Articles on this page are available in 1 other language: Chinese (Simplified) (9) (learn more)

Overview

Distribution

Range

Rocky regions of s Palearctic region; winters to e Africa.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monticola saxatilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAGCTGGGCCAACCAGGCGCCCTACTAGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCATGCTTTCGTAATAATTTTCTTCATAGTCATACCAATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCCTTCCCCCGAATAAACAATATAAGCTTCTGACTACTCCCCCCATCCTTCCTACTCCTCCTAGCCTCCTCTACCGTTGAAGCAGGGGTAGGAACCGGCTGAACTGTATACCCCCCCCTAGCCGGCAACTTAGCCCACGCCGGAGCCTCAGTCGACCTAGCCATCTTCTCTCTCCACTTAGCAGGTATCTCTTCAATCCTAGGCGCTATCAACTTTATCACAACAGCAATCAACATAAAACCTCCAGCTCTTTCACAGTACCAAACTCCCCTCTTCGTATGATCCGTCCTAATTACTGCAGTCCTTCTCCTGCTATCCCTCCCAGTTCTAGCTGCAGGCATTACCATGCTTCTCACCGACCGTAATCTAAATACTACCTTCTTCGACCCTGCAGGAGGAGGAGACCCAGTACTCTACCAACATCTCTTCTGATTCTTCGGACACCCAGAAGTTTATATCCTGATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Monticola saxatilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 100,000-320,000 breeding pairs, equating to 300,000-960,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 612,000-3,840,000 individuals, although further validation of this estimate is needed.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Rock Thrush

Female or juvenile male specimen
Nairobi National Museum

The common rock thrush (Monticola saxatilis),[2] formerly rufous-tailed rock thrush or rock thrush, is a chat belonging to the Muscicapidae family. It was formerly placed in the Turdidae family.

It breeds in southern Europe across central Asia to northern China. This species is strongly migratory, all populations wintering in Africa south of the Sahara. It is an uncommon visitor to northern Europe. Its range has contracted somewhat at the periphery in recent decades due to habitat destruction. For example, in the early 20th century it bred in the Jura Krakowsko-Częstochowska (Poland) where none occur today,[3] but it is not considered globally endangered.[1]

Description[edit]

This is a medium-sized but stocky thrush 17–20 cm in length. The summer male is unmistakable, with a blue-grey head, orange underparts and outer tail feathers, dark brown wings and white back. Females and immatures are much less striking, with dark brown scaly upperparts, and paler brown scaly underparts. The outer tail feathers are reddish, like the male.[4]

Behaviour and ecology[edit]

This species breeds in open dry hilly areas, usually above 1500 m. It nests in rock cavities, laying 4–5 eggs. It is omnivorous, eating a wide range of insects, berries and small reptiles. The male Common Rock Thrush has a clear and tuneful song.[4]

References[edit]

  1. ^ a b BirdLife International (2012). "Monticola saxatilis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ English Name Updates - IOC Version 2.9 (July 10, 2011), IOC World Bird List
  3. ^ Tomek, Teresa & Bocheński, Zygmunt (2005): Weichselian and Holocene bird remains from Komarowa Cave, Central Poland. Acta zoologica cracoviensia 48A(1-2): 43-65. PDF fulltext
  4. ^ a b Clement, Peter & Hathaway, Ren (2000): Thrushes. Christopher Helm, London. ISBN 0-7136-3940-7
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!