Overview

Brief Summary

Junco hyemalis

A medium-sized (5 ½ - 6 ¾ inches) bunting, the Dark-eyed Junco comprises several geographic races possessing different patterns of plumage coloration. The eastern “Slate-colored Junco” is slate gray above and white below. The northwestern “Oregon Junco” is black on the head and breast with a chestnut back, gray wings, and white belly. The southern Rocky Mountains “Gray-headed Junco” is light gray on the head, breast, and tail with a chestnut back. The western Plains “White-winged Junco” is similar to the eastern race, but has strong white wing bars. Another race, the northern Rocky Mountains “Pink-sided Junco” is similar to the northwestern race, but is lighter gray on the head, wings, and tail. These races interbreed where their ranges overlap, producing hybrid birds with intermediate plumage. All races of this “snowbird” have in common a pale bill, dark eyes, and white feathers on the outer tail. Female Juncos are similar to males in the same race, but are usually paler and duller. The Dark-eyed Junco breeds across much of Alaska, Canada, and the northern United States, extending southwards at higher elevations to northern Georgia in the east and to Texas in the west. Dark-eyed Juncos are present all year in southern portions of this species’ breeding range, but birds breeding in these areas are displaced southward by more northern birds during winter, when this species may be found across southern Canada, the U.S., and northern Mexico. Dark-eyed Juncos breed in a variety of habitats across this species’ extensive breeding range, all of which have in common cool summer temperatures and some form of forest cover. During the winter, this species inhabits forest edges and other semi-open habitats, and will often enter urban or suburban areas where food is plentiful. Dark-eyed Juncos eat a variety of seeds and other plant material, but will also eat insects when available. In appropriate habitat, Dark-eyed Juncos may be most easily seen foraging for food on the ground or in the branches of trees. In winter, this species may be seen foraging as part of large flocks containing multiple species of sparrows and buntings. Dark-eyed Juncos are most active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Dark-eyed juncos (Junco_hyemalis) breed from Alaska and central Yukon to Labrador and Newfoundland, south to central coastal California, in the mountains to eastern California, central Arizona, and western Texas, southern Alberta, northern and east-central Minnesota, central Michigan, southern New England, and in the Appalachian Mountains to northern Georgia and northwestern South Carolina; also in the Black Hills. This species winters from central and south coastal Alaska, coastal British Columbia and across southern Canada south to Mexico, the Gulf Coast and northern Florida. It is found only in the Nearctic region of the world.

Biogeographic Regions: nearctic (Native )

  • United States Department of Agriculture, 1991. Forest and Rangeland Birds of the United States - Natural History and Habitat Use. United States Department of Agriculture Forest Service Agriculture Handbook 688.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The subspecies insularis is endemic to Guadalupe Island, 280 km west of Baja California, Mexico, where it was once common and among the island's most abundant birds. It is now patchily distributed in the north of the island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Dark-eyed juncos (Junco hyemalis) breed from Alaska and central Yukon to Labrador and Newfoundland, south to central coastal California, in the mountains to eastern California, central Arizona, and western Texas, southern Alberta, northern and east-central Minnesota, central Michigan, southern New England, and in the Appalachian Mountains to northern Georgia and northwestern South Carolina; also in the Black Hills. This species winters from central and south coastal Alaska, coastal British Columbia and across southern Canada south to Mexico, the Gulf Coast and northern Florida. It is found only in the Nearctic region of the world.

Biogeographic Regions: nearctic (Native )

  • United States Department of Agriculture, 1991. Forest and Rangeland Birds of the United States - Natural History and Habitat Use. United States Department of Agriculture Forest Service Agriculture Handbook 688.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends from Alaska eastward across central Canada to Labrador and Newfoundland, south to northern Baja California, Arizona, western Texas, southern Saskatchewan, southern Manitoba, Great Lakes region, and southern New England, and in the Appalachian Mountains to northern Georgia (Nolan et al. 2002). Winter range extends from southern Canada south through the United States to Florida, southern Texas, and northern Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Dark-eyed juncos are small birds that are 12.5 to 16.5 cm long. They weigh about 19 g and have a wingspan of about 23.5 cm. They have a dark gray head, back and breast and a very white belly. Their tails are dark gray on the middle feathers and white on the outside feathers. Dark-eyed juncos have a pink bill and dark eyes.

Female dark-eyed juncos are a little bit smaller and browner than males. Young juncos are also browner than males, and they have streaks on their breast.

Average mass: 19 g.

Range length: 12.5 to 16.5 cm.

Average wingspan: 23.5 cm.

Average basal metabolic rate: 46 cm^3 oxygen/hour.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger; sexes colored or patterned differently

Average mass: 18 g.

Average basal metabolic rate: 0.2959 W.

  • Barrowclough, F. 1983. The Audubon Society Master Guide to Birding: Vol. 3. New York: Knopf.
  • Reader's Digest Association, 1991. Book of North American Birds. New York: Reader's Digest Association, Inc.
  • Sibley, D. 2000. The Sibley Guide to Birds. New York: Knopf.
  • Sullivan, K. 1999. Yellow-eyed Junco. The Birds of North America, No. 464, 1999, No. 464: 1-23.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

All J. hyemalis are small and slender with an overall length of 5 to 6.5 inches (12.5 to 16.5 cm). This species has dark gray plumage on its head, breast and upper parts which are a contrast to their striking white, outer tail and white belly. Sexes are colored or patterned differently with female and immature J. hyemalis somewhat browner than the adult male; juveniles also have streaked breasts. Males are usually around 5% larger than females. Members of this species have a pink bill and dark eyes. A typical weight for J. hyemalis is 0.67 oz (19 g) and an average wingspan is 9.25 inches (23.5 cm).

