrical coloration, and have a narrow dark gray border (when present) of less than 6% of the width of the plate. Antarctic minkes have an average of 42 to 44 thin, narrow ventral grooves (range 32 to 70) that extend to about 48% of the length of the body – well short of the umbilicus.[9][27]

Distribution[edit]

Antarctic minke whale in Neko Harbour, Antarctica

Range[edit]

Antarctic minke whales occur throughout much of the Southern Hemisphere. In the western South Atlantic, they have been recorded off Brazil from 0°53’ N to 27°35’S (nearly year-round),[28][29][30] Uruguay,[28] off central Patagonia in Argentina (November-December),[31] and in the Strait of Magellan and Beagle Channel of southern Chile (February-March),[32] while in the eastern South Atlantic they have been recorded in the Gulf of Guinea off Togo,[33] off Angola,[34] Namibia (February),[35][36] and Cape Province, South Africa.[20] In the Indian and Pacific Oceans, they have been recorded off Natal Province, South Africa,[20] Réunion (July),[37] Australia (July-August),[10] New Zealand, New Caledonia (June),[38] Ecuador (2° S, October),[39] Peru (12°30’ S, September-October),[40] and the northern fjords of southern Chile.[41] Vagrants have been reported in Suriname – an 8.2 m (26.9 ft) female was killed 45 km (28 mi) upstream the Coppename River in October 1963[42] – and off Jan Mayen (June) in the northeastern North Atlantic.[17]

They appear to disperse into offshore waters during the breeding season. In the spring (October-December), Japanese sighting surveys from 1976 to 1987 recorded relatively high encounter rates of minke whales off South Africa and Mozambique (20° – 30° S, 30° – 40° E), off Western Australia (20° – 30° S, 110° – 120° E), around the Gambier Islands of French Polynesia (20° – 30° S, 130° – 140° W), and in the eastern South Pacific (10° – 20° S, 110° – 120° W).[43] Later surveys, which distinguished between Antarctic and dwarf minke whales, showed that most of these were Antarctic minke whales.[2]

They have a circumpolar distribution in the Southern Ocean (where they have been recorded year-round),[44] including the Bellingshausen, Scotia,[45] Weddell and Ross Seas.[46] They are most abundant in the MacKenzie Bay-Prydz Bay area (60° – 80° E, south of 66° S) and relatively numerous off Queen Maud Land (0° – 20° E, 66° – 70° S), in the Davis (80° – 100° E, south of 66° S) and Ross Seas (160° E – 140° W, south of 70° S), and in the southern Weddell Sea (20° – 40° W, south of 70° S).[47] Like their larger cousin the blue whale, they have a particular affinity for the pack ice. In the spring (October-November), they occur widely throughout the pack ice zone to near the edge of the fast ice, where they have been observed between belts of pack ice and in leads and polynyas – often in heavy ice cover.[48] Some individuals have become trapped in the ice and were forced to overwinter in the Antarctic – for example, up to 120 "lesser rorquals" were trapped in a small breathing hole with sixty killer whales and an Arnoux's beaked whale in Prince Gustav Channel, east of the Antarctic Peninsula and west of James Ross Island, in August 1955.[49]

Migration and movements[edit]

Two Antarctic minke whales marked with "Discovery tags" – 26 cm (10.5 inch) stainless steal tubes with an inscription and number engraved on them – in the Southern Ocean during the austral summer (January) were recovered a few years later off northeastern Brazil (6° – 7° S, 34° W) during the austral winter (July and September, respectively). The first was marked off Queen Maud Land (69° S, 19° E) and the second southeast of the South Orkney Islands (62° S, 35° W). Over twenty individuals marked with these Discovery tags showed large-scale movements around the Antarctic continent, each moving more than 30 degrees of longitude – two, in fact, had moved over 100 degrees of longitude. The first was marked off the Adélie Coast (141° E, 66° S) and recovered the following season off the Princess Ragnhild Coast (26° E, 68° S), a minimum of 114 degrees of longitude. The second was marked north of Cape Adare (172° E, 68° S) and recovered nearly six years later northwest of the Riiser-Larsen Peninsula (32° E, 68° S), a minimum of over 139 degrees of longitude. Both were marked and recovered in January.[50]

On 20 January 1972, a 49.5 cm (19.5 inch) broken-off bill of a marlin (Makaira sp.) was found embedded in the rostrum of a minke whale caught in the Southern Ocean at 64°06' S, 87°14' E, providing indirect evidence of migration to the warmer tropical or subtropical waters of the Indian Ocean.[51]

Population[edit]

Earlier estimates suggested that there were several hundred thousand minke whales in the Southern Ocean.[52][53] In 2012, the Scientific Committee of the International Whaling Commission agreed upon a best estimate of 515,000. The Report of the Scientific Committee acknowledged that this estimate is subject to some degree of negative bias because some minke whales would have been outside the surveyable ice edge boundaries.[54]

