Overview

Brief Summary

Spizella pusilla

A small (5 inches) bunting, the Field Sparrow in summer is most easily identified by its mottled brown back, gray face and neck, rusty red crown, and conspicuous pink bill. This species may be distinguished from the similarly-patterned American Tree Sparrow (Spizella arborea) by that species’ larger size, grayer head, and darker bill. Male and female Field Sparrows are similar to one another in all seasons. The Field Sparrow breeds across the eastern United States and extreme southern Canada west to the Great Plains. In winter, northerly-breeding populations migrate south into the southeastern U.S.and northern Mexico. Populations breeding further south migrate short distances if at all. Field Sparrows breed in a number of semi-open habitats, including forest edges, bushy fields, and thickets near farmland. This species utilizes similar habitats in winter as in summer. Field Sparrows primarily eat seeds, but also eats small insects during the summer months. In appropriate habitat, Field Sparrows may be seen on the ground or in low vegetation while foraging for food. Birdwatchers may also listen for this species’ song, a series of whistled notes steadily increasing in pitch and frequency. Field Sparrows are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: eastern Montana east across the northern U.S. and southern Canada to New England and southern New Brunswick, south to northeastern Colorado, Oklahoma, Texas, Gulf Coast, and southern Georgia; also southern Manitoba (Carey et al. 1994, AOU 1998). NON-BREEDING: Kansas east to Massachusetts, south to southeastern New Mexico, northern Coahuila, central Nuevo Leon, northern Tamaulipas, Gulf Coast, and southern Florida (Carey et al. 1994, AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Field sparrows are found throughout the eastern United States from just east of the Rocky Mountains to the Atlantic Coast and from North Dakota to southern Texas in the west and New Hampshire to Florida in the east. They are also found in southern Ontario and southernmost Quebec. Their breeding and wintering ranges overlap and they are found year-round throughout much of their range.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Field sparrows are found throughout the eastern United States from just east of the Rocky Mountains to the Atlantic Coast and from North Dakota to southern Texas in the west and New Hampshire to Florida in the east. They are also found in southern Ontario and southernmost Quebec. Their breeding and wintering ranges overlap substantially and they are found year-round throughout much of their range except for the northernmost and southernmost portions. Some populations are resident year-round while others undertake short migrations.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Male field sparrows are slightly larger than females, but both sexes have similar feather color. They are reddish brown on their heads and back with gray, un-streaked bellies. They have two white wing bands, a white eye ring, and a rusty brown stripe extending from the eye. Their bill and legs are pinkish, helping to distinguish them from other sparrows.

Range mass: 11.4 to 15.7 g.

Range length: 12.5 to 15 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Male field sparrows are slightly larger than females, but both sexes have similar plumage. They are reddish brown on their heads and back with gray, un-streaked bellies. They have two white wing bands, a white eye ring, and a rusty brown stripe extending from the eye. Their bill and legs are pinkish, helping to distinguish them from other sparrows. They might be confused with Worthen's sparrows (Spizella wortheni) in southern New Mexico, but they lack the rufous stripe from the eye, a different song, and black legs.

Range mass: 11.4 to 15.7 g.

Range length: 12.5 to 15 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 15 cm

Weight: 13 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Old fields, brushy hillsides, overgrown pastures, thorn scrub, deciduous forest edge, sparse second growth, fencerows (AOU 1983). Early nests on or near ground in weed clumps or grass tufts, later nests may be higher in small thick shrubs as leaves grow, to about 30 centimeters above ground (Harrison 1978). Suitable habitat includes oldfields, sage (ARTEMISIA) flats, weedy pastures, untilled and idle cropland, Conservation Reserve Program fields, grassed waterways, hedgerows, shelterbelts, orchards, woodland edges, brushy woodlands, wooded draws, pine (PINUS) plantations, attenuated gallery and gallery forest, and reclaimed strip mines (Gabrielson 1914; Ely 1957; Graber and Graber 1963; Walkinshaw 1968; Stewart 1975; Best 1977, 1978; Evans 1978; Johnsgard 1980; Stauffer and Best 1980; Whitmore 1980; Best et al. 1981, 1997; Faanes 1981, 1983; Buech 1982; Hopkins 1983; Sousa 1983; Dinsmore et al. 1984; Kahl et al. 1985; Basore et al. 1986; Sample 1989; Bryan and Best 1991; Herkert 1991a; Cable et al. 1992; Zimmerman 1993; Carey et al. 1994; Vickery et al. 1994; Faanes and Lingle 1995). Woody vegetation and dense grass appear to be critical components for habitat suitability (Johnston 1947, Kupsky 1970, Lanyon 1981, Sousa 1983, Laubach 1984, Herkert 1991a). Optimal habitat was described as areas greater than 2 hectares containing dense, moderately tall grass, low to moderate shrub density with 50-75 percent of shrubs less than 1.5 meters tall, and shrub cover between 15-35 percent . Areas where most shrubs were less than 1.5 meters in height were considered too sparse in providing adequate numbers of perch sites, whereas areas where most shrubs were taller than 1.5 meters were considered too sparse in providing adequate numbers of possible nest sites. Areas with more than 75 percent shrub cover were too dense to be suitable breeding habitat (Sousa 1983).

