Articles on this page are available in 1 other language: Spanish (17) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Attila spadiceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTATATTTAATCTTTGGCGCCTGGGCCGGTATAATCGGGACAGCCCTAAGTCTCCTTATCCGAGCAGAACTTGGCCAACCAGGGACCCTTCTAGGAGATGATCAAATCTACAATGTAATTGTTACCGCCCATGCATTCGTAATAATCTTCTTCATAGTAATGCCTATTATAATTGGAGGATTCGGCAACTGACTAGTCCCCCTTATAATTGGCGCCCCAGACATAGCATTTCCACGTATAAACAACATAAGCTTTTGACTACTCCCCCCATCATTTCTTCTCCTCTTAGCCTCATCCACAGTCGAAGCCGGTGCAGGAACCGGATGAACTGTCTACCCACCTTTAGCCGGTAACCTAGCCCATGCTGGAGCTTCAGTTGACCTAGCTATTTTCTCCTTACACCTTGCAGGTGTCTCTTCAATTCTAGGTGCCATTAACTTCATTACCACTGCAATCAACATAAAACCACCAGCTTTATCACAATACCAAACCCCCTTATTTGTATGGTCTGTCTTAATCACCGCAGTTCTCCTTCTCCTCTCCCTCCCAGTCCTTGCCGCCGGCATCACCATGCTCTTAACAGACCGCAATCTTAACACCACATTCTTCGACCCTGCAGGAGGTGGAGACCCAGTTTTATATCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Attila spadiceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 500,000-4,999,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bright-rumped attila

The bright-rumped attila or polymorphic attila (Attila spadiceus) is a small passerine bird in the tyrant flycatcher family (Tyrannidae). It breeds from northwestern Mexico to western Ecuador, Bolivia and southeastern Brazil, and on Trinidad.

Description[edit]

The bright-rumped attila is a large tyrant flycatcher with a big head, hooked and slightly upturned bill and upright stance. It is 7 in (18 cm) long and weighs 1.4 oz (40 g). The head is olive-green streaked with black, the back is chestnut or olive, the rump bright yellow and the tail brown. The wings are dark brown with two pale wing bars and paler feather edging. The whitish or yellow throat and yellow breast are variably streaked darker. The belly is white becoming yellow near the tail. The iris is red. The sexes are similar, but young birds have a cinnamon-fringed crown and brown eyes.

The plumage is very variable, but the streaking below and obvious wingbars help in distinguishing this species from others in the genus. The calls include a loud beat-it, beat-it and a plaintive ooo weery weery weery weery woo. It does not move when singing, so can be difficult to see.

Central American birds have slightly different song structures and also tend towards lighter ochre plumage independent of Gloger's Rule; they are sometimes separated as flammulated attila (Attila flammulatus) . Their characteristic song given at dawn has been analyzed in detail: it has a very variable number of weerys which may become weery'os, and often ends in a woo-whit; a finite state machine has been developed to simulate this structure.[2] However, due to the highly variable songs more data is required before the technically plausible split can be accepted; the AOU has so far refrained from formally acknowledging it.

Ecology[edit]

The bright-rumped attila is a common bird from the lowlands to 7,000 ft (2,100 m) ASL. It occurs in forests, second growth, pasture and plantations with trees, and shady gardens, and apparently it can tolerate a considerable amount of habitat destruction.[3] It is an active, aggressive and noisy species, usually seen alone. It eats insects, spiders, frogs and lizards taken from vegetation or the ground. It will pursue prey on foot as well as attacking in short sallies, and will follow army ant columns. It also takes many fruits (such as from gumbo-limbo Bursera simaruba, and less frequently from Cymbopetalum mayanum)[4] and seeds.

The nest is a deep cup of mosses, leaves and plant fibre; it may be built usually below 3m high amongst epiphyte, between buttress roots or in a bank, not necessarily in the forest. The typical clutch is two lilac- or rufous-marked dull white or pink eggs. Incubation by the female is 14–15 days to hatching, with another 17 days to fledging.

Footnotes[edit]

  1. ^ BirdLife International (2012). "Attila spadiceus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Leger (2005)
  3. ^ Salaman et al. (2002)
  4. ^ Foster (2007)

References[edit]

  • Foster, Mercedes S. (2007): The potential of fruiting trees to enhance converted habitats for migrating birds in southern Mexico. Bird Conservation International 17(1): 45-61. doi:10.1017/S0959270906000554 PDF fulltext
  • Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
  • Leger, Daniel W. (2005): First documentation of combinatorial song syntax in a suboscine passerine species. Condor 107(4): 765-774. doi:10.1650/7851.1 PDF fulltext
  • Stiles, F. Gary & Skutch, Alexander Frank (1989): A guide to the birds of Costa Rica. Comistock, Ithaca. ISBN 0-8014-9600-4
  • Salaman, Paul G.W.; Stiles, F. Gary; Bohórquez, Clara Isabel; Álvarez-R., Mauricio; Umaña, Ana María; Donegan, Thomas M. & Cuervo, Andrés M. (2002): New and noteworthy bird records from the east slope of the Andes of Colombia. Caldasia 24(1): 157-189. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!