Biology[edit]

Natural history[edit]

Antarctic minke whales become sexually mature at 5 to 8 years of age for males and 7 to 9 years of age for females. Both become physically mature at about 18 years of age. After a gestation period of about 10 months, a single calf of 2.73 m (9 ft) is born – twin and triplet fetuses have been reported, but are rare. After a lactation period of about six months, the calf is weaned at a length of 4.6 m (15 ft). The calving interval is estimated to be about 12.5 to 14 months. Peak calving is from May to June, while peak conception is from August to September. Females may live up to 43 years of age.[20][55][56]

Prey[edit]

Antarctic minke whales feed almost exclusively on euphausiids. In the Southern Ocean, over 90% of individuals fed on Antarctic krill (Euphausia superba); E. crystallorophias also formed an important part of the diet in some areas, particularly in the relatively shallow waters of Prydz Bay. Rare and incidental items include calanoid copepods, the pelagic amphipod Themisto gaudichaudii, Antarctic sidestripes (Pleuragramma antarcticum), the crocodile icefish Cryodraco antarcticus, nototheniids, and myctophids.[57][58][59] The majority of individuals examined off South Africa had empty stomachs. The few that did have food in their stomachs had all preyed on euphausiids, mainly Thysanoessa gregaria and E. recurva.[20]

Predation[edit]

Antarctic minke whales are the main prey item of Type A killer whales in the Southern Ocean.[60] Their remains have been found in the stomachs of killer whales caught by the Soviets,[61] while individuals caught by the Japanese exhibited damaged flippers with tooth rake scars and parallel scarring on the body suggestive of killer whale attacks.[20] Large groups of killer whales have also been observed chasing, attacking, and even killing Antarctic minke whales.[46][60][62][63] Most attacks involve Type A killer whales, but on one occasion, in January 2009, a group of ten Type B or pack ice killer whales, which normally preyed on Weddell seals in the area by wave-washing them off ice floes, were observed to attack, kill, and feed on a juvenile Antarctic minke whale in Laubeuf Fjord, between Adelaide Island and the Antarctic Peninsula.[64]

Parasites and epibiotics[edit]

Little has been published on the parasitic and epibiotic fauna of Antarctic minke whales. Individuals were often found with orange-brown to yellowish patches of the diatom Cocconeis ceticola on their bodies – 35.7% off South Africa and 67.5% in the Antarctic. Of a sample of whales caught by a Japanese expedition along the ice edge, one-fifth was infested with cyamids (those from one whale were identified as Cyamus balaenopterae). Several hundred of these whale lice can be found on a single whale, with an average of 55 per individual – most are found at the end of the ventral grooves and around the umbilicus. The copepod Pennella was found on only one whale. Cestodes were commonly found in the intestines (one example was identified as Tetrabothrius affinis).[20]

Behavior[edit]

Group size and composition[edit]

Antarctic minke whales are more gregarious than their smaller counterparts, the common and dwarf minke whale. The average group size in the Antarctic was about 2.4 (adjusted downwards for observer bias), with about a quarter of the sightings consisting of singles and one-fifth of pairs; the largest aggregation consisted of 60 individuals.[65] Off South Africa, the average group size was about two, with singles (nearly 46%) and pairs (31%) being the most common – the largest was 15.[20] Off Brazil, most sightings were of singles (32.6%) or pairs (31.5%), with the largest group consisting of 17 individuals.[19]

Like common minke whales, Antarctic minkes exhibit a great deal of spatial and temporal segregation by sex, age class, and reproductive condition. Off South Africa, immature animals predominate from April to May, while mature whales (mainly males) dominate from June onwards – in August and September mature males often accompany cow-calf pairs.[20] Off Brazil, a good proportion of the individuals are immature (particularly for females) in July and August, but by September most are mature, and by October and November nearly all are mature.[27] Females outnumber males two to one off Brazil, while the opposite is true off South Africa, where males outnumber females nearly two to one. Over a quarter of the females off South Africa were found to be lactating, whereas lactating females are very rare in the Antarctic – though a cow-calf pair was observed in the austral winter (August) in the Lazarev Sea.[44] In the sub-Antarctic and Antarctic, immature animals are normally solitary and occur in lower latitudes further offshore, while mature whales are typically found in mixed groups (usually one sex outnumbers the other, and groups composed solely of males or females are occasionally found) and occur in higher latitudes. Mature males dominate in middle latitudes, while mature females predominate in the higher latitudes of the pack ice zone – from two-thirds to three-quarters of the whales in the Ross Sea consist of pregnant females.[21][66][67][68][69][70][71][72]

An immature Antarctic minke whale was observed briefly associating with four dwarf minke whales on the Great Barrier Reef in July 2000.[24]

