Articles on this page are available in 1 other language: Spanish (7) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Megarynchus pitangua

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACTTTCATTAATCGATGATTATTTTCAACAAACCATAAAGATATCGGTACATTATATTTAATTTTTGGCGCCTGAGCCGGCATAATTGGTACCGCCCTAAGTCTCCTTATCCGAGCAGAGCTAGGACAACCAGGGACTCTCTTAGGAGATGACCAGATCTACAACGTGATCGTCACTGCTCATGCTTTCGTAATAATCTTCTTTATAGTAATACCCATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATAATTGGTGCCCCAGATATAGCATTCCCACGTATAAACAATATAAGCTTCTGACTACTTCCCCCATCATTCCTTCTCCTCCTAGCTTCATCTACAGTTGAAGCTGGAGTGGGAACCGGATGGACTGTCTACCCGCCATTAGCTGGTAACCTAGCGCATGCTGGAGCTTCAGTAGACCTAGCCATTTTCTCCCTTCACCTTGCAGGAGTTTCTTCAATCCTAGGTGCAATTAATTTCATTACCACTGCAATCAACATAAAACCCCCAGCCCTATCACAATATCAAACTCCCTTATTCGTATGATCCGTCTTAATCACCGCAGTTCTTCTCCTCCTCTCCCTCCCAGTCCTCGCTGCTGGTATTACTATGCTACTAACAGACCGCAACCTTAACACCACATTCTTCGACCCAGCAGGAGGCGGAGACCCAGTTTTATATCAACACCTATTCTGATTTTTTGGCCACCCAGAAGTCTATATCCTGATCCTACCAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Megarynchus pitangua

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 5,000,000-50,000,000 individuals (A. Panjabi in litt. 2008).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Boat-billed Flycatcher

The Boat-billed Flycatcher (Megarynchus pitangua) is a passerine bird. It is a large tyrant flycatcher, the only member, monotypic, of the genus Megarynchus.

It breeds in open woodland with some tall trees from Mexico south to Bolivia and Argentina, and through to Trinidad.

The nest, built by the female, is an open saucer of sticks. The typical clutch is two or three whitish eggs heavily blotched with brown. These are incubated mostly by the female for 17–18 days with a further 24 days to fledging.

In Costa Rica

Adult Boat-billed Flycatchers are one of the largest species of tyrant flycatcher, measuring 23 cm (9.1 in) long and weighing 70 g (2.5 oz).[2] The head is black with a strong white eyestripe and a concealed yellow crown stripe. The upperparts are olive-brown, and the wings and tail are brown with only faint rufous fringes. The underparts are yellow and the throat is white.

The massive black bill, which gives this species its English and generic names, is the best distinction from the similar Great Kiskadee, which also has more rufous tail and wings, and lacks the olive tone to the upperparts. The call is a strident trilled nya, nya, nya.

Boat-billed Flycatchers wait on a concealed perch high in a tree and sally out to catch insects in flight. They will also take invertebrates off the foliage and eat some berries.

References[edit]

  • ffrench, Richard (1991). A Guide to the Birds of Trinidad and Tobago (2nd edition ed.). Comstock Publishing. ISBN 0-8014-9792-2. 
  • Hilty, Steven L (2003). Birds of Venezuela. London: Christopher Helm. ISBN 0-7136-6418-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!