Overview

Distribution

Range

SE Brazil (Rio de Janeiro to Rio Grande do Sul).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Turdus albicollis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGACATTCATCAACCGGTGATTATTCTCAACCAACCACAAAGACATCGGCACTCTTTATCTGATCTTCGGCGCATGGGCCGGAATAGTAGGTACTGCCCTAAGCCTCCTCATCCGAGCAGAATTAGGCCAACCAGGTGCCCTGCTAGGCGACGACCAAATCTACAACGTGGTTGTTACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCCCGAATAAACAATATGAGCTTTTGACTCCTCCCACCGTCCTTCCTTCTCCTTCTAGCCTCTTCTACAGTAGAAGCCGGGGCAGGAACAGGTTGAACCGTCTACCCTCCCCTCGCCGGCAACCTAGCACACGCAGGAGCTTCAGTTGACTTAGCCATCTTCTCCCTACACCTCGCAGGAATCTCCTCAATCCTAGGGGCCATCAACTTCATCACAACAGCAATCAACATAAAACCGCCTGCCCTCTCACAGTACCAAACCCCCCTATTCGTCTGATCAGTACTGATTACAGCAGTGCTACTTCTACTATCCCTCCCCGTCCTTGCCGCTGGCATCACCATGCTCCTCACCGACCGCAATCTAAACACAACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAGTACTATACCAACAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Turdus albicollis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 31
Specimens with Barcodes: 51
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-necked Thrush

The White-necked Thrush (Turdus albicollis) is a songbird found in forest and woodland in South America. The taxonomy is potentially confusing, and it sometimes includes the members of the T. assimilis group as subspecies, in which case the "combined species" is referred to as the White-throated Thrush (a name limited to T. assimilis when the two are split). On the contrary, it may be split into two species, the Rufous-flanked Thrush (T. albicollis) and the Grey-flanked Thrush (T. phaeopygos).

Contents

Description

This thrush is 20½-26 cm (8–10 in) long and weighs 40-77 g (1.4-2.7 oz).[2] The upperparts are dark brown, turning duskier or greyer towards the ocular region. The throat is white with dense dark streaks, except on the lowermost part, resulting in the appearance of a white crescent below the dark-streaked white throat. This has given rise to both its English and scientific name. The crissum and central belly are whitish, and the chest is grey often tinged brown. The members of the nominate group have conspicuous rufous flanks, and the bill is yellow with a dusky culmen. The flanks are paler and more tawny in the subspecies crotopezus, which also has the entire upper mandible dusky. The members of the phaeopygos group lack contrasting rufous or tawny flanks, and have bills that are almost entirely dusky. All subspecies have pinkish-brown legs and a reddish or yellow eye-ring.[2] Sexes are similar, but juveniles are duller, with dull orange spotting above, and brownish spotting below.[3]

The song is a relatively musical, often rather monotonous[4] two-e-o, two-e. The calls is a distinctive wuk, while the alarm is a rough jjig-wig-wig.[2]

Distribution and habitat

The nominate group (including subspecies paraguayensis and crotopezus) occurs in eastern Brazil, far northern Uruguay, eastern Paraguay and far north-eastern Argentina. The phaeopygos group (including subspecies phaopygoides, spodiolaemus and contemptus) is mainly found in the Amazon Basin, but with populations extending along the eastern slope of the Andes as far south as north-eastern Argentina, and as far north as western Venezuela, with extensions along the Coastal Range, the region centered around Serranía del Perijá and Sierra Nevada de Santa Marta, and the islands of Trinidad and Tobago.[2][4]

Both groups are mainly associated with humid forest and woodland. In the case of the nominate group, mainly the Atlantic Forest, and in the case of the phaeopygos group, mainly the Amazon Rainforest or humid forests and woodlands near mountains. It rarely ventures far from cover.[2]

Behavior

The White-necked Thrush mainly feeds on or near the ground on invertebrates. It also takes some fruit and berries.[2] It regularly follows army ant swarms, but does not attend mixed species flocks.[4] Throughout most of its range, especially in the Amazon, it is a shy species, heard far more than seen, but in Trinidad and parts of south-eastern Brazil it may be less retiring.

The nest is a lined cup of twigs placed low (at a height of 1–9 m [3–30 ft][2]) in a tree or bush. Two to three reddish-blotched green-blue eggs are laid and incubated by the female alone for 12–13 days.

Taxonomy

T. albicollis sometimes includes the members of the T. assimilis group as subspecies, in which case the "combined species" is referred to as the White-throated Thrush (a name limited to T. assimilis when the two are split). Published evidence supporting either treatment is weak, but most recent authorities have followed the split.[5]

On the contrary, it has been suggested that the nominate group and the phaeopygos group of T. albicollis should be considered separate species, but the voices of the two are similar, and the subspecies crotopezus from the nominate group approach members of the phaeopygos group in both plumage and colour of bill.[6] If the two groups are split, the common name Rufous-flanked Thrush has been suggested for T. albicollis, with T. phaeopygos retaining the common name White-necked Thrush or being renamed Grey-flanked Thrush.[2][6]

Footnotes

  1. ^ BirdLife International (2012). "Turdus albicollis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d e f g h Collar (2005)
  3. ^ Restall et al. (2006)
  4. ^ a b c Hilty (2003)
  5. ^ Remsen et al. (2008)
  6. ^ a b Ridgely & Greenfield (1989)

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!