Unlike common minke whales, they often have a prominent blow, which is particularly visible in the calmer waters near the pack ice.[65] In the narrow holes and cracks in the pack ice they have been observed spyhopping – raising their head vertically – to expose their blowholes to breathe; individuals have even been seen to break breathing holes through sea ice in the winter (July-August), rising in a similar manner.[44][46][48] When traveling fast in open water they can create larger versions of the "roostertail" of spray created by their smaller cousin, the Dall's porpoise.[23] During bouts of feeding they will lunge multiple times onto their side (either left or right) into a dense patch of prey with mouth agape and ventral pleats expanded as their gular pouch fills with prey-laden water. After making a series of shorter dives during which they will surface anywhere from two to fifteen times, they will make a longer dive of up fourteen minutes.[46] Shallower dives of normally less than 40 m (131 ft) are made at night (from about 8 p.m. to about 2 a.m.) while deeper dives that can be over 100 m (328 ft) deep are made during the day (from about 2 a.m. to about 8 p.m.).[73]

Vocalizations[edit]

Antarctic minke whales produce a variety of sounds, including whistles, calls reminiscent of a clanging bell, clicks, screeches, grunts, downsweeps,[46] and a sound called bioduck.[73] Downsweeps are intense, low frequency calls that sweep down from about 130 to 115 Hz to about 60 Hz,[74] with a peak frequency of 83 Hz. Each sweep has a duration of 0.2 seconds and an average source level of about 147 decibels at a reference pressure of one micropascal at one metre. The bio-duck call, first described in the 1960s and named by sonar operators on Oberon-class submarines for its purported resemblance to the quack of a duck, consist of a series of anywhere from three to a dozen pulse trains that range from 50 to 200 Hz and have a peak frequency of about 154 Hz – they sometimes also possess harmonics of up to 1 kHz. They are repeated about every 1.5 to 3 seconds and have a source level of 140 decibels at a reference pressure of one micropascal at one metre. Their source remained a mystery for decades until attributed to the Antarctic minke whale in a paper published in 2014 – though it had been suggested to originate from this species as early as the mid-2000s.[75] It has been recorded in the Ross and Lazarev Seas, over Perth Canyon, off Western Australia from late June to early December,[76] and in the King Haakon VII Sea from April to December.[77] The sound seems to be made near the surface before foraging dives, but nothing is known of its function.[73][78]

Whaling[edit]

Main article: Whaling

The barque Antarctic, sent by whaling pioneer Svend Foyn and led by Henrik Johan Bull, managed to harpoon at least three minke whales in the Antarctic between December 1894 and January 1895. Two were saved, both being used for fresh meat (one had only yielded two barrels of blubber).[79] In December 1923, when the men of the first modern whaling expedition to visit the Ross Sea saw "a number of spouts" after leaving the ice edge they were soon disgusted to find out that they from lowly minke whales.[80] The few caught by the British in the 1950s were taken more for curiosity than anything else. The chemist Christopher Ash, who had served on the British factory ship Balaena during this time, stated that they were small enough to be lifted by their tails using a 10-ton spring balance and weighed entire. "Generally this is done when there are no other whales about and the deck empty except for a crowd of sightseers," Ash explained, "but this crowd quickly scatters when the whale is just hanging free and starts to spin around and swing from side to side, as it almost always does." Like Bull before him, Ash commented on their meat, which he described as "fine-textured in comparison with the other whales, and if properly cooked almost indistinguishable from beef."[81]

They were primarily exploited for this very reason – their high quality meat – in later years, which fetched as much as two dollars a pound in 1977.[82] With the larger blue, fin, and sei whales depleted, whaling nations focused their attention on the smaller, but more numerous, minke whales. Though the Soviets had caught several hundred in the 1950s, it was not until 1971-72 that a significant catch was made, with over 3,000 being taken (nearly all by a single Japanese expedition).[83] Not wanting to repeat the same mistakes it had made with previous species, the International Whaling Commission set a quota of 5,000 for the following season, 1972-73. Despite these precautions, the quota was exceeded by 745 – later quotas would be as high as 8,000.[84]

During the commercial whaling era, from 1950-51 to 1986-87, 97,866 minke whales (the vast majority probably Antarctic minkes) were caught in the Southern Ocean – mainly by the Japanese and Soviets – with a peak of 7,900 being reached in 1976-77.[85] Harpoon guns of lesser caliber and "cold harpoons" (harpoons without explosive shells) had to be used due to their small size, while no air was pumped into the carcasses when they were tied alongside for towing to ensure the greatest quality of meat.[82][86] While an expedition or two was fitted out each year specifically for minke whales – the Jinyo Maru in 1971-72, the Chiyo Maru from 1972-73 to 1974-75, and the Kyokusei Maru in 1973-74 – most expeditions, which targeted other species, ignored minkes during the peak of the whaling season (November-December and late February to early March) and only caught them on whaling grounds relatively close to those of larger ones – the minke whaling grounds were much further south (south of 60° S) than those for fin and sei whales.[83][87][88]