Average mass: 19 g.

Range length: 12.5 to 16.5 cm.

Average wingspan: 23.5 cm.

Average basal metabolic rate: 46 cm^3 oxygen/hour.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger; sexes colored or patterned differently

Average mass: 18 g.

Average basal metabolic rate: 0.2959 W.

  • Barrowclough, F. 1983. The Audubon Society Master Guide to Birding: Vol. 3. New York: Knopf.
  • Reader's Digest Association, 1991. Book of North American Birds. New York: Reader's Digest Association, Inc.
  • Sibley, D. 2000. The Sibley Guide to Birds. New York: Knopf.
  • Sullivan, K. 1999. Yellow-eyed Junco. The Birds of North America, No. 464, 1999, No. 464: 1-23.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 16 cm

Weight: 2 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Dark-eyed juncos are found in woodlands that have openings with a dense layer of plants near the ground. They avoid going deep into forests. Instead, they prefer openings and the edges of forests and woodlands. In winter, they can be found in weedy fields, open woodlands, hedgerows, suburbs, and farmyards. They live between sea level and 3500 meters elevation.

Range elevation: 0 to 3500 m.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Nolan, V., E. Keterson, D. Cristol, C. Rogers, E. Clotfelter, R. Titus, S. Schoech, E. Snajdr. 2002. Dark-eyed junco (Junco hyemalis). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 716. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © International Union for Conservation of Nature and Natural Resources

    Source: IUCN

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    The habitat of J. hyemalis occurs from sea level to timberline in a variety of woodland areas that have openings with dense herbaceous ground cover. These areas include coniferous and deciduous forests, forest edges, woodland clearings, stream borders, open woodlands, brushy cover bordering mountain meadows, and old barns. This species avoids deep forest interiors in favor of woodland edges and openings. In winter they prefer weedy fields, but also inhabit open woodlands, hedgerows, suburbs, and farmyards. They are found from sea level to 3500 meters.

    Range elevation: 0 to 3500 m.

    Habitat Regions: temperate ; polar ; terrestrial

    Terrestrial Biomes: forest

    Other Habitat Features: urban ; suburban ; agricultural ; riparian

    • Nolan, V., E. Keterson, D. Cristol, C. Rogers, E. Clotfelter, R. Titus, S. Schoech, E. Snajdr. 2002. Dark-eyed junco (Junco hyemalis). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 716. Philadelphia, PA: The Birds of North America, Inc.
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Comments: Habitats include various sorts of coniferous, mixed, and deciduous forest; forest edge; forest clearings; bogs; open woodland; brushy areas adjacent to forest; and burned-over lands. In migration and winter the species occurs in a wide range of openly wooded and brushy and grassy habitats (AOU 1998). Nests are in scrapes on the ground and usually are concealed by logs, rocks, tree roots, leaves, or ground vegetation.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Migration

    Non-Migrant: No. All populations of this species make significant seasonal migrations.

    Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

    Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

    Generally this species is a long-distance migrant, but migrations are more localized in some areas of the West, and the Appalachian population is largely sedentary.

    South-bound migration from the northern breeding range occurs primarily September-November. Migration to northern breeding areas occurs mainly March-May.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Trophic Strategy

    Food Habits

    Dark-eyed juncos eat insects, non-insect arthropods, and seeds during the fall and winter. They are often seen at bird feeders during migration and in the winter months, but they prefer to search for food on the ground. When there is snow on the ground, dark-eyed juncos scratch away a small circle of snow to look for grain. To eat grass seed, dark-eyed juncos "ride" a grass stem. They fly to a tall grass stem and hold on as the stem bends down to the ground. The junco can stand on the grass stem on the ground and eat the seeds. During the breeding season, dark-eyed juncos eat mostly insects, including caterpillars, beetles, and ants. They also eat the seeds of many weed species.

    Dark-eyed juncos drink water from streams or pools or from raindrops or dew on plant leaves. During the winter, they eat snow in order to get water.

    Animal Foods: insects; terrestrial non-insect arthropods

    Plant Foods: seeds, grains, and nuts

    • Dunning, J. 2001. New World Sparrows. Pp. 516-535 in C Elphick, J Dunning, D Sibley, eds. The Sibley Guide to Bird Life and Behavior. New York: Alfred A. Knopf.
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Food Habits

    Dark-eyed juncos forage on the ground, picking up a wide variety of seeds and some insects. In the non-breeding season, they prefer to feed on insects, non-insect arthropods, and seeds. During the breeding season, they eat mostly insects. They are commonly seen at bird feeders during migration and in the winter months, however, even then they prefer to feed on the ground rather than pick seeds from an elevated feeder. One method of foraging practiced by this species is "riding" a grass stem. This is accomplished by flying up onto a tall grass stem, riding the stem down to the ground as it bends under the bird's weight, and then plucking the seeds from the seed head as it sits on the ground. When a thin layer of snow lies on the ground, dark-eyed juncos scratch away a roughly circular hole, 3 or 4 inches in diameter, to get at the grain underneath. In the summer, half of the diet consists of insects. Caterpillars, beetles, and ants are the most common items in their diet. There is also a long list of mostly weed plants whose seeds J. hyemalis is known to eat. The most common are ragweed, bristlegrass, dropseed grass, crabgrass, pigweed, and goosefoot. Juncos are morphologically generalized enough to handle both seeds and insects as part of their diet.

