Articles on this page are available in 1 other language: Spanish (2) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tachuris rubrigastra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTACCTGATCTTCGGTGCCTGAGCAGGTATAATTGGCACCGCCCTGAGCCTTCTAATCCGAGCAGAGCTAGGACAACCAGGAACCCTTCTAGGAGATGATCAAATCTACAACGTAATCGTCACTGCTCATGCATTCGTAATAATCTTTTTTATAGTAATACCCATTATAATCGGGGGATTCGGCAACTGACTAGTACCTCTAATAATTGGCGCACCCGATATGGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTTCCCCCATCCTTCCTCCTCCTCTTGGCCTCCTCAACAGTAGAAGCTGGAGTTGGGACAGGATGAACCGTCTACCCACCACTAGCTGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTAGCTATCTTCTCACTTCACCTAGCAGGAGTTTCTTCAATCTTAGGGGCTATCAACTTCATCACCACAGCAATCAACATGAAACCACCCGCCCTATCACAGTACCAAACCCCCCTGTTCGTCTGATCTGTCCTAATTACTGCAGTCCTCCTCCTCCTATCTCTCCCAGTCCTTGCCGCAGGCATCACCATACTCCTCACAGACCGTAACCTAAACACCACATTCTTTGACCCAGCAGGAGGCGGAGACCCAATTTTATATCAACACCTCTTCTGATTTTTTGGCCACCCAGAAGTCTATATCCTCATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tachuris rubrigastra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Many-coloured rush tyrant

The many-coloured rush tyrant (Tachuris rubrigastra) or many-colored rush tyrant is a small passerine bird of South America belonging to the tyrant flycatcher family. It is the only member of the genus Tachuris and its relationships with the other members of the family are uncertain. It inhabits marshland and reedbeds around lakes and rivers. It is particularly associated with stands of Scirpus. The nest is built among plant stems.[2]

Taxonomy and systematics[edit]

There are four subspecies: T. r. rubrigastra is the most widespread, occurring from south-east Brazil to southern Argentina and central Chile. T. r. alticola is found in the Andes of south-east Peru, west Bolivia and north-west Argentina. T. r. libertatis is found in coastal Peru while T. r. loaensis is restricted to Antofagasta Region in northern Chile.

Description[edit]

Many-coloured rush tyrant nest

It is a small bird, 10.5 cm in length. The tail is short, the wings are short and rounded and the bill is slender. As the bird's name suggests, the plumage is very colourful. The back and rump are green while the underparts are yellow apart from the white throat, black breastband and red undertail-coverts. The face is dark blue-grey, there is a yellow stripe over the eye and the crown is dark with a red patch that is often concealed. The wings and tail are dark with a white wingbar and white outer tail-feathers. Juveniles are considerably duller than the adults.

References[edit]

  1. ^ BirdLife International (2012). "Tachuris rubrigastra". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Jaramillo, Alvaro; Burke, Peter & Beadle, David (2003) Field Guide to the Birds of Chile. Christopher Helm, London.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!