From 1987 to the present, Japan has been sending a fleet consisting of a single factory ship and several catcher/spotting vessels to the Southern Ocean to catch Antarctic minkes under Article VIII of the IWC, which allows the culling of whales for scientific research. The first research program, Japanese Research Program in the Antarctic (JARPA), began in 1987-88, when 273 Antarctic minkes were caught. The quota and catch soon increased to 330 and 440. In 2005-06, the second research program, JARPA II, began. In its first two years, in what Japan called its "feasibility study", 850 Antarctic minkes, as well as 10 fin whales, were to be taken each season (2005–06 and 2006–07). The quota was reached in the first season, but due to a fire, only 508 Antarctic minkes were caught in the second. In 2007-08, because of constant harassment from environmental groups, they failed to reach the quota again, with a catch of only 551 whales.

Beginning in 1968, larger numbers of minke whales were caught off Natal, South Africa, mainly to supplement the dwindling supply of larger species, particularly the sei whale. A total of 1,113 whales (nearly all Antarctic minke, but a few dwarf minke as well) were caught off the province between 1968 and 1975, with a peak of 199 in 1971. They were taken by whale catchers of 539 to 593 gross tons with 90 mm harpoon guns mounted on their bows, which brought them to the whaling station at Durban (29°53' S, 31°03' E) for processing. Gunners refused to take minkes early in the day, because sharks devoured any minke carcasses that were flagged, forcing the catchers to tow them during the chasing of other whales and thus slowing them down. They also couldn't use asdic, as it frightened them and lead to protracted chases. The season lasted from February to September, with a peak in the last month of the season.[20][89]

In 1966, minke whales became the target of whaling operations off northeastern Brazil (6° – 8° S) due, once again, to the decline of sei whales. Over 14,000 were caught between 1949 and 1985, with a peak of 1,039 in 1975. They were caught by a succession of whale catchers – the 367-ton Koyo Maru 2 (1966–1971), the 306-ton Seiho Maru 2 (1971–1977), and the 395-ton Cabo Branco (also called Katsu Maru 10, 1977–1985) – up to 100 miles offshore and brought to the whaling station at Costinha, operated by the Compania de Pesca Norte do Brasil (COPESBRA) since 1911. The season lasted from June to December, with a peak in either September or October.[27][90][91]

An 8.2 m (26.9 ft) male Antarctic minke whale (confirmed by genetics) was caught west of Jan Mayen (70°57' N, 8°51' W) in the northeastern North Atlantic on 30 June 1996.[17]

Other mortality[edit]

Entanglement in fishing gear and probably ship strikes are other sources of mortality. The former have been reported off Peru and Brazil, and the latter off South Australia. All involved calves or juveniles.[28][40][92]

Conservation status[edit]

The Antarctic minke whale is currently considered Data Deficient by the IUCN red list. However, the IUCN states that the population size is "clearly in the hundreds of thousands".[2]

The Antarctic minke whale is listed on Appendix II [93] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). It is listed on Appendix II[93] as it has an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements.

In addition, the Antarctic minke whale is covered by the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region.[94]

See also[edit]

References[edit]