The key to determining suitability of an area for nesting in Illinois was the availability of shrubs, trees, or other substrates that could be used as song perches; sparrows stayed within or near the forest edge, not venturing deeper than a few meters into the forest, nor farther than 12-15 meters into surrounding fields (Johnston 1947). In Illinois, preferred shrub-grassland, where shrubs and trees were less than 8 meters tall, over adjacent grassland or woodland edge; shrub-grassland offered an assemblage of grasses, forbs, trees, and shrubs to accommodate temporal shifts in the nesting and foraging preferences (Best 1974a, 1977). All available shrub-grassland habitat was encompassed within territories, whereas not all grassland or woodland edge habitat was encompassed within territories. Within riparian habitats ranging from hayfields to closed canopy woodlands in Iowa, density was positively correlated to species richness of shrubs; 67 percent of nine nests were built in shrubs, 22 percent in evergreen trees, and 11 percent in forbs (Stauffer and Best 1980, Best et al. 1981). Also in Iowa, preferred grassy areas with shrubs or low trees (Laubach 1984). In Wisconsin, density was positively correlated with percent woody cover and total number of dead stems (Sample 1989). In North Dakota, were attracted to wooded draws with a high shrub density (Faanes 1983). In Missouri, occupied grasslands and idle areas were characterized by low to intermediate canopy height (2-8 meters, never more than 8 meters), few woody stems less than 2.5 centimeters diameter at breast height (dbh) (approximately 350-700 per hectare), and moderate numbers of woody stems more than 2.5 centimeters dbh (approximately 25-50 per hectare) (Kahl et al. 1985). Moderate amounts of dense grass also are important (Sousa 1983). Optimal grass density is 50-90 percent canopy cover, which provides adequate nesting cover, abundant food sources, and ease of movement through vegetation (Sousa 1983). Optimal height of herbaceous vegetation during May and June is 16-32 centimeters; vegetation with an average height more than 40 centimeters provides suboptimal habitat and vegetation with an average height less than 5 centimeters provides inadequate concealment (Sousa 1983). In Wisconsin, preferred habitats that were relatively undisturbed, that were uncultivated, and that contained an average of 75 percent herbaceous cover (Sample 1989). In an Ohio oldfield, foraged in grasses in higher frequencies than expected based on their availability (Kupsky 1970). In Michigan, preferred to nest in residual stands of Indiangrass (SORGHASTRUM NUTANS) over residual stands of big bluestem (ANDROPOGON GERARDII) because most of the big bluestem was prostrate whereas most of the Indiangrass was upright (Best 1974a).

Nests on or near the ground in weed clumps, grass tufts, or litter usually at or near the base of woody vegetation early in the breeding season (May-June), but nest in small shrubs and saplings later in the breeding season as vegetative cover increases in height (Walkinshaw 1936, 1945; Crooks 1948; Crooks and Hendrickson 1953; Nolan 1963; Best 1974a, 1978; Evans 1978; Sousa 1983; Carey et al. 1994). Nest height ranges from 0 to 4.4 meters above ground (Walkinshaw 1936, 1945; Crooks 1948; George 1952; Ely 1957; Nolan 1963; Kupsky 1970; Best 1978; Evans 1978; Lanyon 1981; Buech 1982; Laubach 1984; Carey et al. 1994; D. E. Burhans, pers. comm.), but height is dependent upon time of season and substrate type. Based on the observations of one male that returned to the same Michigan site for 6 years, May nests were on the ground, and June and July nests averaged 26.0 centimeters and 40.5 centimeters above the ground, respectively (Walkinshaw 1945). In Iowa, six of 11 nests built in May were above ground with an average height of 16 centimeters; by June, six of 10 nests were above ground with an average height of 40 centimeters, and by July, all of the 11 nests found were above ground with an average of 51 centimeters (Crooks 1948). May nest in woody vegetation after foliage becomes dense enough to conceal nests (Crooks 1948, Nolan 1963). Best (1978), however, found preference for use of residual grasses as a nesting substrate over live grasses or woody vegetation that had leafed out. As long as isolated clumps of residual grass remained exposed from new growth, nested in residual grass; once residual grass was covered by live grasses, nested in woody vegetation.