    Animal Foods: insects; terrestrial non-insect arthropods

    Plant Foods: seeds, grains, and nuts

    Primary Diet: omnivore

    • Dunning, J. 2001. New World Sparrows. Pp. 516-535 in C Elphick, J Dunning, D Sibley, eds. The Sibley Guide to Bird Life and Behavior. New York: Alfred A. Knopf.
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Comments: Diet includes seeds throughout the year, insects during the breeding season, and waste grain in fall and winter.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Associations

    Ecosystem Roles

    Dark-eyed juncos play an important role in their ecosystems. They disperse seeds and help to control insect populations. Brown-headed cowbirds (Molothrus_ater) sometimes lay their eggs in the nests of dark-eyed juncos. When this happens, the dark-eyed junco parents feed and protect the brown-headed cowbird chicks. Dark-eyed juncos also host many different parasites.

    Ecosystem Impact: disperses seeds

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Predation

    Dark-eyed juncos are killed by many different birds, including Accipiter striatus, Lanius and owls. They are also often killed by feral and domestic Felis domesticus. Red squirrels (Tamiasciurus_hudsonicus), weasels (genus Mustela), chipmunks (genus Tamias), American martens (Martes_americana) and other mammals as small as Zapus trinotatus take eggs and young from nests.

    When a predator approaches, dark-eyed juncos hide under whatever is nearby. If a predator comes near a nest, parents make "chip" sounds and fly around the nest area. They sometimes even dive at predators.

    Known Predators:

    • sharp-shinned hawks (Accipiter_striatus)
    • chipmunks (Tamias)
    • red squirrels (Tamiasciurus_hudsonicus)
    • shrikes (Lanius)
    • weasels (Mustela)
    • American martens (Martes_americana)
    • owls (Strigiformes)
    • feral cats (Felis_silvestris)
    • domestic cats (Felis_silvestris)

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Ecosystem Roles

    Dark-eyed juncos, like many other bird species, are an integral part of forested ecosystems and play an important role in maintaining the health and productivity of the forests and woodlands. Members of this species aid in the dispersal of seeds and help to control insect populations. They are occasionally parasitized by brown-headed cowbirds (Molothrus ater). Antibodies of the St. Louis strain of encephalitis have been reported in dark-eyed juncos and there are 26 other genera of parasites that have been reported to use this species as a host.

    Ecosystem Impact: disperses seeds

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Predation

    Because it inhabits open areas, Junco hyemalis is subject to attack by many different birds, including sharp-shinned hawks, shrikes and owls. They are also frequently killed by feral and domestic cats. Red squirrels (Tamiasciurus hudsonicus), weasels (genus Mustela), chipmunks (genus Tamias), American martens (Martes americana) and other mammals as small as jumping mice take eggs and young from nests.

    In response to predators, adults flee to nearby shelter. Parents give "chips" excitedly and fly around nest areas when predators are present and sometimes even dive at predators attempting to prey on nestlings or eggs.

    Known Predators:

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Known predators

    Junco hyemalis is prey of:
    Mustelinae
    Accipiter striatus
    Accipiter gentilis
    Accipiter
    Tamias
    Mustela
    Lanius excubitor
    Tamiasciurus hudsonicus
    Martes americana

    Based on studies in:
    USA: Arizona (Forest, Montane)

    This list may not be complete but is based on published studies.
    • D. I. Rasmussen, Biotic communities of Kaibab Plateau, Arizona, Ecol. Monogr. 11(3):228-275, from p. 261 (1941).
    • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
    Creative Commons Attribution 3.0 (CC BY 3.0)

    © SPIRE project

    Source: SPIRE

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Known prey organisms

    Junco hyemalis preys on:
    shrubs
    grass
    herbs
    Coleoptera
    Insecta
    ground invertebrates
    Arthropoda

    Based on studies in:
    USA: Arizona (Forest, Montane)

    This list may not be complete but is based on published studies.
    • D. I. Rasmussen, Biotic communities of Kaibab Plateau, Arizona, Ecol. Monogr. 11(3):228-275, from p. 261 (1941).
    • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
    Creative Commons Attribution 3.0 (CC BY 3.0)

    © SPIRE project

    Source: SPIRE

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Population Biology

    Number of Occurrences

    Note: For many non-migratory species, occurrences are roughly equivalent to populations.

    Estimated Number of Occurrences: > 300

    Comments: This species is represented by a very large number of occurrences (subpopulations).

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Global Abundance

    >1,000,000 individuals

    Comments: Total adult population size is unknown but certainly exceeds 1,000,000. Rich et al. (2004) estimated population size at 260,000,000.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Life History and Behavior

    Behavior

    Communication and Perception

    Dark-eyed juncos have many different songs. Their most common song is a simple, musical trill. Only male dark-eyed juncos sing. To show that they own a territory, males use a warbling song. They use different calls when they are alarmed or when fighting or scolding another.

    Dark-eyed juncos also use physical displays to show ownership of a territory and to attract a mate.

    Communication Channels: visual ; acoustic

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Communication and Perception

    Dark-eyed juncos (Junco hyemalis) possess considerable variation in song. The most common song is a simple, musical trill, all in one pitch, or a series of rapid notes which may be too rapid to discern. Only male dark-eyed juncos sing. To proclaim occupancy of a territory, two or three trills on different pitches may be joined to form a single warbling song. A simple explosive call is used as an alarm, while a smacking sequence is used to scold. This species uses a combination of twanging, buzzing, and smacking notes when fighting.

    Junco hyemalis also uses territorial and courtship displays to communicate (see Mating Systems and Behavior).