  1. ^ Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). Balaenoptera bonaerensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 7 October 2008.
  3. ^ Burmeister, H. (1867). "Preliminary description of a new species of finner whale (Balaenoptera bonaerensis)". Proceedings of the Zoological Society of London: 707-713.
  4. ^ Gray, J.E. (1874). "On a New-Zealand whale (Physalus antarcticus, Hutton), with notes". Annals and Magazine of Natural History 13: 316-318.
  5. ^ Gray, J.E. (1874). "On the skeleton of the New-Zealand pike whale, Balaenoptera huttoni (Physalus antarcticus, Hutton)". Annals and Magazine of Natural History 13: 448-453.
  6. ^ Williamson, G. R. (1959). "Three unusual rorqual whales from the Antarctic". In Proceedings of the Zoological Society of London 133 (1): 135-144.
  7. ^ Omura, H. (1975). "Osteological study of the minke whale from the Antarctic". Scientific Reports of the Whales Research Institute 27: 1-36.
  8. ^ Rice, D. W. (1977). "A list of the marine mammals of the world". NOAA Tech. Rep. 711: 1-15.
  9. ^ a b c d Best, P. (1985). "External characters of southern minke whales and the existence of a diminutive form". Scientific Reports of the Whales Research Institute 36: 1-33.
  10. ^ a b c Arnold, P., Marsh, H. and Heinsohn, G. (1987). "The occurrence of two forms of minke whales in east Australian waters with a description of external characters and skeleton of the diminutive or dwarf form". Scientific Reports of the Whales Research Institute 38: 1-46.
  11. ^ a b Wada, S., and Numachi, K. I. (1991). "Allozyme analyses of genetic differentiation among the populations and species of the Balaenoptera". Genetic ecology of whales and dolphins. Reports of the International Whaling Commission (Special Issue 13): 125-154.
  12. ^ Wada, S., Kobayashi, T., and Numachi, K. I. (1991). "Genetic variability and differentiation of mitochondrial DNA in minke whales". Genetic ecology of whales and dolphins. Reports of the International Whaling Commission (Special Issue 13): 203-215.
  13. ^ Árnason, Ú., Gullberg, A. and Widegren, B. (1993). "Cetacean mitochondrial DNA control region: sequences of all extant baleen whales and two sperm whale species". Molecular Biology and Evolution 10 (5): 960-970.
  14. ^ Pastene, L. A., Fujise, Y., and Numachi, K. I. (1994). "Differentiation of mitochondrial DNA between ordinary and dwarf forms of southern minke whale". Reports of the International Whaling Commission 44: 277-281.
  15. ^ Rice D. W. (1998). Marine Mammals of the World: Systematics and Distribution. Society for Marine Mammalogy Special Publication 4: 1–231.
  16. ^ Pastene, L. A., Goto, M., Kanda, N., Zerbini, A. N., Kerem, D. A. N., Watanabe, K., Bessho, Y., Hasegawa, M, Nielsen, R., Larsen, F., and Palsböll, P. J. (2007). "Radiation and speciation of pelagic organisms during periods of global warming: the case of the common minke whale, Balaenoptera acutorostrata". Molecular Ecology 16 (7): 1481-1495.
  17. ^ a b c Glover, K. A., Kanda, N., Haug, T., Pastene, L. A., Øien, N., Goto, M., Seliussen, B. B., and Skaug, H. J. (2010). "Migration of Antarctic minke whales to the Arctic". PLoS One 5 (12): 1-6.
  18. ^ Glover, K. A., Kanda, N., Haug, T., Pastene, L. A., Øien, N., Seliussen, B. B., Sørvik, A. G. E., and Skaug, H. J. (2013). "Hybrids between common and Antarctic minke whales are fertile and can back-cross". BMC genetics 14 (1): 1-11.
  19. ^ a b Da Rocha, J. M. and Braga, N. M. A. (1982). "Brazil Progress Report on cetacean research, June 1980 to May 1981". Reports of the International Whaling Commission 32: 155-159.
  20. ^ a b c d e f g h i j k Best, P. B. (1982). "Seasonal abundance, feeding, reproduction, age and growth in minke whales off Durban (with incidental observations from the Antarctic)". Reports of the International Whaling Commission 32: 759-786.
  21. ^ a b Fujise, Y., Ishikawa, H., Saino, S., Nagano, M., Ishii, K., Kawaguchi, S., Tanifuji, S., Kawashima, S., and Miyakoshi, H. (1993). "Cruise report of the 1991/92 Japanese research in Area IV under a special permit for Southern Hemisphere minke whales". Reports of the International Whaling Commission 43: 357-371.
  22. ^ Lockyer, C. (1976). "Body weights of some species of large whales". J. Cons. int. Explor. Mer 36 (3): 259-273.
  23. ^ a b Jefferson, Thomas, Marc A. Webber, and Robert L. Pitman (2008). Marine Mammals of the World: A Comprehensive Guide to their Identification. London: Academic. ISBN 9780123838537. OCLC 272382231. 