Other important habitat features are vegetation patchiness, species richness of herbaceous and woody vegetation, and slope (Stauffer and Best 1980, Best et al.1981, Sample 1989, Vickery et al. 1994). In riparian habitats in Iowa, densities were positively correlated to horizontal patchiness of shrubs, vertical patchiness of trees, slope, and species richness of grass-like vegetation, shrubs, and evergreen trees; densities were negatively correlated to tree density and tree size, species richness of vines, and vertical stratification of vegetation (Stauffer and Best 1980, Best et al. 1981). In Maine grassland barrens, abundance was positively correlated to habitat patchiness, litter, shrub cover, and short grass, and negatively correlated to bare ground (Vickery 1993, Vickery et al. 1994). Density in Wisconsin was positively correlated to plant species richness (Sample 1989). In Iowa, all 15 breeding territories in an idle pasture were located on semi-wooded hillsides or lowlands (Crooks and Hendrickson 1953).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Field sparrows can be common in habitats they like but they don't like living near humans. They are found in open, savanna-like habitats, like old fields, forest edges and openings, fencerows and road or railway cuts near open fields, and occasional orchards and nurseries. They are found only in fields with some trees or shrubs that provide perches, but not too many trees.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Field sparrows can be common in preferred habitat, but are rarely found near human habitation, even in appropriate habitat. They are found in open, savanna-like habitats, such as successional old fields, forest edges and openings, fencerows and road or railway cuts near open fields, and occasional orchards and nurseries. They are found only in fields with some trees or shrubs that provide perches. Once succesional habitats become overgrown with trees and shrubs, field sparrows are no longer found there.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northernmost breeding populations are migratory, move south for winter; migrate northward in small flocks in March-April (Terres 1980). Partially migratory in North Carolina; some individuals migrate in some years, all migrate in some years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats insects, also spiders and seeds; forages much on the ground (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Field sparrows eat mainly grass seeds, throughout the year. Grass seeds make up less than 50% of their diet in the summer, but more than 90% in the winter. In the summer they also take adult and larval insects and spiders. They forage on the ground, most often near some form of plant cover.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Field sparrows take seeds, primarily grass seeds, throughout the year. Grass seeds make up less than 50% of their diet in the summer, but more than 90% in the winter. In the summer, breeding season they also take adult and larval insects and spiders. They forage on the ground, most often near some form of vegetative cover. In the breeding season field sparrows forage on their own or with a mate, but they form small foraging flocks in winter. They take fallen seeds or land on grass stems and push them to the ground, where they remove the seeds. They use perches to briefly scan for insect prey.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Many kinds of parasites are found on field sparrows, including feather mites. Field sparrows are important predators of grass seeds in their savanna and edge habitats. Nests are parasitized by Molothrus ater. Most parasitized nests are deserted by the female.

Commensal/Parasitic Species:

  • malaria (Plasmodium)
  • feather mites (Astigmata)
  • brown-headed cowbirds (Molothrus_ater)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Predators of eggs and nestlings include Tamias striatus and many species of snakes (Elaphe obsoleta, Coluber constrictor, Lampropeltis, Thamnophis sirtalis, and Lampropeltis calligaster). The most common predators recorded are Elaphe obsoleta. Likely predators include Vulpes vulpes, Urocyon cineoargenteus, Mustela, Neovison vison, Mephitis mephitis, Procyon lotor, and Didelphis virginianus. Field sparrows use a "chip" call to alert others to a threat. They will use a broken-wing display to distract predators from their nest.