    Communication Channels: visual ; acoustic

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Life Expectancy

    Lifespan/Longevity

    Dark-eyed juncos usually live between 3 and 11 years. The oldest known wild dark-eyed junco lived at least 11 years and 1 month. Most juncos probably die due to predation by other species (hawks, squirrels, weasels, etc.).

    Range lifespan

    Status: wild:
    11.1 (high) years.

    Typical lifespan

    Status: wild:
    3 to 11 years.

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Lifespan/Longevity

    The average lifespan of J. hyemalis is approximately 3 to 11 years. The oldest known wild dark-eyed junco lived at least 11 years 1 month. Most commonly, predation by other species (hawks, squirrels, weasels, etc.) limits their lifespan.

    Range lifespan

    Status: wild:
    11.1 (high) years.

    Typical lifespan

    Status: wild:
    3 to 11 years.

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Lifespan, longevity, and ageing

    Maximum longevity: 11.3 years (wild) Observations: In the wild, these animals can live up to 11.3 years (Blumstein and Moller 2008).
    Creative Commons Attribution 3.0 (CC BY 3.0)

    © Joao Pedro de Magalhaes

    Source: AnAge

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Reproduction

    Dark-eyed juncos are monogamous. Males arrive at the breeding grounds very early in the spring. They claim a territory by singing from the top of the tallest trees in a 2 to 3 acre area. When a female enters a territory, the male follows her around. He spreads his tail and wings and struts around the female, making "chip" sounds and singing. He may move his tail up and down to show off his white feathers to the female. Males and females form pairs by mid-April. The males follow their mates around and usually stay within 50 feet of the female.

    Mating System: monogamous

    Dark-eyed juncos begin breeding in April. The female builds the nest and the male helps by bringing nest material. Nests are usually built on the ground near the edge of a forest opening. They are usually hidden under plants, logs, tree roots, or other shelters. Nests are sometimes built in a tree or shrub up to 8 feet above the ground. They are built of sticks, leaves and moss, and are lined with soft materials, like grasses, mosses or mammal hair. Each nest can be used to raise two or three broods in one season.

    The female lays 3 to 6 white or greenish eggs with brown spots. The eggs are usually slightly glossy and about 19 mm long. The female incubates the eggs for 12 to 13 days. The chicks are helpless when they hatch, but they are able to leave the nest after 9 to 13 days. The parents feed the chicks while they are in the nest and for about 3 weeks after they have left the nest. Most dark-eyed juncos begin breeding when they are 1 year old.

    Breeding interval: May breed 2 to 3 times during the spring and early summer each year

    Breeding season: Dark-eyed juncos begin breeding in April

    Range eggs per season: 3 to 6.

    Average eggs per season: 4.

    Average time to hatching: 12 to 13 days.

    Range fledging age: 9 to 13 days.

    Range time to independence: 9 to 21 days.

    Average age at sexual or reproductive maturity (female): 1 years.

    Average age at sexual or reproductive maturity (male): 1 years.

    Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

    Average time to hatching: 11 days.

    Average eggs per season: 4.

    The female parent incubates the eggs and broods the chicks after they hatch. Both parents defend the nest from predators and clean the nest by removing fecal sacs. They also feed the chicks regurgitated food and soft insects, such as caterpillars.

    Chicks are helpless (altricial) when they hatch. Their eyes begin to open after 2 days and they begin to grow feathers after 7 days. They develop strong leg muscles before they can fly so that they can run away from predators. They leave the nest after 9 to 13 days. The parents still feed the chicks for about 3 weeks after they leave the nest. If chicks beg from their parents after 3 weeks, the parents will chase them away.

    Parental Investment: no parental involvement; altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

    • Reader's Digest Association, 1991. Book of North American Birds. New York: Reader's Digest Association, Inc.
    • Bent, A., et al. 1968. Life Histories of North American Cardinals, Grosbeaks, Buntings, Towhees, Finches, Sparrows, and Allies: Part II. New York: Dover Publications.
    • United States Department of Agriculture, 1991. Forest and Rangeland Birds of the United States - Natural History and Habitat Use. United States Department of Agriculture Forest Service Agriculture Handbook 688.
    • Brewer, R., G. McPeek, R. Adams. 1991. The Atlas of Breeding Birds in Michigan. Lansing: Michigan State University Press.
    • Sullivan, K. 1999. Yellow-eyed Junco. The Birds of North America, No. 464, 1999, No. 464: 1-23.
    • Kennedy, D. 2002. "Birds of Stanford" (On-line). Stanford Alumni Association. Accessed March 23, 2004 at http://www.stanfordalumni.org/birdsite/.
    • Nolan, V., E. Keterson, D. Cristol, C. Rogers, E. Clotfelter, R. Titus, S. Schoech, E. Snajdr. 2002. Dark-eyed junco (Junco hyemalis). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 716. Philadelphia, PA: The Birds of North America, Inc.
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Dark-eyed juncos are monogamous. Males usually arrive on breeding grounds in the spring, well in advance of the start of nesting, and pairs are formed by mid-April. Males claim territories by singing from the top of the tallest trees in a 2 to 3 acre area. When a female enters his territory, the male pursues her aggressively. He spreads his tail and struts around the female, uttering "chips" and songs. The male may alternate dropping his tail to the ground with lifting it at a 45 degree angle. Once a pair is formed, males follow their mates and are seldom more than 50 feet away. The only exception is when the male proclaims his occupancy of a territory from a high perch.