  24. ^ a b c d Arnold, P. W., Birtles, R. A., Dunstan, A., Lukoschek, V., and Matthews, M. (2005). "Colour patterns of the dwarf minke whale Balaenoptera acutorostrata sensu lato: description, cladistic analysis and taxonomic implications". Memoirs of the Queensland Museum 51: 277-307.
  25. ^ a b c Bushuev, S. G., and Ivashin, M. V. (1986). "Variation of colouration of Antarctic minke whales". Reports of the International Whaling Commission 36: 193-200.
  26. ^ Wada, S., and Numachi, K. (1979). "External and biochemical characters as an approach to stock identification for the Antarctic minke whale". Reports of the International Whaling Commission 29: 421-32.
  27. ^ a b c Da Rocha, J. (1980). "Progress report on Brazilian minke whaling". Reports of the International Whaling Commission 30: 379-84.
  28. ^ a b c Zerbini, A. N., Secchi, E. R., Siciliano, S., and Simões-Lopes, P. C. (1997). "A review of the occurrence and distribution of whales of the genus Balaenoptera along the Brazilian coast". Reports of the International Whaling Commission 47: 407-417.
  29. ^ Meirelles, A. C. O., and Furtado-Neto, M. A. A. (2004). "Stranding of an Antarctic minke whale, Balaenoptera bonaerensis (Burmeister, 1867), on the northern coast of South America". Latin American Journal of Aquatic Mammals 3 (1): 81-82.
  30. ^ Siciliano, S., Emin-Lima, R., Rodrigues, A.L.F., de Sousa e Silva Jr. J., Scholl, T.G.S. and Moura de Oliveira, J. (2011). "Antarctic minke whales (Balaenoptera bonaerensis) near the Equator". Document SC/63/IA2 submitted to the IWC Scientific Committee's 63rd annual meeting.
  31. ^ Reyes, L. M. (2006). "Cetaceans of central Patagonia, Argentina". Aquatic Mammals 32 (1): 20-30.
  32. ^ Acevedo, J., Aguayo-Lobo, A., Acuna, P., and Pastene, L. A. (2006). "A note on the first record of the dwarf minke whale (Balaenoptera acutorostrata) in Chilean waters". Journal of Cetacean Research and Management 8 (3): 293-296.
  33. ^ Segniagbeto, G. H., Van Waerebeek, K., Bouwessidjaou, J. E., Ketoh, K., Kpatcha, T. K., Okoumassou, K., and Ahoedo, K. (2014). "Annotated checklist and fisheries interactions of cetaceans in Togo, with evidence of Antarctic minke whale in the Gulf of Guinea". Integrative Zoology 9 (1): 1-13 (abstract only).
  34. ^ Weir, C. R. (2010). "A review of cetacean occurrence in West African waters from the Gulf of Guinea to Angola". Mammal Review 40 (1): 2-39.
  35. ^ Anonymous (February 21, 2014). "Minke whale saved at Walvis". The Namibian. Retrieved June 13, 2014. 
  36. ^ Anonymous (February 21, 2014). "Stranded Antarctic minke whale rescued in Walvis Bay". Travel News Namibia. Retrieved June 13, 2014. 
  37. ^ Dulau-Drouot, V., Boucaud, V., and Rota, B. (2008). "Cetacean diversity off La Réunion Island (France)". Journal of the Marine Biological Association of the UK 88 (6): 1263-1272.
  38. ^ Borsa, P. (2006). "Marine mammal strandings in the New Caledonia region, Southwest Pacific". Comptes Rendus Biologies 329: 277-288.
  39. ^ Felix, F., and B. Haase. (2013). "Northernmost record of the Antarctic minke whale (Balaenoptera bonaerensis) in the Eastern Pacific". Document SC/65a/IAO2 presented to the IWC Scientific Committee's 65th annual meeting.
  40. ^ a b Van Waerebeek, K. and Reyes, J. C. (1994). "A note on the incidental mortality of southern minke whales off western South America". Gillnets and cetaceans. Reports of the International Whaling Commission (Special Issue 15): 521-524.
  41. ^ Viddi, F. A., Hucke-Gaete, R., Torres-Florez, J. P., and Ribeiro, S. (2010). "Spatial and seasonal variability in cetacean distribution in the fjords of northern Patagonia, Chile". ICES Journal of Marine Science: Journal du Conseil 67 (5): 959-970.
  42. ^ Husson, A.M. (1978). The mammals of Suriname. E. J. Brill, Leiden.
  43. ^ Kasamatsu, F., Nishiwaki, S. and Ishikawa, H. (1995). "Breeding areas and southbound migrations of southern minke whales Balaenoptera acutorostrata". Marine Ecology Progress Series 119: 1-10.
  44. ^ a b c Scheidat, M. , Bornemann, H. , Burkhardt, E. , Flores, H. , Friedlaender, A. , Kock, K. H. , Lehnert, L. , van Franeker, J. and Williams, R. (2008). "Antarctic sea ice habitat and minke whales". Annual Science Conference in Halifax, 22 - 26 September, Halifax, Canada.
  45. ^ Sirovic, A., Hildebrand, J. A., and D. Thiele. (2006). "Baleen whales in the Scotia Sea during January and February 2003". Journal of Cetacean Research and Management 8 (2): 161-171.
