Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Range

S Mexico (se Veracruz and ne Oaxaca) to w Panama.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Ramphocelus passerinii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Ramphocelus passerinii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTGTACCTAATCTTCGGCGCATGGGCCGGAATAGTAGGTACTGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCTCTCCTGGGAGACGACCAAGTCTACAACGTGGTCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATGCCAATTATGATCGGGGGATTCGGGAACTGACTAGTCCCATTAATAATCGGAGCCCCAGACATAGCATTCCCACGGATAAACAACATAAGCTTTTGACTACTTCCCCCATCTTTCCTTCTCCTCCTGGCATCTTCTACAGTCGAAGCAGGAGTTGGTACAGGTTGAACAGTATATCCCCCACTAGCTGGTAACCTAGCCCACGCCGGAGCCTCAGTCGACTTAGCAATCTTCTCCCTACACCTGGCTGGCATCTCTTCAATCCTTGGAGCAATCAACTTCATCACAACAGCAATCAACATAAAACCCCCCGCTCTCTCACAGTACCAAACTCCCCTATTCGTATGATCGGTCTTAATCACTGCAGTCTTACTGCTCCTGTCCCTTCCAGTCCTTGCTGCAGGAATCACAATACTCCTGACGGACCGCAACCTTAACACCACATTTTTCGACCCCGCTGGAGGAGGAGACCCCGTACTATACCAACACCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight (A. Panjabi in litt. 2008)

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Passerini's Tanager

Passerini's tanager, Ramphocelus passerinii, is a medium-sized passerine bird. This tanager is a resident breeder in the Caribbean lowlands from southern Mexico to western Panama. This species was formerly known as the scarlet-rumped tanager, but was renamed when the distinctive form found on the Pacific coast of Costa Rica and Panama was reclassified as a separate species, the Cherrie's tanager, Ramphocelus costaricensis. While most authorities have accepted this split, there are notable exceptions (e.g. the Howard and Moore checklist).

This species was named for Carlo Passerini, a professor at the Museum of Zoology of the University of Florence.[2]

Description[edit]

Male in Costa Rica

The adult Passerini's tanager is 16 cm long and weighs 31 g. The adult male is mainly black except for a scarlet rump, silvery bill and dark red iris. The female has a grey head, olive upperparts becoming brighter and paler on the rump, brownish wings and tail and ochre underparts. The female's plumage is the one that differs most from Cherrie's tanager. Immatures have an orange tint to the underparts and rump, and look like a paler and duller female Cherrie's tanager.

The Passerini's tanager's call is a sharp wac. Its song consists of a few clear pleasant notes, delivered in shorter phrases than that of its Pacific relative.

Ecology[edit]

It is very common from sea level to 1200 m altitude, and occurs occasionally up to 1700 m. The preferred habitat is semi-open areas including light second growth, woodland edges, gardens and pasture with bushes.

Passerini's tanagers occur in pairs, small groups, or as part of a mixed-species feeding flock, and up to a dozen birds may roost together in dense thickets at night. This species feeds on certain small fruit,[3] usually swallowed whole, insects and spiders.

The cup nest is built up to 6 m high in a tree. The normal clutch is two pale blue or grey eggs, marked with black, brown or lilac. This species will sometimes raise two broods in a season

References[edit]

  1. ^ BirdLife International (2012). "Ramphocelus passerinii". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Beolens, Bo; Watkins, Michael (2003). Whose Bird? Men and Women Commemorated in the Common Names of Birds. London: Christopher Helm. p. 264. 
  3. ^ E.g. of Trophis racemosa (Moraceae): Foster (2007)

References[edit]

  • Foster, Mercedes S. (2007): The potential of fruiting trees to enhance converted habitats for migrating birds in southern Mexico. Bird Conservation International 17(1): 45-61. doi:10.1017/S0959270906000554 PDF fulltext
  • Stiles, F. Gary & Skutch, Alexander Frank (1989): A guide to the birds of Costa Rica. Comistock, Ithaca. ISBN 0-8014-9600-4
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!