    Mating System: monogamous

    The breeding season for dark-eyed juncos begins in April. Females build the nest over a period of 1 to 9 days, but the male often helps by bringing nest material. Nests are commonly built on the ground near the edge of openings in wooded areas or in a slight depression. They are usually well concealed under weeds, grasses, fallen logs, tree roots, or other overhead shelter. Nests are occasionally built up to 8 feet above ground in a shrub or tree. The nest cup is often lined with fine grasses, mosses or mammal hair and is used for two or three broods in one season.

    The female lays 3 to 6 white or pale green eggs spotted with brown. The eggs are usually ovate and slightly glossy. Average egg size is about 0.8 inches (19 mm). The incubation period lasts 12 to 13 days; incubation is usually done by the females. Chicks leave the nest 9 to 13 days after hatching. After leaving the nest, the young remain at least partially dependent on their parents for about 3 weeks. Most dark-eyed juncos begin breeding at at 1 year.

    Breeding interval: May breed 2 to 3 times during the spring and early summer each year

    Breeding season: Dark-eyed juncos begin breeding in April

    Range eggs per season: 3 to 6.

    Average eggs per season: 4.

    Average time to hatching: 12 to 13 days.

    Range fledging age: 9 to 13 days.

    Range time to independence: 9 to 21 days.

    Average age at sexual or reproductive maturity (female): 1 years.

    Average age at sexual or reproductive maturity (male): 1 years.

    Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

    Average time to hatching: 11 days.

    Average eggs per season: 4.

    The female parent incubates the eggs and broods the chicks after they hatch. Both parents defend the nest from predators, remove fecal sacs from the nest and feed the chicks regurgitated or partly digested food along with an occasional tender caterpillar. Chicks are altricial and begin to open their eggs at the end of the second day. Their feathers begin to show around the seventh day. Rapid tarsal development enables nestlings to run from the nest if threatened before they can fly. Youngsters leave the nest 9 to 13 days after hatching. After leaving the nest, the young remain at least partially dependent on their parents for food for about 3 weeks. Occasionally, young will attempt to solicit parental care and crouch in a begging posture even after they are adequately developed for independence. Parents become aggressive in these cases and chase the fledgling a short distance without feeding it.

    Parental Investment: no parental involvement; altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

    • Reader's Digest Association, 1991. Book of North American Birds. New York: Reader's Digest Association, Inc.
    • Bent, A., et al. 1968. Life Histories of North American Cardinals, Grosbeaks, Buntings, Towhees, Finches, Sparrows, and Allies: Part II. New York: Dover Publications.
    • United States Department of Agriculture, 1991. Forest and Rangeland Birds of the United States - Natural History and Habitat Use. United States Department of Agriculture Forest Service Agriculture Handbook 688.
    • Brewer, R., G. McPeek, R. Adams. 1991. The Atlas of Breeding Birds in Michigan. Lansing: Michigan State University Press.
    • Sullivan, K. 1999. Yellow-eyed Junco. The Birds of North America, No. 464, 1999, No. 464: 1-23.
    • Kennedy, D. 2002. "Birds of Stanford" (On-line). Stanford Alumni Association. Accessed March 23, 2004 at http://www.stanfordalumni.org/birdsite/.
    • Nolan, V., E. Keterson, D. Cristol, C. Rogers, E. Clotfelter, R. Titus, S. Schoech, E. Snajdr. 2002. Dark-eyed junco (Junco hyemalis). Pp. 1-44 in A Poole, F Gill, eds. The Birds of North America, Vol. 716. Philadelphia, PA: The Birds of North America, Inc.
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    In most areas, nesting occurs from April to as late as August, but earlier nesting may occur in southern lowland areas and fledging may sometime extend into September. Clutch size usually is 3-5. Incubation lasts about 11-12 days. Both parents feed nestling and newly fledged young.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Molecular Biology and Genetics

    Molecular Biology

    Barcode data: Junco hyemalis

    The following is a representative barcode sequence, the centroid of all available sequences for this species.


    There are 59 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

    CCTTTACCTTATTTTTGGCGCATGAGCCGGAATAGTGGGTACCGCTCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTCCTAGGAGACGACCAAGTCTATAACGTAGTCGTCACAGCCCACGCCTTCGTAATAATCTTCTTCATAGTCATACCAATTATAATCGGAGGATTTGGAAACTGACTAGTTCCACTAATAATCGGAGCCCCGGACATAGCATTCCCGCGAATAAATAACATAAGTTTTTGACTACTCCCCCCATCCTTTCTCCTCCTCCTAGCATCCTCTACCATTGAAGCAGGTGTCGGCACAGGCTGAACAGTATACCCCCCACTAGCAGGCAACCTAGCCCACGCTGGAGCCTCAGTCGACCTCGCAATCTTCTCCCTACACTTAGCCGGCATCTCCTCAATCCTAGGGGCCATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTTTCACAGTATCAAACCCCTTTATTTGTGTGATCAGTCCTAATCACTGCAGTCCTATTACTTCTATCTCTCCCAGTCCTTGCCGCAGGAATCACAATACTCCTCACAGACCGCAACCTTAACACTACATTCTTCGACCCCGCCGGAGGAGGAGATCCCGTCCTATACCAGCACCTATTCTGATTCTTCGGACACCCAGAAGTCTACATTCTAATCCTC
    -- end --

    Download FASTA File
    Creative Commons Attribution 3.0 (CC BY 3.0)

    © Barcode of Life Data Systems

    Source: Barcode of Life Data Systems (BOLD)

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Statistics of barcoding coverage: Junco hyemalis

    Barcode of Life Data Systems (BOLDS) Stats
    Public Records: 60
    Specimens with Barcodes: 63
    Species With Barcodes: 1
    Creative Commons Attribution 3.0 (CC BY 3.0)

    © Barcode of Life Data Systems

    Source: Barcode of Life Data Systems (BOLD)

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Conservation

    Conservation Status

    Dark-eyed juncos are protected under the US Migratory Bird Treaty Act. They are very common birds.