  46. ^ a b c d e Leatherwood, S., Thomas, J. A., and Awbrey, F. T. (1981). "Minke whales off northwestern Ross Island". Antarctic Journal 16: 154-156.
  47. ^ Kasamatsu, F., Joyce, G., Ensor, P., and J. Mermoz. (1996). "Current occurrence of baleen whales in Antarctic waters". Reports of the International Whaling Commission 46: 293-304.
  48. ^ a b Ensor, P. H. (1989). "Minke whales in the pack ice zone, East Antarctica, during the period of maximum annual ice extent". Reports of the International Whaling Commission 39: 219-225.
  49. ^ Taylor, R. J. F. (1957). "An unusual record of three species of whale being restricted to pools in Antarctic sea-ice". In Proceedings of the Zoological Society of London 129 (3): 325-331 (abstract only).
  50. ^ Buckland, S. T. and Duff, E. I. (1989). "Analysis of southern hemisphere minke whale mark-recovery data". Reports of the International Whaling Commission (Special Issue 11): 121-143.
  51. ^ Ohsumi, S. (1973). "Find of a marlin spear from the Antarctic minke whales". Scientific Reports of the Whales Research Institute, Tokyo 25: 237-239.
  52. ^ Branch, T. A. and Butterworth, D. S. (2001). "Southern Hemisphere minke whales: standardized abundance estimates from the 1978/79 to 1997/98 IDCR-SOWER surveys". Journal of Cetacean Research and Management 3 (2): 143-174.
  53. ^ Branch, T. A. (2006). "Abundance estimates for Antarctic minke whales from three completed circumpolar sets of surveys, 1978/79 to 2003/04". Paper SC/58/IA18 submitted to the International Whaling Commission Scientific Committee, pp. 1-28.
  54. ^ International Whaling Commission. (2013). "Report of the Scientific Committee". Journal of Cetacean Research and Management 14 (Supplement): 1-86.
  55. ^ Masaki, Y. (1979). "Yearly change of the biological parameters for the Antarctic minke whale". Reports of the International Whaling Commission 29: 375-95.
  56. ^ Evans, Peter G. H. (1987). The Natural History of Whales and Dolphins. Facts on File.
  57. ^ Bushuev, S. G. (1986). "Feeding of minke whales, Balaenoptera acutorostrata, in the Antarctic". Reports of the International Whaling Commission 36: 241-245.
  58. ^ Bushuev, S. G. (1991). "Distribution and feeding of minke whales in Antarctic Area I". Reports of the International Whaling Commission 41: 303-312.
  59. ^ Kawamura, A. (1994). "A review of baleen whale feeding in the Southern Ocean". Reports of the International Whaling Commission 44: 261-271.
  60. ^ a b Pitman, R. L. and Ensor, P. (2003). "Three forms of killer whales (Orcinus orca) in Antarctic waters". Journal of Cetacean Research and Management 5 (2): 131-139.
  61. ^ Mikhalev, Y. A., Ivashin, M. V., Savusin, V. P., and Zelenaya, F. E. (1981). "The distribution and biology of killer whales in the Southern Hemisphere". Reports of the International Whaling Commission 31: 551-566.
  62. ^ Jefferson, T. A.; Stacey, P.J.; Baird, R.W. (1991). "A review of killer whale interactions with other marine mammals: predation to co-existence" (PDF). Mammal Review 21 (4): 151–180. doi:10.1111/j.1365-2907.1991.tb00291.x. 
  63. ^ Ford, J. K., and R. R. Reeves. (2008). "Fight or flight: antipredator strategies of baleen whales". Mammal Review 38 (1): 50-86.
  64. ^ Pitman, R. L., and Durban, J. W. (2012). "Cooperative hunting behavior, prey selectivity and prey handling by pack ice killer whales (Orcinus orca), type B, in Antarctic Peninsula waters". Marine Mammal Science 28 (1): 16-36.
  65. ^ a b Best, P. B., and Butterworth, D. S. (1980). "Report of the Southern Hemisphere minke whale assessment cruise, 1978/79". Reports of the International Whaling Commission 30: 257-283.
  66. ^ Kasamatsu, F. and Ohsumi, S. (1981). "Distribution pattern of minke whales in the Antarctic with special reference to the sex ratio in the catch". Reports of the International Whaling Commission 31: 345-348.
  67. ^ Shimadzu, Y. and Kasamatsu, F. (1983). "Operating pattern of Antarctic minke whaling by the Japanese expedition in 1981/82". Reports of the International Whaling Commission 33: 389-391.
  68. ^ Shimadzu, Y. and Kasamatsu, F. (1984). "Operating pattern of Antarctic minke whaling by the Japanese expedition in the 1982/83 season". Reports of the International Whaling Commission 34: 357-359.
  69. ^ Kasamatsu, F, and Shimadzu, Y. (1985). "Operating pattern of Antarctic minke whaling by the Japanese expedition in the 1983/84 season". Reports of the International Whaling Commission 35: 283-284.