Known Predators:

  • black rat snakes (Elaphe_obsoleta)
  • chipmunks (Tamias_striatus)
  • blue racers (Coluber_constrictor)
  • milk snakes (Lampropeltis)
  • garter snakes (Thamnophis_sirtalis)
  • prairie kingsnakes (Lampropeltis_calligaster)
  • red foxes (Vulpes_vulpes)
  • grey foxes (Urocyon_cineoargenteus)
  • weasels (Mustela)
  • mink (Neovison_vison)
  • skunks (Mephitis_mephitis)
  • raccoons (Procyon_lotor)
  • Virginia opossums (Didelphis_virginianus)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Many kinds of ectoparasites are found on field sparrows, including feather mites. They are also infected by Plasmodium species. Field sparrows are important predators of grass seeds in their savanna and edge habitats. Nests are parasitized by brown-headed cowbirds (Molothrus ater), although frequency varies regionally. Most parasitized nests are deserted by the female. If a field sparrow nest is successfully parasitized by brown-headed cowbirds, their overall nesting success is greatly reduced and few of the cowbird nestlings are successfully raised.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Observed predators of eggs and nestlings include chipmunks (Tamias striatus) and many species of snakes (Pantherophis obsoletus, Coluber constrictor, Lampropeltis, Thamnophis sirtalis, Lampropeltis calligaster). The most common predators recorded are black rat snakes (Pantherophis obsoletus). Likely predators include red foxes (Vulpes vulpes), grey foxes (Urocyon cineoargenteus), weasels (Mustela), mink (Neovison vison), skunks (Mephitis mephitis), raccoons (Procyon lotor), and opossums (Didelphis virginianus). Field sparrows use a "chip" call to alert others to a threat. They will use a broken-wing display to distract predators from their nest.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Species is widely distributed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Abundance not known but widespread and common. In North Carolina, in pine planting with bluestem spot mapping estimated 23 males in 5.95 hectares, in pines with pasture estimated 14 males in 10.12 hectares (Fretwell 1970, cited in Carey et al. 1994). In a Maryland study, found 17 males per 100 hectares in damp deciduous scrub with standing dead trees, to 197 males per 100 hectares in apple orchard with unmowed ground cover. According to Breeding Bird Survey, highest densities in Missouri, Kentucky, and Ohio.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Territory sizes range from 0.3 to 2.4 hectares (Walkinshaw 1945, 1968; Crooks 1948; Best 1977; Evans 1978; Laubach 1984). In Illinois, territories that included suboptimal habitats, such as grasslands devoid of woody vegetation and woodlands, were found to be larger in area than those habitats that included only optimal habitat, such as shrubby grassland (Best 1977).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Field sparrows are recognized by their distinctive, pretty song, made up of soft whistles that accelerate towards a trill. Males use songs to advertise territories during the breeding season. Young field sparrows learn songs from their parents. Field sparrows also have a repertoire of other calls, including a foraging note ("seep"), courtship calls, trill calls used in territorial defense and courtship, cricket calls used by females at the nest, chip calls given in the presence of a threat, and "zeeee" or "eeeee" calls used with threats.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Field sparrows are recognized by their distinctive, pretty song, consisting of soft whistles that accelerate towards a trill. Males use songs to advertise territories during the breeding season. Young field sparrows learn songs from their parents. Field sparrows also have a repertoire of other calls, including a foraging note ("seep"), courtship calls, trill calls used in territorial defense and courtship, cricket calls used by females at the nest, chip calls given in the presence of a threat, and "zeeee" or "eeeee" calls used with threats.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Field sparrows have lived up to 8 years 9 months in the wild. Approximately 50% of young are thought to die before the fall of the year they were hatched.

Average lifespan

Status: wild:
8.75 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Maximum recorded age in the wild is 8 years 9 months, based on banding records. Annual male survivorship is estimated at 53% and annual female survivorship at 36%. Winter range conditions may result in higher mortality. Approximately 50% of fledglings are thought to die before the fall of their hatch year.

Average lifespan

Status: wild:
8.75 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clutch size usually three to five. Two or sometimes three broods per year. Incubation 10-17 days (average 11.6), by female. Young tended by both parents, leave nest at 7-8 days, independent at 26-34 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Field sparrows form mated pairs that stay together during the breeding season. Males use their simple songs to attract a mate and then stay near her as she builds a nest and begins to lay eggs.