    IUCN Red List of Threatened Species: least concern

    US Migratory Bird Act: protected

    US Federal List: no special status

    CITES: no special status

    State of Michigan List: no special status

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    IUCN Red List Assessment


    Red List Category
    LC
    Least Concern

    Red List Criteria

    Version
    3.1

    Year Assessed
    2009

    Assessor/s
    BirdLife International

    Reviewer/s
    Bird, J., Butchart, S.

    Contributor/s

    Justification
    This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

    History
    • 2008
      Least Concern
    • 2004
      Not Recognized
    • 2000
      Not Recognized
    • 1994
      Not Recognized
    • 1988
      Not Recognized
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © International Union for Conservation of Nature and Natural Resources

    Source: IUCN

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Dark-eyed juncos are protected under the US Migratory Bird Treaty Act. They are quite abundant within their geographic range.

    US Migratory Bird Act: protected

    US Federal List: no special status

    CITES: no special status

    State of Michigan List: no special status

    IUCN Red List of Threatened Species: least concern

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    National NatureServe Conservation Status

    Canada

    Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

    United States

    Rounded National Status Rank: N5 - Secure

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    NatureServe Conservation Status

    Rounded Global Status Rank: G5 - Secure

    Reasons: Large range in North America; very large population size; many occurrences; apparently slowly declining.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Global Short Term Trend: Relatively stable to decline of 30%

    Comments: BBS data suggest that the species has declined slowly over the past 10 years or three generations.

    Global Long Term Trend: Decline of 30-50%

    Comments: Long-term decline over the past 200 years is unknown. Breeding Bird Survey (BBS) data for 19662007 indicate a signidicant survey-wide decline of 1.3% per year; this amounts to a 42% decline over this time period. BBS abundance (average number of bird per route) declined from roughly 8-9 in the 1960s and 1970s to around 6 in 2000-2007. Overall, based on BBS data, the species appears to have undergone a slow but steady decline in abundance over the past several decades.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Threats

    Major Threats
    As a whole, the species is not under immediate threat, but the subspecies J. h. insularis has been threatened by extremely intense grazing by goats. The largest tract of remnant cypress forest on Guadalupe Island was c.3 km long in 1971, but only c.1 km by 1988. Smaller forest patches presumably experience similar intense grazing, leading to a total lack of regeneration. Feral cats were common in 1988 and presumably prey upon this species. Numbers have increased in recent years owing to habitat management and the culling of goats.
    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © International Union for Conservation of Nature and Natural Resources

    Source: IUCN

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Comments: No major threats have been identified. Causes of the slow, apparently ongoing decline are not known.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Management

    Conservation Actions

    Conservation Actions
    Conservation Actions Underway
    In the context of J. h. insularis, Guadalupe is designated as a biosphere reserve (S. N. G. Howell in litt. 1998), but historically there has been little active management (Mirsky 1976. 5. Stattersfield et al. 1998). Nearly 35,000 goats were removed in 1970 and 1971, but in the late 1990s numbers were still estimated at 10,000 individuals (Stattersfield et al. 1998). There is apparently governmental interest in eradicating introduced predators and herbivores (B. Tershy and B. Keitt in litt. 1999), and non-governmental organisations in the region are developing the capacity to undertake eradication programmes on such large islands (B. Tershy and B. Keitt in litt. 1999). There is potential for the removal of these introduced species by 2010 (B. Tershy and B. Keitt in litt. 1999).

    Conservation Actions Proposed
    The following measures have been proposed for the conservation of J. h. insularis: Eradicate goats and cats from the island (B. Tershy and B. Keitt in litt. 1999). Survey to provide a more recent assessment of the population size and remaining habitat.

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © International Union for Conservation of Nature and Natural Resources

    Source: IUCN

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Global Protection: Very many (>40) occurrences appropriately protected and managed

    Comments: Many occurrences are in protected areas.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Relevance to Humans and Ecosystems

    Benefits

    Economic Importance for Humans: Negative

    There are no known adverse affects of dark-eyed juncos on humans.

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Economic Importance for Humans: Positive

    Dark-eyed juncos do not really affect humans, though many people enjoy photographing them or watching them at bird feeders. They also eat some insects that are pests.

    Positive Impacts: controls pest population

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Economic Importance for Humans: Negative

    There are no known adverse affects of dark-eyed juncos on humans.

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Economic Importance for Humans: Positive

    Junco hyemalis has little, if any, economic importance for humans. This species is an excellent subject for photography and art and provides an enjoyable pastime for many bird watchers. Due to the fact that they are commonly found at bird feeders during migration and winter months, they may play a small part in the sale and production of bird seed, bird feeders and binoculars. Juncos also eat insects that humans may consider pests.

    Positive Impacts: controls pest population

    Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

    © The Regents of the University of Michigan and its licensors

    Source: Animal Diversity Web

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Wikipedia

    Dark-eyed Junco

    The Dark-eyed Junco (Junco hyemalis) is the best-known species of the juncos, a genus of small grayish American sparrows. This bird is common across much of temperate North America and in summer ranges far into the Arctic. It is a very variable species, much like the related Fox Sparrow (Passerella iliaca), and its systematics is still not completely untangled.