  70. ^ Kato, H., Hiroyama, H., Fujise, Y. and Ono, K. (1989). "Preliminary report of the 1987/88 Japanese feasibility study of the special permit proposal for Southern Hemisphere minke whales". Reports of the International Whaling Commission 39: 235-248.
  71. ^ Kato, H., Fujise, Y., Yoshida, H., Nakagawa, S., Ishida, M. and Tanifuji, S. (1990). "Cruise report and preliminary analysis of the 1988/89 Japanese feasibility study of the special permit proposal for southern hemisphere minke whales". Reports of the International Whaling Commission 40: 289-300.
  72. ^ Kasamatsu, F., Yamamoto, Y., Zenitani, R., Ishikawa, H., Ishibashi, T., Sato, H., Takashima, K. and Tanifuji, S. (1993). "Report of the 1990/91 southern minke whale research cruise under scientific permit in Area V". Reports of the International Whaling Commission 43: 505-522.
  73. ^ a b c Risch, D.; Gales, N. J.; Gedamke, J.; Kindermann, L.; Nowacek, D. P.; Read, A. J.; Siebert, U.; Van Opzeeland, I. C.; Van Parijs, S. M.; Friedlaender, A. S. (2014). "Mysterious bio-duck sound attributed to the Antarctic minke whale (Balaenoptera bonaerensis)". Biology Letters 10 (4): 1–8. doi:10.1098/rsbl.2014.0175. 
  74. ^ Schevill, W. E., and Watkins, W. A. (1972). "Intense low-frequency sounds from an Antarctic minke whale, Balaenoptera acutorostrata". Breviora 388: 1-8.
  75. ^ Matthews, D., Macleod, R., and R. D. McCauley. (2004). "Bio-duck activity in the Perth Canyon: an automatic detection algorithm". In Proceedings of Acoustics 2004, 3–5 November 2004, Gold Coast, Australia, pp. 63–66.
  76. ^ McCauley, R., Bannister, J., Burton, C., Jenner, C., Rennie, S., and C. S. Kent. (2004). "Western Australian exercise area blue whale project: final summary report". CMST Report R2004–29, Project 350, 1-73.
  77. ^ Van Opzeeland, I., Van Parijs, S., Kindermann, L., and O. Boebel. (2010). "Seasonal patterns in Antarctic blue whale (Balaenoptera musculus intermedia) vocalizations and the bio-duck signal". In Acoustic ecology of marine mammals in polar oceans. Rep. Polar Mar. Res. 619: 251-278.
  78. ^ Morelle, Rebecca (April 22, 2014). "Mystery of 'ocean quack sound' solved". BBC News. Retrieved April 23, 2014. 
  79. ^ Bull, H. J. (1896). The cruise of the 'Antarctic' to the South Polar regions. London: Edward Arnold.
  80. ^ Ainley, D. G. (2010). "A history of the exploitation of the Ross Sea, Antarctica". Polar Record 46 (3): 233-243.
  81. ^ Ash, C. (1962). Whaler's Eye. George Allen and Unwin Ltd., London.
  82. ^ a b Tønnessen, J. and A. O. Johnsen. (1982). The history of modern whaling. University of California Press, Berkeley.
  83. ^ a b Shimadzu, Y., and Kasamatsu, F. (1981). "Operating pattern of Japanese whaling expeditions engaged in minke whaling in the Antarctic". Reports of the International Whaling Commission 31: 349-355.
  84. ^ Holt, S. (1981). "History of the regulation of southern minke whaling: scientific advice and a response of industry". Reports of the International Whaling Commission 31: 319-322.
  85. ^ Masaki, Y. and K. Yamamura. (1978). "Japanese whaling and whale sighting in the 1976/77 Antarctic season". Reports of the International Whaling Commission 28: 251-261.
  86. ^ Furukawa, F. (1981). "Minke whaling in the 34th Antarctic whaling season, 1979/80". Reports of the International Whaling Commission 31: 359-362.
  87. ^ Ohsumi, S. and Y. Masaki. (1974). "Status of whale stocks in the Antarctic, 1972/73". Reports of the International Whaling Commission 24: 102-113.
  88. ^ Masaki, Y. and Y. Fukuda. (1975). "Japanese pelagic whaling and sighting in the Antarctic, 1973/74". Reports of the International Whaling Commission 25: 106-128.
  89. ^ Best, P. (1974). "Status of whale stocks off Natal, 1972". Reports of the International Whaling Commission 24: 127-135.
  90. ^ Da Rocha, J. M. (1983). "Revision of Brazilian whaling data". Reports of the International Whaling Commission 33: 419-427.
  91. ^ Zahl, S. (1990). "Analysis of Brazilian minke whale data from 1966-85". Reports of the International Whaling Commission 40: 325-328.
  92. ^ Van Waerebeek, K., Baker, A. N., Félix, F., Gedamke, J., Iñiguez, M., Sanino, G. P., Secchi, E., Sutaria, D., van Helden, A., and Wang, Y. (2007). "Vessel collisions with small cetaceans worldwide and with large whales in the Southern Hemisphere, an initial assessment". Latin American Journal of Aquatic Mammals 6 (1): 43-69.
  93. ^ a b "Appendix I and Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.[dead link]
  94. ^ Official webpage of the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!