Mating System: monogamous

Field sparrows breed from April through August each year. They lay from 2 to 5 eggs in up to 4 clutches per breeding season. Field sparrows often have to try nesting several times before being successful, because they have lots of predators. Females choose a nest site and construct a bowl-like nest of woven grass. During egg laying the parents don't seem to protect the nest. If eggs are taken by predators, the parents will attempt to build a new nest somewhere else. Incubation is generally from 11 to 12 days long. Young begin to fly at 13 to 14 days after hatching and become independent within 24 to 36 days after hatching. Young can breed in the year following their hatching.

Breeding interval: Field sparrows breed in the warm season, attempting several clutches in each breeding season. From 2.9 to 4 clutch attempts per breeding is typical.

Breeding season: Breeding occurs throughout much of the warm season, with eggs laid from April through August.

Range eggs per season: 2 to 5.

Range time to hatching: 10 to 17 days.

Average time to hatching: 11-12 days.

Range fledging age: 7 to 8 days.

Range time to independence: 24 to 36 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Females incubate eggs and keep the hatchlings warm, spending about 70% of their time on the nest. Males will occasionally feed the females. Males and females feed hatchlings about equally. Young are naked and helpless when they hatch. They develop gray downy feathers, their eyes open at 4 days old, and they can stand by about 5 days old. Parents continue to feed their young for 26 to 34 days after hatching, about 17 to 28 days after they can fly.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Field sparrows are monogamous. Males seem to use their simple songs to attract a mate, the frequency of simple songs decreases after a pair bond forms. Males accompany females during nest building and begin copulatory behavior while the nest is being built. Females seem to find a male mate within a few days of arriving in their breeding area and remain with their mate for a breeding season. A small number of individuals mate with each other again in following years. Extra-pair copulations have been observed.

Mating System: monogamous

Field sparrows breed from April through August each year. They lay up to 4 clutches per breeding season. Multiple nesting attempts are typical because of high rates of nest predation and desertion. Fledglings still dependent on their parents have been observed as late as October. Females choose a nest site and construct a bowl-like nest of woven grass in vegetation near trees and saplings. Nests early in the season are built on or near the ground, but later in the season, after woody vegetation has leafed out, they may be in the branches of shrubs or small trees. During egg laying the parents don't seem to protect the nest. If eggs are taken by predators, the parents will attempt to build a new nest elsewhere. Females lay from 2 to 5 eggs and begin incubating just before the last egg is laid. Females may delay incubation until well after the last egg is laid if the weather is cold and wet. Incubation is generally from 11 to 12 days long, but can be from 10 to 17 days. Young fledge 7 to 8 days after hatching, begin to fly at 13 to 14 days after hatching, and become independent within 24 to 36 days after hatching. Young are sexually mature in the year following their hatching.

Breeding interval: Field sparrows breed in the warm season, attempting several clutches in each breeding season. From 2.9 to 4 clutch attempts per breeding is typical.

Breeding season: Breeding occurs throughout much of the warm season, with eggs laid from April through August.

Range eggs per season: 2 to 5.

Range time to hatching: 10 to 17 days.

Average time to hatching: 11-12 days.

Range fledging age: 7 to 8 days.

Range time to independence: 24 to 36 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Females incubate eggs and brood hatchlings, spending about 70% of their time on the nest. Males will occasionally feed incubating females. Males and females feed hatchlings approximately equally. Young are altricial at hatching and mostly naked. They develop gray downy plumage, their eyes open at 4 days old, and they can stand by about 5 days old. Parents continue to feed their young through the hatchling phase and into the post-fledging period; they feed and protect young for 26 to 34 days after hatching, about 17 to 28 days after fledging. Males can take over feeding of fledglings if the female begins to construct another nest to begin a subsequent brood.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Spizella pusilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAATTTTCGGTGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTCCTAGGAGACGACCAAGTCTATAACGTAATCGTCACGGCCCATGCTTTCGTAATAATCTTCTTTATAGTCATACCAATTATAATCGGAGGATTCGGAAACTGACTAGTCCCCCTGATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCTTTCCTCCTCCTACTAGCATCCTCCACCGTCGAAGCAGGCGTAGGCACAGGCTGAACAGTTTATCCACCACTAGCCGGCAACCTGGCCCACGCCGGAGCTTCAGTCGACCTTGCAATTTTCTCCCTACACCTAGCCGGAATCTCCTCAATTCTAGGAGCAATCAACTTCATCACAACAGCAATCAACATAAAACCTCCCGCCCTATCACAGTACCAAACTCCCCTATTTGTGTGGTCAGTCCTAATCACCGCAGTACTACTACTCCTATCCCTTCCAGTCCTTGCCGCAGGAATCACAATACTCCTCACAGACCGCAACCTCAACACTACATTTTTCGACCCCGCCGGAGGAGGAGACCCTGTCCTGTATCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Spizella pusilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Abundant despite decline.

