Articles on this page are available in 1 other language: Spanish (7) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thraupis episcopus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGACATTGGCACCCTGTACCTAATCTTTGGCGCATGAGCCGGGATAGTAGGTACTGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAATCTACAACGTAGTCGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGGTTTGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTTCTCCTCCTAGCATCCTCTACAGTGGAAGCAGGTGCTGGGACAGGATGAACTGTATACCCGCCACTAGCTGGCAACCTAGCCCACGCCGGAGCCTCCGTCGACCTTGCAATCTTCTCCCTACATCTAGCTGGCATCTCTTCAATTCTAGGGGCAATCAACTTCATTACCACAGCCATCAACATAAAACCGCCCGCCCTGTCACAATACCAAACTCCCCTGTTCGTCTGATCCGTCTTAATTACTGCAGTCCTACTGCTCCTGTCCCTACCAGTTCTCGCCGCAGGAATCACAATACTTCTCACAGACCGCAACCTTAACACCACATTCTTTGACCCTGCTGGAGGAGGAGACCCCGTCCTGTACCAACACCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thraupis episcopus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight (A. Panjabi in litt. 2008)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue-gray Tanager

The Blue-grey Tanager (Thraupis episcopus) is a medium-sized South American songbird of the Tanager family, Thraupidae. Its range is from Mexico south to northeast Bolivia and northern Brazil, all of the Amazon Basin, except the very south. It has been introduced to Lima (Peru). On Trinidad and Tobago, this bird is called Blue Jean.

T. e. neosophilus at the Asa Wright Nature Center in Trinidad

The Blue-grey Tanager is 16–18 cm (6.3-7.1 in) long and weighs 30-40 grams (1.1-1.4 oz.) Adults have a light bluish head and underparts, with darker blue upperparts and a shoulder patch colored a different hue of blue. The bill is short and quite thick. Sexes are similar, but the immature is much duller in plumage.

The song is a squeaky twittering, interspersed with tseee and tsuup call notes.

13-15 subspecies are commonly recognized, differing according to the exact hue of blue of the shoulder patch versus the rest of the plumage; they may be greyish, greenish or purplish-blue, with a lavender, dark blue or whitish shoulder patch. For example, T. e. berlepschi (endemic to Tobago) is a brighter and darker blue on the rump and shoulder, T. e. neosophilus with a violet shoulder patch occurs in northern Venezuela, Trinidad, eastern Colombia and the far north of Brazil, T. e. mediana of the southern Amazon basin has a white wing patch, and T. e. cana in the northern Amazon has blue shoulders.

The breeding habitat is open woodland, cultivated areas and gardens. The Blue-grey Tanager lives mainly on fruit, but will also take some nectar and insects.[2] This is a common, restless, noisy and confiding species, usually found in pairs, but sometimes small groups. It thrives around human habitation, and will take some cultivated fruit like papayas (Carica papaya).

One to three, usually two, dark-marked whitish to grey green eggs are laid in a deep cup nest in a high tree fork or building crevice.[2] Incubation by the female is 14 days with another 17 to fledging. The nest is sometimes parasitised by Molothrus cowbirds.

Two birds studied in the Parque Nacional de La Macarena of Colombia were infected with microfilariae, an undetermined Trypanosoma species, and another blood parasite that could not be identified. Two other birds, examined near Turbo (also in Colombia), did not have blood parasites.[3]

Widespread and common throughout its large range, the Blue-grey Tanager is evaluated as Least Concern on the IUCN Red List of Threatened Species.[4]

Contents

Gallery

Footnotes

References

  • Basto, Natalia; Rodríguez, Oscar A.; Marinkelle, Cornelis J.; Gutierrez, Rafael & Matta, Nubia Estela (2006): Haematozoa in birds from la Macarena National Natural Park (Colombia). Caldasia 28(2): 371-377 [English with Spanish abstract]. PDF fulltext
  • Londono, Aurora; Pulgarin-R., Paulo C. & Blair, Silva (2007): Blood Parasites in Birds From the Lowlands of Northern Colombia. Caribb. J. Sci. 43(1): 87-93. PDF fulltext

Further reading

  • ffrench, Richard; O'Neill, John Patton & Eckelberry, Don R. (1991): A guide to the birds of Trinidad and Tobago (2nd edition). Comstock Publishing, Ithaca, N.Y.. ISBN 0-8014-9792-2
  • Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!