    Contents

    Description

    Female Slate-colored Junco (Junco hyemalis hyemalis)

    Adults generally have gray heads, necks, and breasts, gray or brown backs and wings, and a white belly, but show a confusing amount of variation in plumage details. The white outer tail feathers flash distinctively in flight and while hopping on the ground. The bill is usually pale pinkish.[2]

    Males tend to have darker, more conspicuous markings than the females. The Dark-eyed Junco is 13 to 17.5 cm (5.1 to 6.9 in) long and has a wingspan of 18 to 25 cm (7.1 to 9.8 in).[2][3] Body mass can vary from 18 to 30 g (0.63 to 1.1 oz).[2] Among standard measurements, the wing chord is 6.6 to 9.3 cm (2.6 to 3.7 in), the tail is 6.1 to 7.3 cm (2.4 to 2.9 in), the bill is 0.9 to 1.3 cm (0.35 to 0.51 in) and the tarsus is 1.9 to 2.3 cm (0.75 to 0.91 in).[4] Juveniles often have pale streaks and may even be mistaken for Vesper Sparrows (Pooecetes gramineus) until they acquire adult plumage at 2 to 3 months. But junco fledglings' heads are generally quite uniform in color already, and initially their bills still have conspicuous yellowish edges to the gape, remains of the fleshy wattles that guide the parents when they feed the nestlings.

    The song is a trill similar to the Chipping Sparrow's (Spizella passerina), except that the Red-backed Junco's (see below) song is more complex, similar to that of the Yellow-eyed Junco (Junco phaeonotus). The call also resembles that of the Black-throated blue warblers, which is a member of the New World Warbler family.[5] Calls include tick sounds and very high-pitched tinkling chips.[6]

    A sample of the song can be heard at the USGS web site here (MP3) or at the Cornell Lab of Ornithology web site here.

    Taxonomy

    The Dark-eyed Junco was first described by Linnaeus in his 1758 Systema naturae as Fringilla hyemalis. The description consisted merely of the laconic remark "F[ringilla] nigra, ventre albo. ("A black 'finch' with white belly"), a reference to a source, and a statement that it came from "America".[7]

    Linnaeus' source was Mark Catesby who described the Slate-colored Junco before binomial nomenclature as his "snow-bird", moineau de neige or passer nivalis ("snow sparrow") thus:

    "The Bill of this Bird is white: The Breast and Belly white. All the rest of the Body black; but in some places dusky, inclining to Lead-color. In Virginia and Carolina they appear only in Winter : and in Snow they appear most. In Summer none are seen. Whether they retire and breed in the North (which is most probable) or where they go, when they leave these Countries in Spring, is to me unknown." [italics in original][8]

    Still, at least the Slate-colored Junco is unmistakable enough to make it readily recognizable even from Linnaeus' minimal description. Its modern scientific name means "winter junco", from Latin hyemalis "of the winter".

    Subspecies

    There are several subspecies, making up 2 large groups and 3–5 small or monotypic ones. The five basic groups were formerly considered separate species (and the Guadalupe Junco frequently still is), but they interbreed extensively in areas of contact. Birders trying to identify subspecies are advised to consult detailed identification references.[6][9]

    Slate-colored Juncos

    Male and female Junco hyemalis
    • Junco hyemalis hyemalis
    • Junco hyemalis carolinensis
    • Junco hyemalis cismontanus (perhaps an Oregon x Slate-colored cross)

    This group has dark slate-gray head, breast and upperparts. Females are brownish gray, sometimes with reddish-brown flanks.[6] They breed in North American taiga forests from Alaska to Newfoundland and south to the Appalachian Mountains, wintering through most of the USA. They are relatively common across their range.

    White-winged Junco

    • Junco hyemalis aikeni

    The White-winged Junco has a medium-gray head, breast, and upperparts with white wing bars. Females are washed brownish. It has more white in the tail than the other forms. It is a common endemic breeder in the Black Hills area of South Dakota, Wyoming, Nebraska, and Montana, and winters south to northeastern New Mexico.[6][2]

    Oregon Juncos

    Oregon Junco
    • Junco hyemalis montanus
    • Junco hyemalis oreganus
    • Junco hyemalis pinosus
    • Junco hyemalis pontilis
    • Junco hyemalis shufeldti
    • Junco hyemalis thurberi
    • Junco hyemalis townsendi

    These have a blackish-gray head and breast with a brown back and wings and reddish flanks, tending toward duller and paler plumage in the inland and southern parts of its range.[9] This is the most common form in the west, found in the Pacific coast mountains from southeastern Alaska to extreme northern Baja California, wintering to the Great Plains and northern Sonora. There is an unresolved debate whether this large and distinct group is not better treated as a full species.

    Pink-sided Junco

    Pink-sided Junco

    • Junco hyemalis mearnsi

    Often considered part of the Oregon group, it has a lighter gray head and breast than the Oregon group with contrasting dark lores. The back and wings are brown. It has pinkish-cinnamon color that is richer and covers more of the flanks and breast than in Oregon Juncos. It breeds in the northern Rocky Mountains from southern Alberta to eastern Idaho and western Wyoming; it winters in central Idaho and nearby Montana and from southwestern South Dakota, southern Wyoming, and northern Utah to northern Sonora and Chihuahua.[9]

    Gray-headed Junco

    Gray-headed Junco

    • Junco hyemalis caniceps

    This subspecies is essentially rather light gray on top with a rusty back. It breeds in the southern Rocky Mountains from Colorado to central Arizona and New Mexico, and winters into northern Mexico.[6][2]

    Red-backed Junco

    • Junco hyemalis dorsalis

    Often included with J. h. caniceps as Gray-headed Juncos. It differs from the Gray-headed Junco proper in having a more silvery bill[9] with a dark upper mandible,[6][2] a variable amount of rust on the wings, and pale underparts. This makes it similar to the Yellow-eyed Junco (J. phaeonotus) except for the dark eye. It is found in the southern mountains of Arizona and New Mexico.[6] It does not overlap with the Yellow-eyed Junco in breeding range.