Other Considerations: Winters mostly within United States.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Field sparrows are sensitive to habitat disturbance and are found in only specific kinds of open, savanna habitats. They are not found in areas disturbed by humans, which are expanding currently. Populations have experienced declines across their range, but field sparrows are widespread and fairly common where habitat is appropriate, so they are not considered threatened currently. However, populations in Colorado are considered critically imperiled and populations in New Hampshire, Massachusets, Maine, Quebec, and the Canadian maritime provinces are considered vulnerable.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Field sparrows are sensitive to habitat disturbance and have fairly narrow habitat preferences. They are not found in areas with human habitations, which are expanding currently. Available habitat may increase in areas with recent forest cutting, or decrease in areas with predominantly successional habitats, which become inappropriate for field sparrows as they grow. Populations have experienced declines across their range, but field sparrows are widespread and fairly common where habitat is appropriate, so they are not considered threatened currently. However, populations in Colorado are considered critically imperiled and populations in New Hampshire, Massachusets, Maine, Quebec, and the Canadian maritime provinces are considered vulnerable.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: May have had greatest abundances in late 19th century after clearing of eastern forests. More recently, North American Breeding Bird Survey (BBS) data indicate annual survey-wide decrease -3.3 percent (N = 1621; P less 0.0) in the period 1966-1996 (Sauer et al. 1997). Biggest annual rate of decrease in Maine (-16.8 percent; N = 25; P less than 0.02) for same period. Non-significant increases noted only in Minnesota, Nebraska, and North Dakota. Decline probably due to changes in breeding habitat as shrubby old fields grow to forest or are cleared for agriculture and development.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: PREDATION: Predation is the major cause of nest mortality. In Illinois, 112 of 147 nests depredated (Best 1978, cited in Carey et al. 1994). In Illinois 24 of 66 nests depredated (Nolan 1963, cited in Carey et al. 1994). In Pennsylvania, 163 of 371 nests depredated (Carey et al. 1994). Nest predators include variety of snakes (e.g., blue racers [COLUBER CONSTRICTOR], milk snake [LAMPROPELTIS spp.], black rat snake [ELAPHE OBSOLETA], garter snake [THAMNOPHIS SIRTALIS], and prairie kingsnake [LAMPROPELTIS CALLIGASTER]), small mammals (e.g., chipmunk [TAMIAS STRIATUS], red fox [VULPES FULVA], gray fox [UROCYON CINEOARGENTEUS], weasels [MUSTELA spp.], skunks [MEPHITIS MEPHITIS], mink [MUSTELA VISON], raccoon [PROCYON LOTOR], and opposum [DIDELPHIS VIRGINIANA]), and birds (e.g., blue jay [CYANOCITTA CRISTATA], American crow (CORVUS BRACHYRHYNCHUS], and house wren [TROGLODYTES AEDON]). Best (1978, cited in Carey et al. 1994) attributed 48 percent of egg loss and 54 percent of nestling loss to snakes. Another study attributed 65 percent of nest predation to snakes (Carey et al. 1994). PARASITISM: Parasitism by brown-headed cowbirds (MOLOTHRUS ATER) is common (Crooks and Henderson 1953, Friedmann 1963, Walkinshaw 1968, Kupsky 1970, Friedmann et al. 1977, Best 1978, Evans 1978, Buech 1982, Laubach 1984, Carey et al. 1994). Parasitism rate varies geographically: in Iowa, 80 percent of nests parasitized; in Missouri, 13 percent; in Illinois, 11 percent; in Ohio, 32 percent; in Pennsylavania, less than 1 percent. Parasitized nests commonly deserted (Walkinshaw 1949; George 1952; Crooks and Hendrickson 1953; Ely 1957; Best 1978; Carey et al. 1994; D. E. Burhans, pers. comm.). Of 182 parasitized nests in Michigan, 100 were deserted and only 27 of 234 cowbird eggs hatched (Walkinshaw 1968). In another study in Michigan, only eight of 29 cowbird eggs hatched and, of these, only one cowbird fledgling survived the first week (Crooks 1948).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Preserve Selection and Design Considerations: The habitat suitability model posited that breeding habitat should be more than 2 hectares (Sousa 1983). However, Kupsky (1970) and Petter et al. (1990) found breeding evidence on fields smaller than 2 hectares. In Illinois, were encountered on small (less than 10 hectares) sites but were classified as moderately tolerant to habitat fragmentation because they were more frequently encountered on large than on small grassland fragments (Herkert 1991a,b). Field Sparrows in this study, however, were more strongly influenced by habitat structure than grassland area, and their absence from some small grassland areas may have been due to a lack of suitable habitat rather than an avoidance of small areas per se (Herkert 1991a; J. R. Herkert, pers. comm.). In Maine, occurrence was not affected by field size (Vickery et al. 1994). No studies have investigated a relationship between patch size and nest success or patch size and rates of brood parasitism by Brown-headed Cowbirds (MOLOTHRUS ATER).

