Articles on this page are available in 1 other language: Spanish (7) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Elaenia flavogaster

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Elaenia flavogaster

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTATACCTAATTTTCGGTGCCTGAGCCGGCATAATTGGCACTGCCCTAAGCCTTCTTATCCGAGCAGAACTTGGTCAACCCGGAACCCTCCTAGGAGATGACCAGATCTATAACGTAATTGTTACCGCCCATGCCTTTGTAATAATCTTCTTCATAGTTATACCTATTATAATTGGAGGATTCGGCAACTGACTAGTCCCCCTGATAATTGGAGCTCCTGACATAGCATTCCCACGTATAAATAACATAAGTTTTTGACTCCTTCCCCCATCATTTCTTCTCCTCTTAGCCTCGTCCACAGTTGAAGCCGGGGTAGGAACGGGATGAACCGTTTACCCACCATTAGCCGGCAACCTAGCCCATGCAGGTGCTTCAGTAGACTTAGCTATCTTCTCCCTCCACCTCGCAGGAGTGTCTTCAATCCTAGGCGCTATTAATTTTATTACCACCGCAATCAATATGAAACCACCAGCCCTCTCACAATACCAAACACCTCTATTTGTTTGATCCGTCCTAATTACCGCAGTGCTTCTTCTCCTTTCTCTCCCTGTTCTCGCTGCTGGCATTACCATGCTTCTAACAGACCGAAACCTTAACACTACATTTTTTGACCCTGCAGGAGGAGGAGACCCAGTTCTATACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 5,000,000-50,000,000 individuals (A. Panjabi in litt. 2008).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yellow-bellied elaenia

The yellow-bellied elaenia (Elaenia flavogaster) is a small bird of the tyrant flycatcher family. It breeds from southern Mexico and the Yucatán Peninsula through Central and South America as far as northern Argentina, and on Trinidad and Tobago.

Adults are 16.5 cm long and weigh 24g. They have olive-brown upperparts, a white eye ring, a bushy divided crest and a white crown patch in the parting. The throat is pale and the breast greyish, with pale yellow lower underparts. The call is a nasal breeer, and the song is a wheezing zhu-zhee-zhu-zhee.

4 subspecies are recognized:

This is a common bird in semi-open woodland, scrub, gardens and cultivation. The yellow-bellied elaenia is a noisy and conspicuous bird which feeds on berries and insects. The latter are usually caught from mid-air after the bird sallies from a perch, and sometimes picked up from plants.[2] The species will also join mixed-species feeding flocks on occasion, typically staying quite some distance up in the trees.[3]

It makes a cup nest and lays two cream eggs with reddish blotches at the larger end. The female incubates for 16 days, with about the same period to fledging. Omnivorous mammals as small as the common marmoset (Callithrix jacchus) will eagerly plunder yellow-bellied elaenia nests in the undergrowth – perhaps more often during the dry season when fruits are scarce – despite the birds' attempts to defend their offspring.[4]

E. flavogaster is a common and wide-ranging bird, not considered threatened by the IUCN.[5]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Elaenia flavogaster". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ de A. Gabriel & Pizo (2005)
  3. ^ Machado (1999)
  4. ^ de Lyra-Neves et al. (2007)
  5. ^ BLI (2008)

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!