    Guadalupe Junco

    • Junco hyemalis insularis

    The extremely rare Guadalupe Junco is also considered part of this species by some authors, namely the IUCN which restores it to subspecies status in 2008.[10][11] Other authors consider it a species in its own right – perhaps a rather young one, but certainly this population has evolved more rapidly than the mainland juncos due to its small population size and the founder effect.

    Ecology

    Fledgling Pink-sided Junco (Junco hyemalis mearnsi) at about 1 month after hatching, Yellowstone National Park.

    Their breeding habitat is coniferous or mixed forest areas throughout North America. In otherwise optimal conditions they also utilize other habitat, but at the southern margin of its range it can only persist in its favorite habitat.[12] Northern birds migrate further south, arriving in their winter quarters between mid-September and November and leaving to breed from mid-March onwards, with almost all gone by the end of April or so.[13][12] Many populations are permanent residents or altitudinal migrants, while in cold years birds may choose to stay in the winter range and breed there.[12] In winter, juncos are familiar in and around towns, and in many places are the most common birds at feeders.[2] The Slate-colored Junco is a rare vagrant to western Europe and may successfully winter in Great Britain, usually in domestic gardens.

    These birds forage on the ground. In winter, they often forage in flocks that may contain several subspecies. They mainly eat insects and seeds.

    Nest with eggs

    They usually nest in a cup-shaped depression on the ground, well hidden by vegetation or other material, although nests are sometimes found in the lower branches of a shrub or tree. The nests have an outer diameter of about 10 cm and are lined with fine grasses and hair. Normally two clutches of 4 eggs are laid during the breeding season. The slightly glossy eggs are grayish or pale bluish-white and heavily spotted (sometimes splotched) with various shades of brown, purple or gray. The spotting is concentrated at the large end of the egg. The eggs are incubated by the female for 12 to 13 days. Young leave nest between 11 and 14 days after hatching.

    References

    Junco hyemalis in flight
    1. ^ BirdLife International (2012). "Junco hyemalis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
    2. ^ a b c d e f g Cornell Lab of Ornithology (2002): Bird Guide – Dark-eyed Junco. Retrieved 2007-JAN-20.
    3. ^ Rising, J.D. (2010) A Guide to the Identification and Natural History of the Sparrows of the United States and Canada. Christopher Helm Publishers, London, ISBN 1408134608.
    4. ^ Sparrows and Buntings: A Guide to the Sparrows and Buntings of North America and the World by Clive Byers & Urban Olsson. Houghton Mifflin (1995). ISBN 978-0395738733.
    5. ^ "Black-throated Blue Warbler (Dendroica caerulescens)". Birds in Forested Landscapes. Cornell Lab of Ornithology. 
    6. ^ a b c d e f g Sibley, David Allen (2000): The Sibley Guide to Birds. Alfred A. Knopf, New York, pp. 500–502, ISBN 0-679-45122-6
    7. ^ Linnaeus, Carl (1758): 98.30. Fringilla hyemalis. In: Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis (10th ed., vol.1): 183. Laurentius Salvius, Holmius (= Stockholm).
    8. ^ Catesby, Mark (1731): 36. Passer nivalis. In: The Natural History of Carolina, Florida and the Bahamas (vol.1): Spread 65.
    9. ^ a b c d Dunn, Jon L. (2002). "The identification of Pink-sided Juncos, with cautionary notes about plumage variation and hybridization". Birding 34 (5): 432–443. 
    10. ^ BirdLife International (2008) Guadalupe Junco Species Factsheet. Retrieved 2008-MAY-26.
    11. ^ BirdLife International (2008): 2008 IUCN Redlist status changes. Retrieved 2008-MAY-23.
    12. ^ a b c Ohio Ornithological Society (2004): Annotated Ohio state checklist.
    13. ^ Henninger, W.F. (1906). "A preliminary list of the birds of Seneca County, Ohio". Wilson Bulletin 18 (2): 47–60. 
    Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

     

    Source: Wikipedia

    Unreviewed

    Article rating from 0 people

    Average rating: 2.5 of 5

    Names and Taxonomy

    Taxonomy

    Comments: The several recognizable groups or subspecies of dark-eyed juncos formerly were recognized as distinct species. Further genetic studies are likely to alter current views on the relationships of these groups and other junco species.

    The groups of this complex that have been treated as species by many authors include: hyemalis (Slate-colored Junco); oreganus (Oregon Junco); aikeni (White-winged Junco); caniceps (Gray-headed Junco); and insularis (Guadalupe Junco) (AOU 1998); insularis is an isolated population closest to oreganus (AOU 1983); mearnsi form (Pink-sided Junco) may represent a distinct group from oreganus, and dorsalis form (Red-backed Junco) may represent a distinct group from caniceps (AOU 1998), and both formerly were treated as separate species.

    Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

    © NatureServe

    Source: NatureServe

    Trusted

    Article rating from 0 people

    Average rating: 2.5 of 5

    Disclaimer

    EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

    To request an improvement, please leave a comment on the page. Thank you!