Management Requirements: BURNING: Complete removal of woody vegetation from an area may make it unattractive (Stauffer and Best 1980, Sousa 1983). In Illinois, appeared tolerant to burning in shrub-grassland if woody vegetation remained and burning occurred after territories had been established (Best 1979). Field Sparrows moved from the adjacent burned tallgrass and woodland edge into the shrub-grassland. Also in Illinois, preferred burned areas 3-4 years postburn but were not present more than 5 years postburn (Westemeier and Buhnerkempe 1983; Herkert 1991a, 1994a). In Iowa, one nest was found just 27 days after the area was burned (Laubach 1984). In Wisconsin, density was positively correlated with the proportion of plots that was burned (Sample 1989). In Kansas tallgrass prairie, did not occur in annually burned watersheds, probably because they lacked woody vegetation (Zimmerman 1993). In the same study area, occurred in prairie that was neither burned or grazed, but were absent from ungrazed prairie that was annually burned (Zimmerman 1997). In Nebraska, abundance did not differ between pastures grazed by cattle and a pasture grazed by American bison (BISON BISON), or between burned and unburned areas in the pasture grazed by American bison (Griebel et al. 1998). In Maine, avoided grassland barrens more than 3 years postburn (Vickery 1993). In Michigan, following a burn in early spring, only males that had bred on the burned area the previous year bred on the burned area (Walkinshaw 1945). Some males whose territories were severely burned did not acquire a mate until the vegetation had recovered. One male did not acquire a mate until July but still was able to successfully nest.

HAY AND CROPFIELDS: In Illinois, selected idle areas over areas that were high-mowed (stubble more than 30 centimeters remains on the field), but were absent in hayed areas (Westemeier and Buhnerkempe 1983). However, in another Illinois study, were absent from both tame hayfields and idle fields (Herkert 1991a). In Iowa, nested only in grassed waterways that were mowed the previous year (Bryan and Best 1994). Also in Iowa, they nested in low densities in strip cover, such as grassed waterways, terraces, fencerows, and road rights-of-way (Basore et al. 1986). They also nested in soybean fields that were not tilled in fall and spring and that contained year-round crop residue; they did not nest in spring-tilled fields. In Illinois, were observed more frequently in a corn field under no-tillage treatment than in a conventionally tilled corn field, possibly because there was greater availability of invertebrates in the former corn field (Warburton and Klimstra 1984). In a study of avian use of cropland in Ohio, used fallow cropland, pasture, and small grains grown in strips between idle cropland (Good and Dambach 1943). In Wisconsin, were absent from hayfields and cropland (Sample 1989). In New York, avoided fields mowed annually and nested in oldfields 2-16 years following the cessation of cultivation; after that time the fields were no longer attractive, probably due to lack of suitable nesting cover such as weeds and saplings (Lanyon 1981).

PESTICIDES: Little information exists concerning the effects of pesticides. In New York, carbaryl (1-naphthyl methylcarbamate) was sprayed on shrubs at normal levels and at levels six times the normal dose (Bart 1979). Not affected by the spraying; the number of singing males did not significantly differ between the treated areas and the control areas. In New York, did not breed for 18 years in a field where vegetation was removed by a one-time application of 2,4,5-trichlorophenoxy acetic acid (2,4,5-T) and kerosene (Lanyon 1981). In Texas, in a study examining the effects on avian density of discing, spraying of 2,4,5-T approximately 14 years earlier, and construction of brush shelters, grassland sparrows, as a group, were more abundant in the treated than untreated areas; effects on particular species were not examined (Gruver and Guthery 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: Widespread east of the Rockies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no adverse effects of field sparrows on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no direct positive impacts of field sparrows on humans. They are an interesting member of the native, North American bird fauna and are appreciated for their song.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no adverse effects of field sparrows on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no direct positive impacts of field sparrows on humans. They are an interesting member of the native, North American bird fauna and are appreciated for their song.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: Keys to management include providing shrub-dominated edge habitat adjacent to grassland or providing grassland with a shrub component (both of must which include dense grass and moderately high litter cover), and avoiding disturbances that completely eliminate woody vegetation. Avoid management practices that completely remove woody vegetation (Best 1979, Stauffer and Best 1980). Protect existing prairie remnants (Herkert 1994b). Collaborate with private landowners to maintain suitable habitat (Herkert 1994b).

Manipulations of forested riparian habitats include reducing woody vegetation to narrow strips, partially removing woody canopy, and thinning shrubs and saplings (Stauffer and Best 1980).

Disturbance, such as burning, should be avoided before territories have been established, approximately March to early April (Best 1979, Carey et al. 1994, Herkert 1994b). Burning after territories already have been established does not appear to cause territory abandonment (Best 1979, Carey et al. 1994).

Burning should be used to prevent encroachment of woody vegetation, but some woody vegetation should be allowed to remain (Best 1979, Carey et al. 1994, Herkert 1994b). On prairie fragments greater then 80 hectares, burning should be conducted on a rotating schedule with 20-30 percent of area treated annually (Herkert 1994a). Small, isolated prairie fragments should not have more than 50-60 percent of total area burned at a time, and where several small prairie fragments are present, a rotating schedule also can be implemented to provide adjacent burned and unburned areas (Herkert 1994a).

In Iowa, mowing should be delayed until late August or early September to prevent destruction of nests and young; however, mowing should not occur later than mid-September, as vegetation will not have time to recover before the winter and following spring (Bryan and Best 1991).

Minimize tillage, because conventional tillage leaves little or no crop residue on the soil surface. Reduced tillage allows 15-30 percent of crop residue to remain, whereas conservation tillage allows more than 30 percent of crop residue to remain (Basore et al. 1986, Koford and Best 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Field sparrow


Problems playing this file? See media help.

The field sparrow (Spizella pusilla) is a small New World sparrow.

Description[edit]

Adults have brown upperparts, a buffy breast, a white belly, two whitish wing bars and a dark-brown forked tail. They have a grey face, a rusty crown, a white eye ring and a pink bill. They have rusty markings behind the eye. There are grey and rufous colour variants.[2][3]

Standard Measurements[2][3]
length5.1–6 in (130–150 mm)
weight12.5 g (0.44 oz)
wingspan8 in (200 mm)
wing62.7–67.8 mm (2.47–2.67 in)
tail62–68.4 mm (2.44–2.69 in)
culmen8.7–9.8 mm (0.34–0.39 in)
tarsus17.6–18.9 mm (0.69–0.74 in)

Distribution and habitat[edit]

Their breeding habitat is brushy, shrubby fields across eastern North America. The nest is an open cup on the ground under a clump of grass or in a small thicket.

These birds are permanent residents in the southern parts of their range. Northern birds migrate to the southern United States and Mexico.

Habits[edit]

These birds forage on the ground or in low vegetation, mainly eating insects and seeds. They may feed in small flocks outside the nesting season.

The male sings from a higher perch, such as a shrub or fencepost, which indicates his ownership of the nesting territory. The song is a series of sad whistles ending in a trill, often compared to the accelerating sound of a bouncing ball.

This bird's numbers expanded as settlers cleared forests in eastern North America, but may have declined in more recent times.

References[edit]

  1. ^ BirdLife International (2012). "Spizella pusilla". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Godfrey, W. Earl (1966). The Birds of Canada. Ottawa: National Museum of Canada. p. 395. 
  3. ^ a b Sibley, David Allen (2000). The Sibley Guide to Birds. New York: Knopf. p. 483. ISBN 0-679-45122-6. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Constitutes a superspecies with S. WORTHENI and considered to be conspecific with it by some authors (AOU 1983, 1998). See Zink and Dittmann (1993) for a hypothesis for evolution in the genus SPIZELLA. See Dodge et al. (1995) for a comparison of phylogenies derived from two molecular data sets for the genus SPIZELLA; among other results, monophyly of SPIZELLA including the American tree sparrow was supported.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!